Саркопения и нервно мышечный аппарат: Нервно-мышечный аппарат — Департамент физической культуры и спорта

Содержание

Нервно-мышечный аппарат — Департамент физической культуры и спорта

В. Н. Селуянов, В. А. Рыбаков, М. П. Шестаков

Глава 1. Модели систем организма

1.1.2. Нервно-мышечный аппарат

Человек выполняет физические упражнения и тратит энергию с помощью нервно мышечного аппарата.

Нервно-мышечный аппарат — это совокупность двигательных единиц. Каждая ДЕ включает мотонейрон, аксон и совокупность мышечных волокон. Количество ДЕ остается неизменным у человека (Физиология человека, 1998). Количество МВ в мышце возможно и поддается изменению в ходе тренировки, однако, не более чем на 5 % (Хоппелер, 1987). Поэтому этот фактор роста функциональных возможностей мышцы не имеет практического значения. Внутри МВ происходит гиперплазия (рост количества элементов) многих органелл: миофибрилл, митохондрий, саркоплазматического ретикулума (СПР), глобул гликогена, миоглобина, рибосом, ДНК и др. Изменяется также количество капилляров, обслуживающих МВ (Физиология мышечной деятельности, 1982).

Миофибрилла является специализированной органеллой мышечного волокна (клетки). Она у всех животных имеет примерно равное поперечное сечение. Состоит из последовательно соединенных

саркомеров, каждый из которых включает нити актина и миозина. Между нитями актина и миозина могут образовываться мостики и при затрате энергии, заключенной в АТФ, может происходить поворот мостиков, т. е. сокращение миофибриллы, сокращение мышечного волокна, сокращение мышцы. Мостики образуются в присутствии в саркоплазме ионов кальция и молекул АТФ, в расслабленном мышечном волокне концентрация ионов кальция очень низкая. Увеличение количества миофибрилл в мышечном волокне приводит к увеличению его силы, скорости сокращения и размера. Вместе с ростом миофибрилл происходит разрастание и других обслуживающих миофибриллы органелл, например, саркоплазматического ретикулума.

Саркоплазматический ретикулум — это сеть внутренних мембран, которая образует пузырьки, канальцы, цистерны. В МВ СПР образует цистерны, в этих цистернах скапли-ваются ионы кальция (Са). Предполагается, что к мембранам СПР прикреплены ферменты гликолиза, поэтому при прекращении доступа кислорода происходит значительное разбухание каналов. Это явление связано с накоплением ионов водорода (Н), которые вызывают частичное разрушение (денатурацию) белковых структур, присоединение воды к радикалам белковых молекул (Меерсон Ф. З., 1965, 1975, 1981, 1988; Панин Л. Е., 1983; Hoppeler H., 1985, 1986). Для механизма мышечного сокращения принципиальное значение имеет скорость откачивания Са из саркоплазмы, поскольку это обеспечивает процесс расслабления мышцы. В мембраны СПР встроены натрий калиевые и кальциевые насосы, поэтому можно предположить, что увеличение поверхности мембран СПР по отношению к массе миофибрилл должно вести к росту скорости расслабления МВ. Следовательно, увеличение максимального темпа или скорости расслабления мышцы (интервала времени от конца электрической активации мышцы до падения механического напряжения в ней до нуля) должно говорить об относительном приросте мембран СПР.

Поддержание максимального темпа обеспечивается запасами в МВ АТФ, КрФ, массой миофибриллярных митохондрий, массой саркоплазматических митохондрий, массой гликолитических ферментов и буферной емкостью содержимого мышечного волокна и крови. Все эти факторы влияют на процесс энергообеспечения мышечного сокращения, однако, способность поддерживать максимальный темп должна зависеть преимущественно от митохондрий СПР. Увеличивая количество окислительных МВ или, другими словами, аэробных возможностей мышцы, продолжительность упражнения с максимальной мощностью растет. Обусловлено это тем, что поддержание концентрации КрФ в ходе гликолиза ведет к закислению МВ, торможению процессов расхода АТФ из за конкурирования ионов Н с ионами Са на активных центрах головок миозина (Hermansen, 1981). Поэтому процесс поддержания концентрации КрФ при преобладании в мышце аэробных процессов идет по мере выполнения упражнения все более эффективнее. Важно также то, что митохондрии активно поглощают ионы водорода (Hermansen, 1981; Holloshzy, 1971. 1975; Hoppeler, 1986), поэтому при выполнении кратковременных предельных упражнений (10-30 с) их роль больше сводится к буферированию закисления клетки.

Митохондрии располагаются везде, где требуется в большом количестве энергия АТФ. В мышечных волокнах энергия требуется для сокращения миофибрилл, поэтому вокруг них образуются миофибриллярные митохондрии (Лениджер, 1966; Лузиков, 1980).



Заболевания опорно-двигательного аппарата

Масштабы проблемы

Нарушения и болезни костно-мышечной системы – это более 150 нарушений здоровья, поражающих опорно-двигательный аппарат. Они варьируются в широком диапазоне: от острых и кратковременных явлений — переломов, растяжений и вывихов — до пожизненных нарушений, сопровождающихся постоянным снижением функциональных возможностей и инвалидностью. Нарушения и болезни костно-мышечной системы обычно характеризуются болевыми ощущениями (нередко постоянного характера), снижением подвижности, ухудшением моторики и функциональных возможностей в целом, что ограничивает способность человека к трудовой деятельности. 

Нарушения и болезни костно-мышечной системы включают в себя нарушения, поражающие:

  • суставы, в частности, остеоартрит, ревматоидный артрит, псориатический артрит, подагру, анкилозирующий спондилоартрит;
  • костные ткани, в частности, остеопороз, остеопению и связанные с этим переломы в результате хрупкости костей или травм;
  • мышцы, в частности, саркопению;
  • позвоночник, в частности, люмбаго и цервикалгию;
  • различные части тела или системы организма, в частности, регионарные и распространенные болевые синдромы и воспалительные заболевания, такие как заболевания соединительных тканей и васкулит, характеризующиеся симптомами со стороны костно-мышечной системы, или системная красная волчанка.  

Помимо всего, нарушения и болезни костно-мышечной системы являются самым главным фактором, обусловливающим глобальную потребность в реабилитационных услугах. Они входят в число основных причин, определяющих спрос на такие услуги для детей, а примерно две трети взрослого населения, нуждающегося в реабилитационных услугах, – это люди, страдающие от нарушений и болезней костно-мышечной системы.

Распространенность проблемы

Данные недавнего исследования «Глобальное бремя болезней» (ГБВ) свидетельствуют о том, что примерно 1,71 миллиарда человек в мире страдают от нарушений и болезней костно-мышечной системы (1). Хотя распространенность болезней костно-мышечной системы различается в зависимости от возраста и диагноза, от них страдают люди любого возраста повсюду в мире. Наиболее сильно затронуто такими болезнями население стран с высоким доходом (441 миллион человек), далее идут жители Региона Западной части Тихого океана (427 миллионов человек) и Региона Юго-Восточной Азии (369 миллионов человек). Нарушения и болезни костно-мышечной системы также занимают ведущее место среди факторов инвалидности в мире: на них приходится примерно 149 миллионов лет жизни, прожитых с инвалидностью, что в глобальном масштабе составляет 17% всех лет, прожитых с инвалидностью, обусловленной разными причинами.

На люмбаго приходится основная доля общего бремени нарушений и болезней костно-мышечной системы. Среди других факторов, влияющих на это бремя, следует назвать переломы (436 миллионов человек в мире), остеоартрит (343 миллиона человек), прочие травмы (305 миллионов человек), цервикалгия (222 миллиона человек), ампутации (175 миллионов человек) и ревматоидный артрит (14 миллионов человек) (1).

Хотя распространенность нарушений и болезней костно-мышечной системы увеличивается с возрастом, ими страдают и более молодые люди, причем нередко в годы наибольшей экономической активности. Люмбаго, например, является основной причиной преждевременного прекращения трудовой деятельности. Неблагоприятные последствия этого для общества поистине огромны не только с точки зрения прямых затрат на медико-санитарное обслуживание, но и с точки зрения косвенных издержек (которые выражаются в пропусках работы, снижении производительности). Кроме того, нарушения и болезни костно-мышечной системы тесно связаны со значительным ухудшением психического здоровья и снижением функциональных возможностей. Согласно прогнозам, в будущем число людей, страдающих от люмбаго, будет только возрастать, причем наиболее быстрыми темпами – в странах с низким и средним уровнем дохода (2).

Разработанный ВОЗ инструмент для оценки потребностей в реабилитационных услугах WHO Rehabilitation Need Estimator предоставляет уникальную возможность получать данные о распространенности нарушений и болезней костно-мышечной системы в отдельных странах, регионах и в мире в целом, а также данные о годах жизни, прожитых с инвалидностью, обусловленной нарушениями и болезнями костно-мышечной системы.

Деятельность ВОЗ

В 2017 г. ВОЗ учредила инициативу «Реабилитация-2030: призыв к действиям» в целях привлечения внимания к острой неудовлетворенной потребности в реабилитационных услугах во всем мире и к важности укрепления систем здравоохранения в части предоставления реабилитационных услуг. Эта инициатива знаменует собой новый стратегический подход к глобальному реабилитационному сообществу, акцентируя внимание на том, что:   

  • Реабилитационные услуги должны быть доступны для всего населения на протяжении всей жизни. Это относится и ко всем людям с нарушениями и болезнями костно-мышечной системы.
  • Усилия по укреплению реабилитационных услуг должны быть направлены на то, чтобы оказывать поддержку системам здравоохранения в целом и интегрировать услуги по реабилитации во все уровни медико-санитарной помощи.
  • Реабилитация является одной из важнейших услуг здравоохранения и имеет огромное значение для достижения всеобщего охвата услугами здравоохранения.

Данная инициатива была учреждена в значительной степени из-за того, что многие страны не имеют должного потенциала для удовлетворения существующих потребностей в реабилитационных услугах, в том числе потребностей людей с нарушениями и болезнями костно-мышечной системы, не говоря уже о прогнозируемом росте спроса на такие услуги в связи с наблюдаемыми тенденциями, связанными со здоровьем и демографией. Страны зачастую не придают первостепенного значения проблеме реабилитации, и эта сфера по-прежнему не обеспечена необходимыми ресурсами. В результате бесчисленное множество людей не имеют доступа к реабилитационным услугам, что приводит к ухудшению состояния их здоровья, дальнейшим осложнениям и последствиям, которые будут ощущаться ими на протяжении всей жизни. В некоторых странах с низким и средним уровнем дохода более 50% населения не получают реабилитационных услуг, в которых они нуждаются.

ВОЗ оказала поддержку более чем 20 странам во всех регионах мира в целях укрепления их систем здравоохранения в части совершенствования реабилитационных услуг. Число стран, обращающихся в ВОЗ с просьбой о технической поддержке, постоянно возрастает.

Дополнительную информацию об инициативе «Реабилитация-2030: призыв к действиям» можно найти по следующей ссылке.

Кроме того, ВОЗ занимается разработкой пакета реабилитационных вмешательств (в том числе в отношении переломов конечностей, остеоартрита, ревматоидного артрита, люмбаго и ампутаций), содержащего перечень приоритетных и основанных на фактических данных реабилитационных вмешательств и ресурсов, необходимых для их безопасного и эффективного осуществления.  Эти вмешательства сохранят свою актуальность для людей на протяжении всей жизни и всего континуума медицинского обслуживания, на всех платформах оказания услуг и во всех регионах мира, причем особое внимание будет уделяться вопросам, возникающим в условиях низкой или средней обеспеченности ресурсами.

Пакет станет онлайновым ресурсом с открытым доступом, предназначенным для различных целевых аудиторий. Министерства здравоохранения смогут планировать интеграцию реабилитационных вмешательств в свои национальные системы медико-санитарных услуг; исследователи получат возможность выявлять пробелы в научных исследованиях, касающихся реабилитации; преподаватели университетов смогут разрабатывать программы обучения для подготовки специалистов в области реабилитации; медицинские работники смогут планировать и включать конкретные реабилитационные вмешательства в свои программы по оказанию реабилитационных услуг.

Дополнительную информацию о пакете реабилитационных вмешательств в отношении нарушений и болезней костно-мышечной системы можно найти по следующей ссылке.

ВОЗ планирует провести в начале 2022 г. совещание заинтересованных сторон, посвященное нарушениям и болезням костно-мышечной системы. Цель совещания – составить план дальнейшей более конкретной деятельности ВОЗ, направленной на укрепление реабилитационных услуг в отношении нарушений и болезней костно-мышечной системы в различных странах и выявление факторов, способствующих и препятствующих успешному осуществлению глобальной повестки в области реабилитации.


(1)    Cieza, A., Causey, K., Kamenov, K., Hanson, S. W., Chatterji, S., & Vos, T. (2020). Global estimates of the need for rehabilitation based on the Global Burden of Disease study 2019: a systematic analysis for the Global Burden of Disease Study 2019. The Lancet, 396(10267), 2006-2017.

(2)    Hartvigsen J, Hancock MJ, Kongsted A, et al. What low back pain is and why we need to pay attention. Lancet 2018; 391: 2356–67.

 

 

Саркопения | KinesioPro

Саркопения — это состояние, которое определяется, как снижение мышечной функции (скорости ходьбы или силы хвата), связанное с потерей мышечной массы. Саркопения чаще всего поражает пожилых людей, ведущих малоподвижный образ жизни, а также пациентов, имеющих сопутствующие заболевания, которые влияют на опорно-двигательный аппарат или снижают физическую активность. Саркопения приводит к инвалидности, падениям и преждевременной смертности. Потеря мышечной силы и аэробной функции являются двумя отличительными признаками подверженности травмам. Саркопения связана с повышенной распространенностью остеопороза, что еще больше увеличивает склонность к переломам (Malmstrom, 2021).

Саркопения является глобальной проблемой здравоохранения.

  • По имеющимся данным, саркопения поражает 5-13% людей в возрасте от 60 до 70 лет и до 50% людей старше 80 лет.
  • В 2000 году число людей в возрасте ≥ 60 лет во всем мире оценивалось в 600 миллионов.
  • Ожидается, что это население вырастет до 1.2 миллиарда к 2025 году и до 2 миллиардов к 2050 году.
  • Даже при приблизительной оценке, саркопения поражает >50 миллионов человек сегодня и будет поражать >200 миллионов в ближайшие 40 лет.
  • Силовые тренировки следует рассматривать как стратегию первой линии лечения и профилактики саркопении (Clark, 2016).

Факторы риска

Многие считают саркопению неизбежным атрибутом старения. Однако выраженность саркопении может быть разной и зависит от наличия определенных факторов риска.

Физическая активность

Отсутствие физических нагрузок считается главным фактором риска развития саркопении. Постепенное уменьшение количества миоцитов начинается в возрасте около 50 лет. Уменьшение мышечных волокон и силы более выражено у пациентов, ведущих малоподвижный образ жизни, по сравнению с пациентами, ведущими более активный образ жизни. Даже у профессиональных спортсменов, таких как марафонцы и тяжелоатлеты, наблюдается постепенное (правда более медленное) снижение скорости и силы с возрастом.

Дисбаланс гормонов и цитокинов

Возрастное снижение концентрации гормонов (например, тестостерона, тиреотропного гормона и инсулиноподобного фактора роста) приводит к потере мышечной массы и силы. Крайняя потеря мышечной массы часто является результатом сочетания снижения гормональных анаболических сигналов и стимулирования катаболических сигналов, опосредованных провоспалительными цитокинами.

Синтез белка и регенерация

Для саркопении характерно снижение способности организма к синтезу белка в сочетании с недостаточным потреблением калорий и/или белка для поддержания мышечной массы. Окисленные белки накапливаются в скелетных мышцах по мере старения и приводят к накоплению липофусцина (желтовато-коричневых, пигментированных, нерастворимых гранул). Увеличение количества окисленных белков может отражать возрастное накопление невосстановленных повреждений ДНК, которые влияют на концентрацию или активность многочисленных факторов, регулирующих скорость окисления белков и деградации окисленных белков (Stadtman, 1992). Это накопление неконтрактильного дисфункционального белка в скелетных мышцах является одной из причин серьезного снижения мышечной силы при саркопении.

Ремоделирование двигательной единицы

Также происходит возрастное сокращение количества мотонейронов, ответственных за передачу сигналов от мозга к мышцам. Сателлитные клетки — это небольшие мононуклеарные клетки, которые прилегают к мышечным волокнам и обычно активируются при травме или физической нагрузке. В ответ на эти сигналы клетки-сателлиты дифференцируются и срастаются с мышечным волокном, помогая поддерживать функцию мышц. Одна из современных гипотез заключается в том, что саркопения частично вызвана нарушением активации клеток-сателлитов (Dhillon, 2017).

Гистопатология

Ранняя саркопения характеризуется уменьшением размеров мышц и мышечной ткани. Изменения включают:

  • Замещение мышечных волокон жировой тканью, увеличение фиброза, изменения в метаболизме мышц, окислительный стресс и дегенерация нервно-мышечного соединения.
  • В конечном итоге это приводит к прогрессирующей потере мышечной функции и хрупкости.
  • Саркопения преимущественно поражает мышечные волокна типа II (быстро сокращающиеся), волокна типа I (медленно сокращающиеся) поражаются гораздо в меньшей степени.
  • Саркопения представляет собой как уменьшение количества мышечных волокон, так и уменьшение их размера.
  • Гистологические исследования, сравнивающие поперечные срезы мышц пожилых и более молодых людей, показывают, что к девятому десятилетию количество волокон типа I и II уменьшается по крайней мере на 50% (Dhillon, 2017).

Инструменты скрининга для выявления вероятной саркопении

Опросник SARC-F (сила, помощь при ходьбе, вставании со стула, подъеме по лестнице и падениях). 

Оценка саркопении: мышечная сила: 

  • Тест кистевого захвата. Как правило, сила кистевого захвата является одним из двух методов, используемых для количественной оценки мышечной силы у пациентов с подозрением на саркопению. Сила кистевого захвата коррелирует с силой других мышц и поэтому используется как некий индикатор для выявления дефицита общей силы.
  • Тест вставания со стула. Данный тест может быть использован в качестве косвенного показателя для оценки силы нижних конечностей, особенно четырехглавых мышц бедра (Ardeljan, 2020).

Предлагаемые тесты для определения степени тяжести саркопении включают:

  • Тест на скорость ходьбы. 
  • Тест «встань и иди». 

Фармакологическое лечение

В настоящее время не существует препаратов для лечения саркопении, которые были бы одобрены управленим по контролю за продуктами и лекарствами.

  • Дегидроэпиандростерон и гормон роста человека практически не оказывают никакого эффекта на морфологию мышц при саркопении. Гормон роста повышает синтез мышечного белка и увеличивает мышечную массу, но не приводит к увеличению силы и функциональности.
  • Тестостерон или другие анаболические стероиды оказывают скромный положительный эффект на мышечную силу и массу, но имеют ограниченное применение из-за неблагоприятных эффектов, таких как повышенный риск рака простаты у мужчин, вирилизация у женщин и повышение риска сердечно-сосудистых событий.
  • Новые методы лечения саркопении находятся в стадии клинической разработки. Селективные модуляторы андрогеновых рецепторов (SARMs) представляют особый интерес благодаря своей тканевой избирательности. Другие соединения, изучаемые в качестве методов лечения саркопении, включают миостатин, витамин D, ингибиторы ангиотензинпревращающего фермента, добавки омега-3 и анаболические агенты, такие как грелин и его аналоги.

Физическая терапия

Раннее распознавание и вмешательство являются ключом к улучшению исходов у пациентов с саркопенией.

  • Скрининг пациентов на предмет нарушения их физических функций и повседневной активности должен стать обычной частью визитов в медицинские учреждения для пожилых людей.
  • Оценка пациента на предмет опасности падения и принятие мер предосторожности должны быть частью стратегии лечения.

Режим физических упражнений считается краеугольным камнем в лечении саркопении.

  • Как известно, хорошо продуманная, прогрессивная программа тренировок с сопротивлением оказывает положительное воздействие на нервную и мышечную системы и, в конечном итоге, приводит к увеличению мышечной массы и силы мышц.
  • Силовые тренировки следует рассматривать как стратегию первой линии для лечения и профилактики саркопении.
  • Было доказано, что кратковременные упражнения с сопротивлением увеличивают способность и потенциал скелетных мышц к синтезу белков.
  • Было показано, что как тренировки с сопротивлением, так и силовые тренировки являются в некоторой степени успешными мероприятиями в профилактике и лечении саркопении. Сообщается, что тренировки с сопротивлением положительно влияют на нервно-мышечную систему, а также повышают концентрацию гормонов и скорость синтеза белка (Dhillon, 2021; Clark, 2016).

Наибольший эффект наблюдается при сочетании резистентных тренировок и высокобелковой диеты, что, по-видимому, работает синергически.

  • В частности, рекомендуется потреблять 20-35 г белка за один прием пищи, поскольку такое количество обеспечивает достаточное содержание аминокислот для максимального увеличения синтеза мышечного белка, что минимизирует возрастную потерю мышц. Например, куриная грудка: 23.1г белка на 100г; консервированный тунец: 23.6г белка на 100г; какао: 20г белка на 100г; сыр чеддер: 24.9 г белка на 100г; вяленая говядина: 33.2 г белка на 100 г.
  • Кроме того, пациентам с саркопенией рекомендуется потреблять 1.0 — 1.2 г/кг (массы тела) в день (Ardeljan, 2020).
Источник: Physiopedia — Sarcopenia. 

Саркопения, ожирение, остеопороз и старость | Тополянская

КЛЮЧЕВЫЕ ПОЛОЖЕНИЯ

HIGHLIGHTS

Старение неизбежно сопровождается изменениями в составе тела

Ageing is inevitably accompanied by changes in body composition

Уменьшение мышечной массы и силы наблюдается у абсолютного большинства пациентов старческого возраста

Decrease in muscle mass and strength is observed in the vast majority of elderly patients

По мере старения увеличивается масса жировой ткани и происходит ее перераспределение по центральному типу

With ageing the fat mass increases and it is redistributed according to the central type

В старческом возрасте уменьшается минеральная плотность костной ткани, что приводит к сенильному остеопорозу и увеличению риска переломов

In old age bone mineral density decreases, which results in senile osteoporosis and increased risk of fractures

Хорошо известно, что процессы старения затрагивают практически все органы и системы человеческого организма, однако изменения в композиционном составе тела обычно наиболее заметны. Старение неизбежно приводит к уменьшению мышечной массы и силы, увеличению доли жира, а также к снижению минеральной плотности костной ткани, что нередко способствует возникновению саркопенического ожирения и остеопороза (в англоязычной литературе используется термин «остеосаркопеническое ожирение») [1] (рис. 1).


РИС. 1
. Изменения композиционного состава тела по мере старения (по JafariNasabian P., с изменениями) [1]
FIG. 1. Changes in body composition with ageing (JafariNasabian P., with changes) [1]

САРКОПЕНИЯ В СТАРЧЕСКОМ ВОЗРАСТЕ

Под саркопенией (sarx, греч., — плоть, тело и penia, греч., — утрата) понимают уменьшение мышечной массы и силы (обычно у лиц пожилого и старческого возраста), которое может привести к ухудшению функциональных способностей человека. В Международной классификации болезней 10-го пересмотра, клиническая модификация (International Classification of Diseases, 10th Revision, Clinical Modification, ICD-10-CM) код диагноза саркопения — M62.84.

Унифицированный подход к терминологии саркопении до сих пор отсутствует, однако наиболее принятыми во всем мире считают определение и классификацию Европейской рабочей группы по изучению саркопении у пожилых (The European Working Group on Sarcopenia in Older People, EWGSOP) [2][3].

Следует отметить, что в последних рекомендациях EWGSOP по саркопении (2018 г.) на первый план выступает не столько мышечная масса, сколько мышечная сила, поскольку она точнее позволяет предсказать развитие неблагоприятного исхода [3][4].

Поскольку мышечную силу в настоящее время рассматривают в качестве наиболее надежной оценки мышечной функции, то EWGSOP2 использует сейчас низкую мышечную силу как основной параметр саркопении [3].

В соответствии с вышеуказанными рекомендациями диагноз саркопении вероятен при наличии низкой мышечной силы. Данный диагноз подтверждают на основании сниженного количества или ухудшения качества скелетной мускулатуры. При наличии трех критериев — низкая мышечная сила, сокращение количества или изменение качества мышц, а также низкая физическая активность — саркопению считают тяжелой [3].

Саркопения увеличивает риск падений и низкоэнергетических переломов, существенно повышает частоту госпитализаций и их стоимость, способствует инвалидизации и ухудшает качество жизни лиц пожилого и старческого возраста, а также приводит к значительному увеличению их смертности [2][4][5][6][7][8].

Уменьшение мышечной массы является основным компонентом не только саркопении, но и кахексии, представляющей собой прогрессирующую и непроизвольную потерю массы скелетных мышц и жировой ткани вследствие различных тяжелых заболеваний (злокачественных новообразований, хронической обструктивной болезни легких, хронической сердечной недостаточности). Кахексию рассматривают как одну из форм вторичной саркопении, характеризующейся не только потерей веса, но и феноменом мальнутриции вследствие метаболического дисбаланса и системной воспалительной реакции с гиперэкспрессией провоспалительных цитокинов, вызывающих как протеолиз, так и липолиз [9].

В основе саркопении лежат обычно несколько патологических процессов: снижение числа мышечных волокон, уменьшение их размера, нарушения иннервации миофибрилл, а также жировая инфильтрация мышц (миостеатоз) [9, 10]. Одной из особенностей ассоциированной со старением саркопении считают относительное несоответствие между мышечной массой и мышечной функцией, что может быть отчасти обусловлено миостеатозом [9][10]. Жировую инфильтрацию мышц также рассматривают как часть процессов старения, причем не всегда зависящую от наличия системного ожирения. В основе миостеатоза может лежать возрастное сокращение физической активности, а жировая инфильтрация мышц приводит, в свою очередь, к дополнительному ослаблению их сократительной активности, уменьшению мышечной силы и функциональных способностей людей преклонного возраста. В возникновении миостеатоза определенную роль играют также адипокины (главным образом лептин), половые гормоны, глюкокортикостероиды и нарушения метаболизма глюкозы. В ряде исследований показано, что жировая инфильтрация мышц не только приводит к потере мышечной массы и силы, но и способствует возникновению инсулинорезистентности и сахарного диабета 2-го типа [9].

Следует отметить, что в последние годы взгляд на функции скелетной мускулатуры существенно изменился. Если прежде основной ее функцией считали механическую, то сейчас установлено, что мышечная ткань также представляет собой своеобразный эндокринный орган и принимает активное участие в регуляции метаболических процессов в других органах и тканях. Была предложена концепция «мышцы — секреторный орган», объясняющая многогранное воздействие мышечной системы синтезом и секрецией различных миокинов [9][11]. Миокины представляют собой цитокины и иные пептиды, реализующие свои эффекты в других органах и системах и имеющие большое значение для понимания не только процессов саркопении, но и разнообразной другой патологии [9][11] (рис. 2).


РИС. 2
. Роль миокинов в норме и патологии
FIG. 2. The role of myokines in health and disease

Примечание: ↑ — эффект увеличения / стимуляции; ↓ — эффект уменьшения / ингибирования
Note: ↑ — increase / stimulation effect; ↓ — reduction / inhibition effect

В качестве одного из важнейших миокинов в последнее время рассматривают такой классический провоспалительный цитокин, как интерлейкин-6 (ИЛ-6). Примечательно, что физические упражнения способны вызывать десятикратное возрастание концентрации ИЛ-6 в сыворотке крови за счет его синтеза и высвобождения из скелетных мышц [12]. Наряду с этим показано, что ИЛ-6 может увеличивать доступность глюкозы и липидов посредством стимуляции гликогенолиза и липолиза в скелетных мышцах, а также способен вмешиваться в передачу сигналов инсулина [9][11][13]. Такой миокин, как ИЛ-15, способен обеспечивать взаимодействие между мышечной и жировой тканью, а ИЛ-8 вовлечен в процессы ангиогенеза [11].

Поскольку синтез миокинов связан с сокращением мышц, то отсутствие физической активности может вызвать дисбаланс миокинов, что, в свою очередь, будет способствовать каскаду развития саркопении, накоплению жировой ткани, стимуляции субклинического воспаления, метаболическим и другим нарушениям [9][11] (рис. 2). Уменьшение двигательной активности по мере старения человека вполне естественно и может быть обусловлено множеством различных причин, в частности наличием заболеваний, вызывающих болевые синдромы или астению [10][14].

В целом саркопению можно считать результатом уменьшения анаболических стимулов (физической активности, гормонов (инсулиноподобного фактора роста-1, дегидроэпиандростерон-сульфата, тестостерона и эстрогенов), потребляемых протеинов, действия инсулина) при увеличении катаболических стимулов (субклинического воспаления, синтеза катаболических цитокинов, в частности ИЛ-6 и ИЛ-1, а также фактора некроза опухоли-альфа, ФНО-α) [6][10][14][15][16]. В развитии и прогрессировании саркопении определенную роль играет тканевая гипоксия и нарушение синтеза нейротрофических факторов. Установлено, например, что к саркопении может приводить дисбаланс между стимуляторами роста мышц (такими, как костные морфогенетические белки, нейротрофический фактор мозга, фоллистатин и иризин) и отрицательными регуляторами мышечной массы (трансформирующим фактором роста-β, миостатином, активинами А и В, фактором роста и дифференцировки-15) [17]. Апоптоз (программируемая гибель клеток) также способен стимулировать процессы саркопении, а его ускорение может быть связано с более выраженным снижением мышечной массы и замедлением скорости ходьбы у лиц преклонного возраста [18]. Вне всякого сомнения, еще один вероятный фактор возникновения саркопении: утрата по мере старения способности к регенерации и замещению скелетных мышц, что обусловлено патологическими изменениями стволовых мышечных клеток и уменьшением скорости их миграции [6][19].

По механизму возникновения саркопению подразделяют на первичную (обусловленную только процессами старения) и вторичную, возникающую при наличии какой-либо патологии, способной повлиять на состояние мышечной ткани (например, при системных воспалительных заболеваниях) [2][3]. К развитию саркопении может приводить также недостаточная физическая активность вследствие сидячего образа жизни или заболеваний, ограничивающих подвижность человека [20]. Саркопения может развиться и в результате неадекватного потребления белка, в частности при анорексии, нарушении всасывания, ограничении доступа к здоровой пище [3][21].

Саркопения в пожилом и старческом возрасте обусловлена, как правило, многими факторами, поэтому в большинстве случаев точная диагностика первичного или вторичного характера саркопении у людей преклонного возраста не представляется возможной [2]. В рекомендациях EWGSOP2 выделены еще два варианта саркопении — острая и хроническая. Острая саркопения связана обычно с острым заболеванием или травмой, а хроническая — с хроническими и прогрессирующими патологическими состояниями [3]. В рекомендациях EWGSOP 2010 года выделяли также стадию «пресаркопении», характеризуемую низкой мышечной массой, но нормальной мышечной силой и функциональными способностями [2].

Для диагностики саркопении целесообразно применять предложенный EWGSOP2 алгоритм “F-A-C-S”, который означает «Найти (Find) — Оценить (Assess) — Подтвердить (Confirm) — Тяжесть (Severity)» [3] (рис. 3). В соответствии с этими рекомендациями желательно использовать опросник SARC-F1, чтобы найти лиц с вероятной саркопенией. Мышечную силу рекомендуют оценивать с помощью определения силы сжатия кисти (динамометрии) или теста вставания со стула. Для оценки тяжести саркопении рекомендуют анализ физической активности (тест «Встань и иди», ходьба на 400 м или краткая батарея тестов физического функционирования (Short Physical Performance Battery, SPPB) [3]. Уменьшение мышечной массы в клинической практике подтверждают обычно с помощью двухэнергетической рентгеновской абсорбциометрии или биоимпедансного анализа [3].


РИС. 3
. Алгоритм диагностики саркопении (по Cruz-Jentoft A.J., с изменениями) [3]
FIG. 3. Sarcopenia diagnostic algorithm (Cruz-Jentoft A.J., with changes) [3]

Стоит отметить, что для оценки состояния мышечной ткани можно использовать различные методы исследования, отличающиеся между собой точностью, сложностью, стоимостью, а также рядом других параметров [3][9][22][23][24] (табл.).

Таблица. Методы диагностики саркопении
Table. Diagnostic methods for sarcopenia

Метод

Основные изучаемые параметры

Преимущества

Недостатки

Двухэнергетическая рентгеновская абсорбциометрия

Общее содержание тощей ткани, тощая ткань верхних и нижних конечностей, скелетно-мышечный индекс

Относительно недорогое исследование, низкая лучевая нагрузка, возможность определения общей массы жировой и костной ткани, а также их содержания в разных участках тела

Отсутствие портативных аппаратов, невозможность раздельного определения подкожного и висцерального жира

Компьютерная томография

Размер мышечных волокон,
интенсивность эхосигнала

Высокая точность результатов, возможность определения висцерального и подкожного жира

Сложность, дороговизна,

лучевая нагрузка

Магнитно-
резонансная томография

Размер мышечных волокон, атрофия мышц, жировая инфильтрация мышц

Точность изучения композиционного состава тела, возможность определения и мониторирования структурных изменений в мышцах, отсутствие лучевой нагрузки

Сложность метода, его дороговизна, ограниченная доступность, отсутствие стандартизованных протоколов исследования состава тела, наличие противопоказаний к применению

Биоимпедансный анализ

Масса жировой и мышечной ткани

Низкая стоимость, простота в применении

Относительно частые ошибки в точности определения как мышечной, так и жировой массы

Однако в рутинной клинической практике для диагностики саркопении опираются чаще всего на антропометрические методики (определение окружности голени, окружности средней трети плеча и толщины кожно-жировой складки над трицепсом, а также индекса массы тела), которые обладают малой информативностью и зачастую недостаточно верны, особенно у лиц пожилого и старческого возраста [22][24]. Так, уменьшение эластичности кожи и преимущественное распределение жира в области туловища приводят к неправильной трактовке результатов измерения окружностей конечностей или кожно-жировой складки над трицепсом у людей преклонного возраста [22].

Наиболее часто применяемыми на практике методами для диагностики саркопении являются тест «Встань и иди» и динамометрия. При снижении силы сжатия кисти (менее 16 кг у женщин и 27 кг у мужчин), скорости ходьбы (менее 0,8 метра в секунду) или при невозможности самостоятельно встать со стула пациентов желательно направлять на исследование композиционного состава тела посредством одного из вышеописанных инструментальных методов диагностики [3, 5].

ОСОБЕННОСТИ ЖИРОВОЙ ТКАНИ В СТАРЧЕСКОМ ВОЗРАСТЕ

Помимо саркопении, старение связано с увеличением общего содержания жировой ткани в организме вплоть до глубокой старости, когда жировая масса может уменьшаться [25][26][27]. Последствия утраты жировой ткани в конце жизни не совсем понятны, но этот фактор можно расценивать как важное свидетельство ухудшения здоровья [28].

Предполагают, что увеличение жировой массы по мере старения связано отчасти с дисбалансом между потреблением энергии и ее расходом, обусловленным избыточной продолжительностью сидячего образа жизни. Некоторые нарушения зависят также от сопряженной с возрастом перестройки эндокринной системы и процессов метаболизма [27].

Увеличение содержания общего жира при старении происходит нередко вне зависимости от изменений массы тела, так что количество жира может меняться на протяжении жизни из-за сопутствующего уменьшения мышечной ткани. Таким образом, стабильная или уменьшенная масса тела в пожилом возрасте способна маскировать увеличение содержания жира в организме [25].

Увеличение жировой ткани в организме пожилых людей играет важную роль в повышении уровня провоспалительных цитокинов. По данным ряда авторов, жировая ткань секретирует ИЛ-6 и ФНО-α [26][29]. Относительное содержание жировой ткани в туловище по данным двухэнергетической рентгеновской абсорбциометрии коррелирует с уровнями данных цитокинов в крови [30].

Повышение содержания жировой ткани по мере старения различается у мужчин и у женщин. Согласно результатам ряда исследований, абсолютная масса жира и его процентное содержание нередко остаются относительно стабильными у пожилых мужчин, но могут уменьшаться с возрастом у пожилых женщин [27]. Возрастное накопление абдоминального и висцерального жира (как у мужчин, так и у женщин) происходит главным образом в среднем возрасте, в то время как общая масса жира остается примерно постоянной или слегка увеличивается в последующие десятилетия [27]. По другим данным, у мужчин наблюдается постепенная эволюция жировой ткани с заметным ее повышением после 60 лет и вплоть до 80-летнего возраста [31]. У женщин содержание жировой ткани увеличивается до 60–74 лет, а после 75 лет — снижается [32]. При наблюдении за составом тела у пожилых людей обнаружено общее увеличение жировой ткани в старшей когорте, но этот возрастной прирост был ослаблен у женщин, тогда как у мужчин этот эффект не отмечался [33].

Старение связано не только с повышением, но и с перераспределением жировой ткани в организме от подкожных депо к другим отложениям, включая мышцы и внутренние органы [34]. Увеличение висцерального жира, внутриклеточное накопление липидов в печени и мышцах связано в известной мере с возрастной дерегуляцией метаболизма липидов в подкожных адипоцитах [35]. К централизации жира в организме приводит, очевидно, сочетание нескольких возрастных факторов, в том числе изменение уровня половых гормонов и потребления жирных кислот, снижение физической активности и резистентность к лептину [35].

Висцеральная жировая ткань менее эффективна в хранении жирных кислот, и поэтому при висцеральном ожирении наблюдается сопутствующее увеличение циркулирующих свободных жирных кислот, что способствует инсулинорезистентности, повышению концентрации глюкозы в крови и в итоге развитию сахарного диабета 2-го типа [34]. При висцеральном накоплении жира повышение уровня свободных жирных кислот в крови сопровождается увеличением факторов риска смерти от всех причин, и от сердечно-сосудистых заболеваний в том числе [36].

С возрастом у лиц с избыточной и нормальной массой тела содержание интраабдоминального жира повышается как по отношению к подкожному жиру передней брюшной стенки, так и количественно. Площадь интраабдоминального жира, измеренная с помощью компьютерной томографии, также линейно увеличивается с возрастом даже без значительных изменений всей жировой массы [37].

Основные параметры, характеризующие распределение жира по центральному типу, у мужчин и женщин (особенно во второй половине жизни) различны. У мужчин прогрессивно нарастает содержание жировой ткани, распределенной по андроидному типу, а также доля висцерального жира, в то время как в популяции здоровых женщин наблюдается тенденция к менее выраженному андроидному или висцеральному распределению жира даже в более поздние десятилетия жизни [31].

У женщин депо подкожного жира значительно выше в молодом и среднем возрасте и почти сравнивается в возрасте 50–70 лет с содержанием подкожного жира у мужчин [31]. По некоторым данным, масса абдоминального жира увеличивается у мужчин до 55 лет, оставаясь затем стабильной, в то время как у женщин она постоянно увеличивается до 70-летнего возраста [38]. Как уже отмечалось, центральное (абдоминальное или андроидное) ожирение сопряжено с более высоким риском развития сердечно-сосудистых и метаболических заболеваний.

По данным Coin A. и соавт. [39], по мере старения обнаружено общее снижение тощей ткани и в верхних, и в нижних конечностях, но у женщин сохранялось более благоприятное соотношение жировой и тощей ткани в руках. Снижение тощей ткани в конечностях связано прежде всего с увеличением жировой ткани. Обеднение тощей ткани начиналось у мужчин после 40 лет (особенно заметно после 50 лет), тогда как у женщин — после 50 лет [39]. По некоторым данным, содержание жировой ткани в конечностях прогрессивно увеличивается до 60–74 лет, когда наблюдается пик жировой массы (как у мужчин, так и у женщин), а затем снижается. Тощая ткань конечностей сохраняется стабильной до 35–59 лет с последующим снижением и у мужчин, и у женщин [31].

МИНЕРАЛЬНАЯ ПЛОТНОСТЬ КОСТНОЙ ТКАНИ И ОСТЕОПОРОЗ В СТАРЧЕСКОМ ВОЗРАСТЕ

По мере старения неизбежно уменьшается и минеральная плотность костной ткани, что приводит к одному из наиболее распространенных возраст-ассоциированных заболеваний — остеопорозу. Остеопороз представляет собой системное заболевание костной ткани, характеризующееся снижением ее массы и ухудшением качества, что способствует, в свою очередь, увеличению риска переломов даже при отсутствии какой-либо травмы. По данным Российской ассоциации по остеопорозу, это патологическое состояние можно диагностировать примерно у 14 млн жителей Российской Федерации, а остеопению — еще у 20 млн человек [40].

Костная ткань очень активна и меняется на протяжении всей жизни. Ремоделирование кости происходит вследствие совместного действия остеокластов и остеобластов. Остеобласты, равно как адипоциты, фибробласты, хондробласты и миобласты, происходят из мезенхимальных стволовых клеток, тогда как остеокласты — из кроветворных клеток и могут генерироваться из мононуклеарных предшественников. Координированная связь между клетками, формирующими кость и разрушающими ее, необходима для поддержания костного гомеостаза [41]. Для генерации остеокластов нужны два основных цитокина: макрофагальный колониестимулирующий фактор и лиганд рецептора-активатора ядерного фактора каппа-B (Receptor Activator of Nuclear factor Kappa-B, RANKL). Следует отметить, что экспрессию RANKL подавляют эстрогены, трансформирующий фактор роста бета и механические воздействия. В результате этих эффектов уменьшаются синтез и дифференцировка остеокластов, а в конечном счете снижается резорбция костной ткани [42].

Остеопороз возникает вследствие любого дисбаланса между активностью остеобластов и остеокластов, что приводит к избыточной деградации костной ткани. В большинстве исследований зарегистрировано уменьшение остеопрогениторных клеток и активности остеобластов в костном мозге по мере старения. Характерной особенностью старения костного мозга считают переход от остеобластогенеза к адипогенезу, что обусловливает накопление жира в костном мозге и замещение им красного костного мозга [41]. При использовании гистоморфометрии костей обнаружено снижение костеобразования с возрастом. В ряде исследований отмечено также увеличение маркеров формирования кости и резорбции кости у женщин в постменопаузе по сравнению с женщинами в пременопаузе; этот процесс свидетельствует о высокой скорости ремоделирования, подтвержденной данными гистоморфометрии. Деградация костей, выявленная с помощью биохимических маркеров, у пожилых мужчин также увеличивается [41].

Существуют два типа инволютивного остеопороза — постменопаузальный, или тип 1, и сенильный, или тип 2. Первый тип остеопороза относят к быстрой фазе потери костной массы; он наблюдается примерно в течение 5–10 лет после наступления менопаузы и затрагивает в основном трабекулярную кость, что проявляется клинически переломами дистального отдела лучевой кости и позвонков [43]. Если постменопаузальный остеопороз обусловлен дефицитом эстрогенов, то сенильный остеопороз сопряжен с процессами старения, и в первую очередь с дисфункцией остеобластов. Остеопороз 2-го типа поражает как трабекулярную, так и кортикальную кость; для него характерны переломы позвонков и бедренной кости [44].

В качестве основополагающей причины потери костной ткани рассматривают дефицит эстрогенов, причем как в раннем, так и в более позднем постменопаузальном периоде. Резкое снижение функции яичников ведет к быстрому уменьшению секреции эстрадиола, что, в свою очередь, стимулирует активность остеокластов за счет увеличения синтеза RANKL, ИЛ-1β, ИЛ-6 и ФНО-α [45]. Стоит подчеркнуть, что эстрогены оказывают многогранное влияние на костную ткань и минеральный обмен. Эстрадиол ингибирует синтез и активность остеокластов посредством стимуляции остеопротегерина. Дефицит эстрогенов вызывает также дерегуляцию Т-лимфоцитов с преимущественной их активацией, за счет чего увеличивается синтез RANKL и ФНО-α, и в конечном счете стимулируется остеокластогенез [41]. Увеличение резорбции кости сопровождается потерей костной ткани и ухудшением ее микроархитектоники.

Потеря костной массы с возрастом более заметна у женщин. В первые годы после менопаузы костная масса теряется быстрее, в основном в трабекулярном отделе, что сопровождается перфорацией трабекул с последующей потерей всей трабекулы [45]. После исчезновения трабекул доступная для костной резорбции поверхность уменьшается, и потеря губчатой кости замедляется. Потеря кортикальной кости также возрастает по мере старения и проявляется её истончением и увеличением пористости. За быстрой фазой потери костной массы, примерно через 5–10 лет после наступления менопаузы, начинается более медленная фаза непрерывной потери костной ткани. К 80 годам количество трабекулярной и кортикальной кости у женщин существенно уменьшается и составляет около 40% от предменопаузальной минеральной плотности костной ткани [45].

Медленная потеря костной массы у мужчин начинается вскоре после достижения пика минеральной плотности костной ткани, а затем ускоряется экспоненциально после 70 лет [44]. Потеря трабекулярной кости у мужчин проявляется, главным образом, ее истончением, что в меньшей степени снижает прочность кости, по сравнению с потерей всей трабекулы, как у женщин. Механизм потери кортикальной кости одинаков для обоих полов, но в меньшей степени наблюдается у мужчин. Потеря как трабекулярной, так и кортикальной костной ткани на протяжении всей жизни у мужчин составляет от 20 до 25%. Таким образом, пиковая минеральная плотность костной ткани у мужчин больше, а связанная со старением потеря костной ткани меньше, поэтому частота остеопоротических переломов у них ниже, чем у женщин [45].

Известно, что секреция половых гормонов у мужчин преклонного возраста снижается достаточно медленно; более того, у многих пожилых мужчин общий уровень тестостерона остается в пределах нормы [46]. Остеопороз у мужчин может развиваться на фоне гипогонадизма. В специальном исследовании мужчин, проживавших в домах престарелых, у 66% пациентов с переломами бедра выявлялся гипогонадизм. Снижение уровня тестостерона оказывает прямое влияние на кортикальную и трабекулярную костную массу, что вызывает уменьшение минеральной плотности костной ткани у лиц с гипогонадизмом [44]. Хотя дефицит тестостерона явно связан с потерей костной массы, основным половым стероидом, регулирующим обмен костной ткани у мужчин, становится эстрадиол и особенно его биодоступная фракция [47]. У мужчин с самыми низкими уровнями биодоступного эстрадиола минеральная плотность костной ткани меньше, тогда как уровни биохимических маркеров костного метаболизма выше, потеря костной массы происходит быстрее, а переломы позвонков и бедренных костей встречаются чаще [47]. Можно сказать, что эстрогены имеют решающее значение для нормальной функции костей как у женщин, так и у мужчин. Однако, в отличие от резкого прекращения функции яичников во время менопаузы, при старении у мужчин отмечается устойчивое, но небольшое снижение уровня эстрадиола и тестостерона [41].

Помимо снижения уровня половых гормонов, одним из ключевых факторов уменьшения минеральной плотности костной ткани у пожилых людей становится дефицит витамина D [45]. Низкое содержание витамина D у пожилых людей возникает в результате недостатка солнечного света, неадекватного питания или различных заболеваний, например почечной недостаточности [41]. К снижению синтеза активной формы витамина D (1,25-дигидроксихолекальциферола) предрасполагает также возрастное уменьшение активности фермента 1α-гидроксилазы в почках [45]. Одним из основных эффектов активного метаболита витамина D становится, как известно, увеличение кишечной абсорбции кальция. При дефиците витамина D снижается всасывание кальция в кишечнике, что может способствовать гипокальциемии и, соответственно, повышению уровня паратиреоидного гормона. Вторичному гиперпаратиреозу способствуют также дефицит кальция в потребляемых продуктах питания и снижение всасывания кальция на фоне дефицита эстрогенов. Высокое содержание паратгормона обусловливает, в свою очередь, усиление резорбции кости и потерю костной массы (преимущественно кортикальной кости) [45].

По результатам эпидемиологических исследований установлено несколько факторов, повышающих риск переломов; наиболее значимыми из них считают низкую минеральную плотность костной ткани, пожилой и старческий возраст, женский пол, европеоидную расу и наличие переломов в анамнезе [45]. Низкая костная масса представляет собой далеко не единственный фактор, способствующий переломам у лиц пожилого и старческого возраста. Поскольку при одной и той же плотности костной ткани риск переломов увеличивается с возрастом, следует учитывать и другие факторы, обусловливающие риск возникновения низкотравматических переломов: общий состав кости (доля минералов, коллагена, жидкости и матриксных белков), физические и биохимические характеристики этих компонентов (например, степень минерализации), морфологию и архитектонику кости (ее размер, геометрию, трабекулярную микроархитектонику) [48].

Не менее, если не более, важны в качестве факторов риска переломов падения. Как минимум у одной трети лиц старше 65 лет случается не менее одного падения в год [49]. Чем чаще человек падает, тем скорее возникает риск переломов. Повышается он при различных патологических состояниях, ведущих к увеличению риска падений (гемипарез, дисфункция нижних конечностей, болезнь Паркинсона, сердечно-сосудистые заболевания с ортостатической гипотензией, а также фармакотерапия с использованием нейролептиков, антидепрессантов, антигипертензивных и других препаратов) [45]. Падениям может содействовать и низкий уровень витамина D: поскольку рецепторы этого витамина экспрессируются в скелетных мышцах, его дефицит предрасполагает к уменьшению мышечной силы и увеличению частоты падений [49].

Установлено также, что паратгормон является независимым предиктором падений у пожилых людей, особенно с наличием старческой астении (код по МБК-10 — R54). Даже у относительно здоровых женщин среднего и пожилого возраста высокие уровни паратгормона ассоциируются с ухудшением равновесия и увеличением риска падений [50].

Классическими остеопоротическими переломами считают компрессионные переломы позвонков, дистального отдела предплечья и проксимального отдела бедренной кости [40]. Хорошо известно, что частота подобных переломов неизбежно увеличивается с возрастом. Следует отметить, что наиболее высокая кумулятивная частота переломов регистрируется у женщин 80 лет и старше; так, частота переломов бедра в этой группе составляет около 30%. Переломы позвонков встречаются еще чаще, причем распространенность их достигает примерно 20% у женщин моложе 75 лет и более 40% у женщин старше 80 лет. По мере старения резко возрастает и число иных переломов, не связанных с повреждением позвоночника. На долю женщин старше 80 лет приходится свыше 30% всех переломов,
обусловленных остеопорозом, и более 60% всех переломов позвонков [51].

У лиц старческого возраста остеопороз сочетается, как правило, с высокой частотой других заболеваний. Важно отметить, что остеопороз и связанные с ним переломы встречаются преимущественно у лиц с выраженной старческой астенией, способствующей увеличению смертности, снижению функциональных способностей организма и ухудшению качества жизни [52]. Старческая астения связана со значительно более высоким риском повторных падений и переломов, причем этот риск не зависит, по сути, от возраста [53]. Старческую астению, наряду с остеопорозом и саркопенией, рассматривают как одну из наиболее важных проблем в пожилом и старческом возрасте [52].

Снижение минеральной плотности костной ткани нередко наблюдается на фоне сокращения мышечной массы, что приводит к развитию остеосаркопении. Так, по данным Reiss J. и соавт. [54], в выборке из 148 пациентов старшего возраста (в среднем 80,6 года) у 15,6% из них выявлялся только остеопороз, у 13,5% — только саркопения, тогда как у 14,2% — сочетание того и другого (остеосаркопения). Частота остеопороза заметно повышалась при саркопении. Авторы пришли к выводу, что остеосаркопению надо рассматривать как распространенное явление, более связанное с мальнутрицией, нежели изолированный остеопороз или саркопения [54].

ВЗАИМОСВЯЗИ МЕЖДУ ТОЩЕЙ, ЖИРОВОЙ И КОСТНОЙ ТКАНЬЮ

Между костной, жировой и тощей (включая мышечную) тканью существуют важные взаимосвязи. Хорошо известны, например, прямые взаимоотношения между жировой тканью и минеральной плотностью костной ткани [55]. Сюда входит прежде всего положительный эффект механической нагрузки (особенно при избыточной массе тела), стимулирующей формирование костной ткани за счет уменьшения апоптоза и увеличения пролиферации и дифференцировки остеобластов и остеоцитов [56][57]. Кроме того, взаимосвязь между жировой и костной тканью может опосредоваться различными биологическими активными веществами, в частности лептином и эстрогенами, синтезируемыми адипоцитами, а также склеростином и остеокальцином, синтезируемыми остеобластами и стимулирующими секрецию адипокинов и инсулина [1][56].

Следует отметить, что все эффекты жировой ткани на состояние минеральной плотности костной ткани до конца не выяснены; они могут меняться (от позитивного до негативного) в зависимости от массы и распределения жира — подкожного или висцерального [1]. По мнению ряда авторов, увеличение содержания жира в организме свыше 35–40% может негативно влиять на минеральную плотность костной ткани, тогда как меньшая его доля действует позитивно [58]. Возможные взаимоотношения между жировой и костной тканью отражены на рисунке 4.


РИС. 4
. Возможные взаимосвязи между жировой, костной и мышечной тканью у лиц старческого возраста
FIG. 4. Possible relationships between adipose, bone and muscle tissue in elderly patients

Примечание: ↑ — эффект увеличения / стимуляции; ↓ — эффект уменьшения / ингибирования
Note: ↑ — increase / stimulation effect; ↓ — reduction / inhibition effect

Взаимозависимость между костной и мышечной тканью может объясняться несколькими факторами. Прежде всего при увеличении мышечной массы возрастает нагрузка на кость, что способствует ее укреплению [56]. Увеличение мышечной массы приводит к удлинению коллагеновых волокон и гипертрофии надкостницы в месте прикрепления мышц, что стимулирует рост кости в этой области. Приток крови к конечностям увеличивается пропорционально мышечной массе, а повышение притока крови к кости способствует, очевидно, увеличению прочности кости [59]. Мышцы выполняют также эндокринную функцию, синтезируя биологически активные молекулы (миокины), способные влиять на регуляцию костной ткани [1]. В уменьшении костной и мышечной ткани по мере старения могут лежать одинаковые патогенетические факторы: субклиническое воспаление, дефицит гормонов и питательных веществ, а также снижение физической активности [1]. Возможные взаимоотношения между мышечной и костной тканью отражены на рисунке 4.

ЗАКЛЮЧЕНИЕ

Хотя пристальное внимание к особенностям композиционного состава тела и саркопении в различных группах пациентов было привлечено относительно недавно, к настоящему времени уже проведено много исследований по изучению данной проблемы как у лиц пожилого возраста, так и у пациентов с рядом хронических заболеваний. Однако научных работ по изучению композиционного состава тела у лиц старческого возраста и долгожителей не так много, а их результаты достаточно противоречивы. Наряду с этим, несмотря на большое внимание к глобальной проблеме остеопороза, диагностике и лечению остеопороза у лиц старческого возраста и долгожителей по-прежнему уделяют недостаточно внимания, что объясняется отчасти тем, что большинство ключевых исследований по остеопорозу проведено с участием женщин не старше 70 лет в постменопаузе. В то же время значимость проблем саркопении и остеопороза может лишь возрастать вследствие неуклонного старения населения. Учитывая вышеизложенное, необходимы дальнейшие исследования по изучению особенностей композиционного состава тела у лиц старческого возраста и долгожителей.

1. JafariNasabian P., Inglis J.E., Reilly W., et al. Aging human body: Changes in bone, muscle and body fat with consequent changes in nutrient intake. J Endocrinol. 2017; 234(1): R37–51. https://doi.org/10.1530/JOE-16-0603 PMID: 28442508

2. Cruz-Jentoft A.J., Baeyens J.P., Bauer J.M., et al. Sarcopenia: European consensus on definition and diagnosis. Age Ageing. 2010; 39(4): 412–23. https://doi.org/10.1093/ageing/afq034 PMID: 20392703

3. Cruz-Jentoft A.J., Bahat G., Bauer J., et al. Sarcopenia: Revised European consensus on definition and diagnosis. Age Ageing. 2019; 48(1): 16–31. https://doi.org/10.1093/ageing/afy169 PMID: 31081853

4. Schaap L.A., Van Schoor N.M., Lips P., Visser M. Associations of sarcopenia definitions, and their components, with the incidence of recurrent falling and fractures: The longitudinal aging study Amsterdam. J Gerontol A Biol Sci Med Sci. 2018; 73(9): 1199–204. https://doi.org/10.1093/gerona/glx245 PMID: 29300839

5. Fielding R. A., Vellas B., Evans W.J., et al. Sarcopenia: An Undiagnosed Condition in Older Adults. Current Consensus Definition: Prevalence, Etiology, and Consequences. International Working Group on Sarcopenia. J Am Med Dir Assoc. 2011; 12(4): 249–56. https://doi.org/10.1016/j.jamda.2011.01.003 PMID: 21527165

6. Walston J.D. Sarcopenia in older adults. Curr Opin Rheumatol. 2012; 24(6): 623–7. https://doi.org/10.1097/BOR.0b013e328358d59b PMID: 22955023

7. Antunes A.C., Araújo D.A., Veríssimo M.T., Amaral T.F. Sarcopenia and hospitalisation costs in older adults: a cross-sectional study. Nutr Diet. 2017; 74(1): 46–50. https://doi.org/10.1111/1747-0080.12287 PMID: 28731551

8. Steffl M., Sima J., Shiells K., Holmerova I. The increase in health care costs associated with muscle weakness in older people without long-term illnesses in the Czech Republic: Results from the survey of health, ageing and retirement in Europe (SHARE). Clin Interv Aging. 2017; 12: 2003–7. https://doi.org/10.2147/CIA.S150826 PMID: 29225462

9. Lee K., Shin Y., Huh J., et al. Recent issues on body composition imaging for sarcopenia evaluation. Korean J Radiol. 2019; 20(2): 205–17. https://doi.org/10.3348/kjr.2018.0479 PMID: 30672160

10. Keller K., Engelhardt M. Strength and muscle mass loss with aging process. Age and strength loss. Muscles Ligaments Tendons J. 2013; 3(4): 346–50. https://doi.org/10.11138/mltj/2013.3.4.346 PMID: 24596700

11. Ilich J.Z., Kelly O.J., Inglis J.E., et al. Interrelationship among muscle, fat, and bone: Connecting the dots on cellular, hormonal, and whole body levels. Ageing Res Rev. 2014; 15: 51–60. https://doi.org/10.1016/j.arr.2014.02.007 PMID: 24632496

12. Pedersen B.K., Fischer C.P. Beneficial health effects of exercise — the role of IL-6 as a myokine. Trends Pharmacol Sci. 2007; 28(4): 152–6. https://doi.org/10.1016/j.tips.2007.02.002 PMID: 17331593

13. Kelly M., Gauthier M., Saha A.K., Ruderman N.B. Activation of AMP-Activated Protein Kinase by Interleukin-6 in Rat Skeletal Muscle. Diabetes. 2009; 58(9): 1953–60. https://doi.org/10.2337/db08-1293 PMID: 19502419

14. Morley J.E. Sarcopenia in the elderly. Fam Pract. 2012; 29(suppl. 1): i44–8. https://doi.org/10.1093/fampra/cmr063 PMID: 22399555

15. Sayer A.A., Robinson S.M., Patel H.P., et al. New horizons in the pathogenesis, diagnosis and management of sarcopenia. Age Ageing. 2013; 42(2): 145–50. https://doi.org/10.1093/ageing/afs191 PMID: 23315797

16. Jo E., Lee S.R., Park B.S., Kim J.S. Potential mechanisms underlying the role of chronic inflammation in age-related muscle wasting. Aging Clin Exp Res. 2012; 24(5): 412–22. https://doi.org/10.3275/8464 PMID: 22717404

17. Kalinkovich A., Livshits G. Sarcopenia — The search for emerging biomarkers. Ageing Res Rev. 2015; 22: 58–71. https://doi.org/10.1016/j.arr.2015.05.001 PMID: 25962896

18. Armand A.S., Laziz I., Dieghloul D., et al. Apoptosis-inducing factor regulates skeletal muscle progenitor cell number and muscle phenotype. PLoS One. 2011; 6(11): e27283. https://doi.org/10.1371/journal.pone.0027283 PMID: 22076146

19. Collins-Hooper H., Woolley T.E., Dyson L., et al. Age-related changes in speed and mechanism of adult skeletal muscle stem cell migration. Stem Cells. 2012; 30(6): 1182–95. https://doi.org/10.1002/stem.1088 PMID: 22593017

20. Mijnarends D.M., Koster A., Schols J.M., et al. Physical activity and incidence of sarcopenia: The population-based AGES-Reykjavik Study. Age Ageing. 2016; 45(5): 614–20. https://doi.org/10.1093/ageing/afw090 PMID: 27189729

21. Muscaritoli M., Anker S.D., Argiles J., et al. Consensus definition of sarcopenia, cachexia and pre-cachexia: Joint document elaborated by Special Interest Groups (SIG) “cachexia-anorexia in chronic wasting diseases” and “nutrition in geriatrics”. Clin Nutr. 2010; 29(2): 154–9. https://doi.org/10.1016/j.clnu.2009.12.004 PMID: 20060626

22. Beaudart C., McCloskey E., Bruyère O., et al. Sarcopenia in daily practice: assessment and management. BMC Geriatr. 2016; 16(1): 170. https://doi.org/10.1186/s12877-016-0349-4 PMID: 27716195

23. Gonzalez M.C., Heymsfield S.B. Bioelectrical impedance analysis for diagnosing sarcopenia and cachexia: what are we really estimating? J Cachexia Sarcopenia Muscle. 2017; 8(2): 187–9. https://doi.org/10.1002/jcsm.12159 PMID: 28145079

24. Cooper C., Fielding R., Visser M.V., et al. Tools in the assessment of sarcopenia. Calcif Tissue Int. 2013; 93(3): 201–10. https://doi.org/10.1007/s00223-013-9757-z PMID: 23842964

25. Santoro A., Bazzocchi A., Guidarelli G., et al. A cross-sectional analysis of body composition among healthy elderly from the European NU-AGE study: Sex and country specific features. Front Physiol. 2018; 9: 1693. https://doi.org/10.3389/fphys.2018.01693 PMID: 30555339

26. Tchkonia T., Morbeck D.E., Von Zglinicki T., et al. Fat tissue, aging, and cellular senescence. Aging Cell. 2010; 9(5): 667–84. https://doi.org/10.1111/j.1474-9726.2010.00608.x PMID: 20701600

27. Mantovani G. Cachexia and Wasting: A Modern Approach. Pathophysiology of Body Composition Changes in Elderly People. Milan: Springer, 2006: 369–76.

28. Cheng F.W., Gao X., Jensen G.L. Weight Change and All-Cause Mortality in Older Adults: A Meta-Analysis. J Nutr Gerontol Geriatr. 2015; 34(4): 343–68. https://doi.org/10.1080/21551197.2015.1090362 PMID: 26571354

29. Lisko I., Tiainen K., Stenholm S., et al. Inflammation, adiposity, and mortality in the oldest old. Rejuvenation research. 2012; 15(5): 445–52. https://doi.org/10.1089/rej.2011.1310 PMID: 22998329

30. Pedersen M., Bruunsgaard H., Weis N., et al. Circulating levels of TNF-alpha and IL-6-relation to truncal fat mass and muscle mass in healthy elderly individuals and in patients with type-2 diabetes. Mech Ageing Dev. 2003; 124(4): 495–502. https://doi.org/10.1016/S0047-6374(03)00027-7 PMID: 12714258

31. Bazzocchi A., Diano D., Ponti F., et al. Health and ageing: A cross-sectional study of body composition. Clin. Nutr. 2013; 32(4): 569–78. https://doi.org/10.1016/j.clnu.2012.10.004 PMID: 23111003

32. Kyle U.G., Genton L., Hans D., et al. Age-related differences in fat-free mass, skeletal muscle, body cell mass and fat mass between 18 and 94 years. Eur. J. Clin. Nutr. 2001; 55(8): 663–72. https://doi.org/10.1038/sj.ejcn.1601198 PMID: 11477465

33. Hughes V.A., Frontera W.R., Roubenoff R., et al. Longitudinal changes in body composition in older men and women: Role of body weight change and physical activity. Am. J. Clin. Nutr. 2002; 76(2): 473–81. https://doi.org/10.1093/ajcn/76.2.473 PMID: 12145025

34. Pararasa C., Bailey C.J., Griffiths H.R. Ageing, adipose tissue, fatty acids and inflammation. Biogerontology. 2015; 16(2): 235–48. https://doi.org/10.1007/s10522-014-9536-x PMID: 25367746

35. Mancuso P., Bouchard B. The impact of aging on adipose function and adipokine synthesis. Front Endocrinol. 2019; 10: 137. https://doi.org/10.3389/fendo.2019.00137 PMID: 30915034

36. Rost S., Freuer D., Peters A., et al. New indexes of body fat distribution and sex-specific risk of total and cause-specific mortality: A prospective cohort study. BMC Public Health. 2018; 18(1): 427. https://doi.org/10.1186/s12889-018-5350-8 PMID: 29609587

37. Hunter G.R., Gower B. A., Kane B.L. Age related shift in visceral fat. Int. J. Body Compos. Res. 2010; 8(3): 103–8. PMID: 24834015

38. Henche S.A., Torres R.R., Pellico L.G. An evaluation of patterns of change in total and regional body fat mass in healthy Spanish subjects using dual-energy X-ray absorptiometry (DXA). Eur. J. Clin. Nutr. 2008; 62(12): 1440–8. https://doi.org/10.1038/sj.ejcn.1602883 PMID: 17717537

39. Coin A., Giannini S., Minicuci N., et al. Limb fat-free mass and fat mass reference values by dual-energy X-ray absorptiometry (DEXA) in a 20-80 year-old italian population. Clin. Nutr. 2012; 31(4): 506–11. https://doi.org/10.1016/j.clnu.2012.01.012 PMID: 22342050

40. International Osteoporosis Foundation (IOF). Lesnyak O, Nauroy L. The Eastern European & Central Asian regional audit epidemiology, costs & burden of osteoporosis in 2010. International Osteoporosis Foundation; 2010: 43–8. URL: https://www.osteoporosis.foundation/sites/iofbonehealth/files/2019-06/2010_Eastern_European_Central_Asian_Audit_English.pdf (дата обращения: 13.06.2020).

41. Pietschmann P., Rauner M., Sipos W., Kerschan-Schindl K. Osteoporosis: An age-related and gender-specific disease — A mini-review. Gerontology. 2009; 55(1): 3–12. https://doi.org/10.1159/000166209 PMID: 18948685

42. Khosla S., Melton L.J., Riggs B.L. The unitary model for estrogen deficiency and the pathogenesis of osteoporosis: Is a revision needed? J Bone Miner Res. 2011; 26(3): 441–51. https://doi.org/10.1002/jbmr.262 PMID: 20928874

43. Wijnands J. M., Boonen A., Dagnelie P.C., et al. The cross-sectional association between uric acid and atherosclerosis and the role of low-grade inflammation: The CODAM study. Rheumatol. (United Kingdom). 2014; 53(11): 2053–62. https://doi.org/10.1093/rheumatology/keu239 PMID: 24917566

44. Katz J.D., Walitt B. Rheumatic diseases in older adults. Rheum Dis Clin North Am. 2018; 44(3): XIII–XIV. https://doi.org/10.1016/j.rdc.2018.05.001 PMID: 30001792

45. Szulc P., Bouxsein M.L., Compston J.E. Overview of osteoporosis: Epidemiology and clinical management. Nyon, Switzerland: International Osteoporosis Foundation. 2011: 65. https://www.researchgate.net/publication/313894090_Overview_of_osteoporosis_epidemiology_and_clinical_management (дата обращения: 13.06.2020).

46. Kaufman J. M., Vermeulen A. The decline of androgen levels in elderly men and its clinical and therapeutic implications. Endocr Rev. 2005; 26(6): 833–76. https://doi.org/10.1210/er.2004-0013 PMID: 15901667

47. Khosla S., Amin S., Orwoll E. Osteoporosis in men. Endocr Rev. 2008; 29(4): 441–64. https://doi.org/10.1210/er.2008-0002 PMID: 18451258

48. Kuroshima S., Kaku M., IshimotoT., et al. A paradigm shift for bone quality in dentistry: A literature review. J Prosthodont Res. 2017; 61(4): 353–62. https://doi.org/10.1016/j.jpor.2017.05.006 PMID: 28633987

49. Annweiler C., Montero-Odasso M., Schott A.M., et al. Fall prevention and vitamin D in the elderly: An overview of the key role of the non-bone effects. J Neuroeng Rehabil. 2010; 7(1): 50. https://doi.org/10.1186/1743-0003-7-50 PMID: 20937091

50. Bird M.-L., Haber N.E., Batchelor F., et al. Vitamin D and parathyroid hormone are associated with gait instability and poor balance performance in mid-age to older aged women. Gait Posture. 2018; 59: 71–5. https://doi.org/10.1016/j.gaitpost.2017.09.036 PMID: 29017107

51. Vandenbroucke A., Luyten F.P., Flamaing J., Gielen E. Pharmacological treatment of osteoporosis in the oldest old. Clin. Interv. Aging. 2017; 12: 1065–77. https://doi.org/10.2147/CIA.S131023 PMID: 28740372

52. Gielen E., Bergmann P., Bruyère, O., et al. Osteoporosis in Frail Patients: A Consensus Paper of the Belgian Bone Club. Calcif. Tissue Int. 2017; 101(2): 111–31. https://doi.org/10.1007/s00223-017-0266-3 PMID: 28324124

53. Tom S.E., Adachi J.D., Anderson F.A. Jr., et al. Frailty and fracture, disability, and falls: A multiple country study from the global longitudinal study of osteoporosis in women. J. Am. Geriatr. Soc. 2013; 61(3): 327–34. https://doi.org/10.1111/jgs.12146 PMID: 23351064

54. Reiss J., Iglseder B., Alzner R., et al. Sarcopenia and osteoporosis areinterrelated in geriatric inpatients. Z. Gerontol. Geriatr. 2019; 52(7): 688–93. https://doi.org/10.1007/s00391-019-01553-z PMID: 31049683

55. Santos V.R.D., Christofaro D.G.D., Gomes I.C., et al. Relationship between obesity, sarcopenia, sarcopenic obesity, and bone mineral density in elderly subjects aged 80 years and over. Rev. Bras. Ortop. 2018; 53(3): 300–5. https://doi.org/10.1016/j.rbo.2017.05.010 PMID: 29892580

56. Ho-Pham L.T., Nguyen U.D.T., Nguyen T.V. Association between lean mass, fat mass, and bone mineral density: A meta-analysis. J. Clin. Endocrinol. Metab. 2014; 99(1): 30–8. https://doi.org/10.1210/jc.2013-3190 PMID: 24384013

57. Marwaha R.K., Garg M.K., Tandon N., et al. Relationship of body fat and its distribution with bone mineral density in Indian population. J. Clin. Densitom. 2013; 16(3): 353–9. https://doi.org/10.1016/j.jocd.2012.08.074 PMID: 23910719

58. Liu P.Y., Ilich J.Z., Brummel-SmithK., Ghosh S. New insight into fat, muscle and bone relationship in women: determining the threshold at which body fat assumes negative relationship with bone mineral density. Int. J. Prev. Med. 2014; 5(11): 1452–63. PMID: 25538842

59. Kaji H. Linkage between muscle and bone: Common catabolic signals resulting in osteoporosis and sarcopenia. Current Opinion in Clinical Nutrition and Metabolic Care. 2013; 16(3): 272–7. https://doi.org/10.1097/MCO.0b013e32835fe6a5 PMID: 23481148


современные подходы к диагностике и лечению uMEDp

Потеря мышечной ткани с возрастом и вследствие некоторых серьезных заболеваний значительно снижает функциональные возможности человека, повышает риск падений и, как следствие, травм и переломов, определяет необходимость постороннего ухода. В статье представлены современные рекомендации по диагностике саркопении, определению степени тяжести потери мышечной ткани, подходы к терапии саркопении и перспективные разработки, рассмотрены препараты витамина D: химическая структура колекальциферола, альфакальцидола и кальцитриола, их биологические возможности, эффективность для повышения функциональных возможностей пожилых людей и снижения риска падений.

Таблица. Этиологическая классификация саркопении [11]

Саркопения – дегенеративная потеря мускулатуры (в среднем 0,5–1% каждый год после 25–30 лет), ухудшение качества мышечных волокон и снижение силы сокращения мышц. Саркопения наряду с остеопорозом является причиной немощности пожилых людей и потери ими независимости [1]. Снижение мышечной массы и связанной с этим способности к ежедневному самообслуживанию наблюдается у 4% мужчин и 3% женщин в возрасте 70–75 лет и до 16% среди мужчин и 13% среди женщин старше 85 лет [2]. Однако в первую очередь саркопения приводит к ухудшению функциональных возможностей быстрых мышечных волокон, отвечающих за сохранение равновесия при изменении положения центра тяжести, что в свою очередь увеличивает риск самопроизвольных падений: у пожилых людей через каждые 10 лет частота падений увеличивается на 10% [3]. Падения становятся причиной серьезных повреждений в 10–15% случаев [4], переломов в 5% случаев [4, 5]. При этом 5,3% всех госпитализаций и 90% переломов проксимального отдела бедра обусловлены падениями с высоты собственного роста [6, 7]. Среди факторов риска внепозвоночных переломов падения более значимы, чем снижение минеральной плотности костной ткани [8–10].

Патогенетические аспекты целого ряда заболеваний, связанных с возрастом (атеросклероз, сахарный диабет 2 типа, остеопороз, деменция), изучаются давно, в то время как причины потери мышечной массы стали исследовать совсем недавно.

В связи с этим нами проанализированы причины и ключевые механизмы развития саркопении, подходы к диагностике этого состояния и способы немедикаментозной и медикаментозной коррекции.

Этиология саркопении

В подавляющем большинстве случаев саркопения связана со старением организма, поэтому чаще выявляется у пожилых людей. Однако это состояние встречается и у моло­дых пациентов.

Классификация потери мышечной ткани предполагает выделение первичной и вторичной саркопении, последняя подразделяется на формы в зависимости от первопричины заболевания [11]. Этиологическая классификация саркопении представлена в таблице.

Первичная саркопения обусловлена рядом факторов [11–13]:

  • гормональной перестройкой. Она связана со снижением содержания половых гормонов, уровня соматотропного гормона, относительным увеличением содержания свободного кортизола, нарушением нормального циркадного ритма кортизола, снижением содержания витамина D и D-гормона и уменьшением количества/ухудшением чувствительности рецепторов к D-гормону;
  • активизацией процессов апоптоза, митохондриальной дисфункцией, определяющей процессы старения клетки, дифференцировкой мезенхимальной стволовой клетки в адипоцит. В ряде случаев уменьшение мышечной массы происходит без уменьшения массы тела вследствие замещения мышечной ткани жи­ровой;
  • дегенерацией нервной системы, ухудшением иннервации мышечных волокон и денервацией.

В случае первичной саркопении процесс носит необратимый, прогрессирующий характер. Поэтому именно данная когорта пациентов нуждается в грамотной диагностике и разработке способов лечения.

При вторичных формах саркопении, как правило, отмечается один значимый этиологический фактор (таблица). Так, у пациентов, страдавших эндогенным гиперкортицизмом в 25–30-летнем возрасте, наблюдается значимое снижение функциональных возможностей и повышение риска переломов [14, 15]. Необходимо отметить, что в большинстве случаев эти процессы имеют полное или частичное обратное развитие после достижения ремиссии заболевания [16].

Диагностическая концепция саркопении

Термин «саркопения» для обозначения феномена потери мышечной массы с возрастом впервые был предложен в 1997 г. [17], диагностическая концепция заболевания – в 1998-м [18]. Саркопенией считалось снижение тощей массы на два стандартных отклонения, измеренных при двухэнергетической рентгеновской абсорбциометрии (dual-energy X-ray absorptiometry – DXA), по отношению к молодому здоровому взрослому человеку соответствующего пола. Такой подход имел целый ряд преимуществ. Определение было понятно большинству врачей, демонстрировало высокие прогностические возможности для негативного исхода, а диагностика могла проводиться в ходе обследования на исключение остеопороза.

В 2010 г. концепция саркопении была пересмотрена. Европейская ассоциация клинического питания и метаболизма предложила определять саркопению при снижении мышечной массы более двух стандартных отклонений по сравнению с молодыми здоровыми лицами того же пола и этнической принадлежности. Кроме того, снижение мышечной массы должно было сочетаться со снижением скорости ходьбы человека (менее 0,8 м/с при четырехметровом тесте) [19].

Расширяя это понятие, Европейская рабочая группа по изучению саркопении у пожилых людей предложила выделять стадии саркопении [11]:

  • первую (прекахексия) – снижение мышечной массы;
  • вторую – снижение мышечной массы и мышечной силы или функциональных возможностей;
  • третью (тяжелая форма) – снижение всех трех параметров.

Силу мышц сегодня оценивают при выполнении теста на силу сжатия динамометра, подъема со стула или из положения приседания и определении пикового респираторного объема (межреберные мышцы). Существует линейная зависимость между силой сжатия и силой мышц нижних конечностей, a также моментом силы разгибателя коленей и размером поперечного сечения икроножных мышц [20]. Сила сжатия кисти в проспективных наблюдениях коррелировала с частотой инвалидизации и невозможностью выполнять привычную домашнюю работу (возможностью проживать отдельно) [21]. Таким образом, стандартизованное исследование силы сжатия динамометра является альтернативой сложных тестов для измерения силы мышц нижних конечностей. Определение пикового респираторного объема у пациентов без первичной легочной патологии позволяет оценить силу мышц, участвующих в акте дыхания. Это сравнительно простой, но пока не доступный многим метод.

Тесты для оценки функциональных возможностей (короткий набор тестов функциональных возможностей, тест для определения скорости ходьбы, шестиминутный тест ходьбы и тест ходьбы по лестнице) ввиду сложности проведения и интерпретации используются только в клинических исследованиях [22]. В рутинной практике для оценки функциональных возможностей применяют тест оценки скорости ходьбы на 4 м.

В Европейском консенсусе по диагностике саркопении предложен алгоритм выявления пациентов с таким заболеванием. Отмечено, что исследование должны проходить пациенты старше 65 лет (или с факторами риска развития саркопении). Сначала оценивается скорость ходьбы (время прохождения 4 м). При скорости ходьбы более 0,8 м/с предлагается измерить силу сжатия динамометра. В случае нормальных показателей проводить исследование мышечной массы не надо. При скорости ходьбы менее 0,8 м/с или неадекватной силе сжатия динамометра необходимо исследовать мышечную массу (применяется DXA). Только после этого ставится диагноз.

Саркопения в составе других синдромов

Потеря мышечной массы наблюдается при кахексии. Кахексия – это комплексный метаболический синдром, который ассоциирован с основным заболеванием пациента и при котором происходит утрата мышечной массы с потерей жировой ткани или без таковой [23]. Кахексия часто сочетается с воспалительными процессами, инсулинорезистентностью, анорексией и ускоренным разрушением белков мышечной ткани [24].

Другой гериатрический симптомокомлекс, включающий в себя саркопению, – немощность. Данное состояние обусловлено прогрессирующим снижением функций всех органов и систем с ухудшением резервных возможностей гомео­стаза, снижением устойчивости к стрессовым факторам. При нем повышается риск падений, частота госпитализаций и летальных исходов [25]. Помимо физиче­ских проявлений (спонтанная потеря массы тела, переутомление, выраженная слабость, медленная походка, низкая физическая активность) [26] немощность проявляется в снижении когнитивных функций, социальной активности и др. [25].

Лечение саркопении

Немедикаментозная терапия. Традиционно считается, что дефицит физической активности является наиболее значимым фактором развития саркопении [27]. Однако даже у спортсменов, в том числе тех, кто продолжает активные тренировки, мышечная масса, мышечная сила и выносливость начинают снижаться после 30 лет [28, 29]. Тем не менее физические нагрузки – существенная составляющая терапии саркопении, поскольку было доказано, что непродолжительные силовые нагрузки повышают способность мышечной ткани синтезировать белок [29].

Медикаментозная терапия. Препарата с зарегистрированными показаниями для лечения саркопении пока не существует. Дегидроэпиандростерон и гормон роста человека показали минимальную эффективность или ее отсутствие в терапии саркопении. Гормон роста человека увеличивал синтез белков мышцей и, как следствие, мышечную массу, но это не повышало силу мышц и функциональные возможности [30]. Малоэффективным оказался и рекомбинантный инсулиноподобный фактор роста 1. Возможно, причиной стали сопутствующие воспалительные процессы и другие факторы, связанные с возрастом.

Тестостерон продемонстрировал определенное положительное влияние на мышечную силу и мышечную массу, но его применение у пациентов пожилого возраста было связано с рядом нежелательных явлений. Существует опасение в отношении развития рака предстательной железы, повышения сердечно-сосудистых рисков [31–33]. Кроме того, у женщин тестостерон вызывает вирилизацию.

Для коррекции или замедления развития саркопении сегодня рассматриваются потенциальные возможности грелина, ингибиторов ангиотензинпревращающего фермента и эйкозапентаеновой кислоты (ЭПК) [34]. ЭПК – полиненасыщенная жирная кислота класса омега-3, которая входит в состав липидов большинства тканей животных. В рацион человека ЭПК попадает в составе таких продуктов питания, как сельдь, скумбрия, лосось, сардины или печень трески. Восполнить ее содержание можно также при приеме добавок омега-3 жирных кислот, эффективность которых до сих пор обсуждается.

Наиболее благоприятный профиль (соотношение эффективности и безопасности) для лечения саркопении у пожилых пациентов имеют препараты витамина D.

Важность D-гормона для развития мышц и их функциональных возможностей была продемонстрирована во многих работах. Еще в середине 70-х гг. прошлого века было показано, что 25-гидроксивитамин D3 (25(ОН)D3) оказывает влияние на фосфатный метаболизм в мышцах диафрагмы животных с дефицитом витамина D [35]. В результате дальнейших исследований рецептор активной формы витамина D (1,25 дигидрохолекальциферола), или D-гормона, был обнаружен на клетках скелетной мускулатуры [36]. Следующие работы показали, что D-гормон влияет на скелетную мускулатуру на генетическом (изменение траскрипции генов) и тканевом уровне через регуляцию метаболизма кальция и контроль мышечных сокращений и расслаблений [37–40]. Важность D-гормона для удержания равновесия была дополнительно подтверждена в двух проспективных генетических исследованиях. Полиморфизм рецептора витамина D сопровождается увеличением частоты падений и снижением мышечной силы [41].

В ходе исследований было выявлено, что снижение содержания витамина D в сыворотке крови (25(ОН)D менее 40 нг/мл, по некоторым данным менее 20 нг/мл) повышает риск падений [42, 43].

Надо отметить, что в отдельных когортах пациентов дефицит D-гормона может наблюдаться даже при нормальном поступлении витамина D. Это больные с тяжелыми заболеваниями печени, снижением скорости клубочковой фильтрации (СКФ) – менее 65 мл/мин, больные ожирением, а также люди преклонного возраста.

У пациентов с ожирением нативный витамин D как жирорастворимый витамин преимущественно находится в жировом депо, поэтому и создается относительный дефицит циркулирующего D-гормона. При первичной патологии печени и почек нарушается превращение нативного витамина D в D-гормон. В исследовании с участием 1781 больного остеопорозом возрастное снижение функции почек было признано независимым фактором риска падений и снижения функциональных возможностей пациентов [44]. У людей пожилого возраста наблюдается снижение экспрессии рецептора к D-гормону по сравнению с молодыми [45]. Во всех этих когортах пациентов функциональные возможности хуже, а риск падений выше по сравнению со здоровыми лицами из группы контроля [46].

Назначение колекальциферола – нативного витамина D – оказывает положительное влияние на снижение риска падений и, как следствие, переломов, особенно у пациентов с дефицитом D-гормона [47].

Вместе с тем важно понимать разницу между профилактическим назначением нативного витамина D пожилым пациентам с дефицитом витамина D и фармакотерапией препаратами D-гормона или его аналогов [48]. Активная форма витамина D (альфакальцидол) нуждается в одном гидроксилировании в печени (25-гидроксилаза) для превращения в D-гормон. Этим определяется преимущество альфакальцидола перед кальцитриолом: большая продолжительность действия и меньшая частота гиперкальциемии. Альфакальцидол эффективен и при снижении СКФ. Описана способность альфакальцидола преодолевать резистентность рецепторов к D-гормону и увеличивать их экспрессию [45]. Сравнительный метаанализ (14 исследований, 21 268 пациентов) показал, что активные метаболиты витамина D (альфакальцидол и кальцитриол) статистически значимо (р = 0,049) уменьшают риск падений по сравнению с нативным витамином D (отношение рисков 0,79 (95%-ный доверительный интервал (ДИ) 0,64–0,96) против 0,94 (95% ДИ 0,87–1,01)) [49]. Лечение пациентов с остеопорозом альфакальцидолом в дозе 1 мкг в течение трех – шести месяцев приводило к относительному увеличению доли мышечных волокон типа А и некоторому уменьшению доли волокон типа B, что сочеталось с увеличением поперечного сечения волокон типа А. Время, которое требовалось пациентам, чтобы одеться, статистически значимо уменьшалось [50].

Кроме того, терапия альфакальцидолом в течение шести месяцев у пациенток пожилого возраста с дефицитом витамина D приводила к статистически значимому улучшению мышечной силы (изометрической силы разгибания колена) и функциональных возможностей (расстояние, которое они могли пройти за две минуты) [51].

У пациентов с остеопенией на фоне ревматоидного артрита и нормальным уровнем витамина D (49–59 нмоль/л), которые ежедневно получали 1 мкг альфакальцидола, статистически значимо повысилась мышечная сила по сравнению с больными, получавшими ежедневно нативный витамин D в дозе 1000 МЕ (60 против 18%) [52].

После успешных пилотных исследований были проведены рандомизированные плацебоконтролируемые исследования, доказавшие способность альфакальцидола предотвращать падения и переломы у пациентов старше 65 лет [53–55]. Особенно эффективным оказалось применение альфакальцидола (Альфа Д3-Тева®) в дозе 1 мкг у пациентов с возрастным снижением СКФ (менее 65 мл/мин): риск падений снизился на 71% [56].

Работа японских исследователей продемонстрировала эффективность приема альфакальцидола в дозе 1 мкг в течение года в отношении увеличения мышечной массы у пациентов с ее дефицитом (мышечная масса измерялась с помощью DXA) и поддержания мышечной массы при исходно нормальных показателях (согласно критериям, применяемым в Японии) [57].

Очевидно, что на фоне лечения альфакальцидолом улучшается мышечная функция, снижается риск падений и повышается минерализация костной ткани, следовательно, снижается риск переломов. Именно поэтому длительное время препарат использовался для лечения остеопороза [58]. Когда появились более эффективные препараты для лечения остеопороза, альфакальцидол стали применять в профилактических целях или в дополнение к антирезорбтивной терапии [58–64]. В ряде исследований альфакальцидол продемонстрировал преимущество перед нативным витамином D и возможность использования в тех случаях, когда комбинация антирезорбтивной терапии и нативных форм витамина D недостаточно эффективна [65, 66].

Наиболее широко применяемым альфакальцидолом  является лекарственный препарат Альфа Д3-Тева®, имеющий широкий международный и российский опыт применения и большую доказательную базу.

На сегодняшний день поиск препаратов для лечения саркопении продолжается. Проводятся доклинические и клинические исследования эффективности миостатина, селективных модуляторов андрогенных рецепторов [67], а также принципиально нового класса анаболик-катаболик-трансформирующих агентов – MT-102, показавших хорошие результаты у животных [68].

Заключение

Саркопения, обусловленная возрастными изменениями мышечной ткани, вносит существенный вклад в повышение риска падений, снижение функциональных возможностей и способности к самообслуживанию. Увеличение продолжительности жизни населения ставит перед медициной задачи по сохранению активной и независимой жизни пожилых людей. Разрабатываются методы лечения остеопороза, атеросклероза и онкологических заболеваний, все больше внимания уделяется саркопении. Среди существующих медикаментозных методов лечения эффективность продемонстрировали препараты тестостерона и витамина D. При этом активные метаболиты витамина D (альфакальцидол) представляются более эффективными по сравнению с нативным витамином D и безопасными по сравнению с тестостероном. Учитывая важность проблемы, в настоящее время ведется поиск новых методов медикаментозного лечения саркопении. 

Статья создана при поддержке ООО «Тева».
За дополнительной информацией обращаться:
OOO «Тева», Россия, 119049, Москва, ул. Шаболовка, д. 10, корп. 2.
Тел. +7 (495) 644-22-34, факс +7 (495) 644-22-35, www.teva.ru
FIRE-ALD3-AEL-190914-A4-674-180915

Жир вместо мышц: чем опасно саркопеническое ожирение и как его предотвратить? | Здоровье

Малоподвижный образ жизни, сидячая работа, неправильное питание, хронические стрессы — эти факторы риска сопровождают современный ритм жизни людей. Все это может приводить к развитию различных заболеваний. Вместе с врачом-диетологом клуба World Class Романов Марией Большаковой разбираемся в том, что такое саркопеническое ожирение, почему его все чаще диагностируют и что можно делать для профилактики.

Что такое саркопеническое ожирение и кто в группе риска?

Для начала разберемся с определениями. Ожирение — это заболевание, связанное с накоплением избыточного жира в организме. При саркопеническом ожирении жир тоже накапливается, но вместе с этим происходит потеря мышечной массы и силы. Это приводит к риску развития неблагоприятных исходов и ухудшению качества жизни.

Раньше саркопения и саркопеническое ожирение считались серьезной проблемой в основном людей старшей возрастной группы. Среди основных причин — возрастные изменения, нарушения гормонального фона, хронические заболевания.

После 30 лет масса и сила мышц начинают постепенно снижаться. После 60 лет этот процесс значительно ускоряется. Потеря мускулатуры может достигать 30-40%, это приводит к уменьшению скорости основного обмена веществ.

Исследования показали, что масса жировой ткани увеличивается с возрастом и к 75 годам достигает пика, при этом происходит снижение подкожно-жирового слоя и увеличение содержания висцерального (внутреннего) жира.

Саркопечическое ожирение может встречаться и в более молодом возрасте! Низкая физическая активность, инсулинорезистентность, гормональные нарушения, воспалительные процессы, хронические заболевания, плохое питание (частые ограничительные диеты, недостаточное потребление белка и т.д.) способствуют ускорению потери массы и силы мышц.

Важно понимать, что недостаточное количество мышечной и избыточное содержание жировой тканей может быть и при нормальном весе тела. Как правило, при таком варианте люди недовольны именно качеством тела (нет желаемых упругости и рельефа).

Опасность в том, что потеря мышечной массы не всегда приводит к снижению веса. Саркопеническое ожирение может скрывать потерю мышечной массы организмом за счет увеличения содержания жировой ткани.

Чем опасна саркопения и как ее распознать?

При саркопеническом ожирении повышается риск развития метаболического синдрома, который характеризуется увеличением массы висцерального жира, снижением чувствительности периферических тканей к инсулину и гиперинсулинемией. Это приводит к развитию нарушений углеводного, липидного, пуринового обменов и артериальной гипертонии.

Этот риск выше, чем при наличии только ожирения или только саркопении.

Причиной этого может служить то, что потеря массы скелетных мышц способствует развитию инсулинорезистентности. Избыточное количество висцерального жира в организме способствует поддержанию хронического воспаления, нарушается обмен веществ. Все это усугубляет инсулинорезистентость.

Потеря мышечной массы приводит к снижению силы. Способность выполнять привычную физическую работу или бытовые дела снижается, растет риск падений и травм.

Выявить саркопению помогут исследования мышечной массы и силы мышц. Например, анализ состава тела позволяет определить содержание мышечной и жировой массы тела, сравнить полученные показатели с нормой и отслеживать динамику изменений. Данное исследование рекомендуется регулярно проходить всем членам клубов World Class. Силу мышц можно определить с помощью измерения изометрической силы сжатия руки. Для таких тестов потребуется динамометр. Эффективна и оценка силы мышц с помощью других тестов, например, теста на кратковременную физическую нагрузку.

Как предотвратить саркопению?

Главный способ профилактики саркопенического ожирения — сбалансированный рацион с оптимальным потреблением белка. Он должен отвечать индивидуальным потребностям организма и целям, которые ставит человек: например, снижение веса или наращивание мышечной массы.

Кроме того, необходимы регулярные физические нагрузки, как анаэробные, так и аэробные. Они способствуют тонусу и стабильности мышечной ткани, поддерживают высокий уровень обмена веществ и расходуют энергию. При этом важно сохранять баланс между потребляемой и затрачиваемой энергией. Рацион и физические нагрузки необходимо подбирать индивидуально.

Не стоит забывать и про регулярные медицинские обследования не реже 1-2 раз в год. Они помогут отследить динамику изменений в организме и не пропустить первые тревожные звоночки. Все это поможет минимизировать риск возникновения саркопении, а еще получить здоровое и красивое тело.

Неспецифическая боль в спине и саркопения Текст научной статьи по специальности «Фундаментальная медицина»

Olga N. Voskresenskaya, et al. / Consilium Medicum. 2019; 21 (9): . https://doi.org/10.26442/20751753.2019.9.190461

Обзор

Неспецифическая боль в спине и саркопения

О.Н. Воскресенская, Д.О. Туряница

ФГАОУ ВО «Первый Московский государственный медицинский университет им. И.М. Сеченова» Минздрава России (Сеченовский Университет), Москва, Россия

Аннотация

В статье суммированы современные данные о причинах развития и методах терапии неспецифической боли в спине (НБС). Рассматриваются этиологические факторы, методы диагностики саркопении и обсуждается ее роль в возникновении боли. Основными механизмами развития сар-копении являются денервация синапсов скелетных мышц, а также естественное снижение половых гормонов, инсулиноподобного фактора роста 1 и других агентов, регулирующих синтез белков мышц. Поддержание мышечного корсета и его регенерация происходят за счет пролиферации миогенных стволовых клеток (сателлитов). Особенностью данного типа клеток является их способность не только к мышечной, но и к жировой пролиферации. Возрастное снижение уровня половых гормонов сопровождается нарушением адаптационных свойств мышечных волокон, способствует развитию процессов склерозирования и дегенерации мышечной ткани, которая в последующем становится источником боли. Высказывается предположение о том, что саркопения в условиях возрастного дефицита половых гормонов и старения, возможно, выступает в качестве дополнительного фактора риска возникновения НБС. Приводятся данные о серии исследований, изучающих влияние экспозиции анальгетиков, в частности нестероидных противовоспалительных препаратов, на репродуктивную функцию биологических моделей.

Ключевые слова: боль в спине, неспецифическая боль в спине, саркопения, НПВП, эстроген, тестостерон, возрастной дефицит половых гормонов. Для цитирования: Воскресенская О.Н., Туряница Д.О. Неспецифическая боль в спине и саркопения. Consilium Medicum. 2019; 21 (9): . DOI: 10.26442/20751753.2019.9.190461

Review

Non-specific back pain and sarcopenia

Olga N. Voskresenskaya, Denis O. Turyanitsa

Sechenov First Moscow State Medical University, Moscow, Russia

и

Abstract

The article summarizes modern data on causes of development and treatment methods of non-specific back pain (NBP). Sarcopenia etiologic factors and diagnostic methods are presented and its role in pain development is discussed. The main mechanisms of sarcopenia development are skeletal muscle denervation and natural decrease of levels of sex hormones, insulin-like growth factor 1 and other agents that regulate muscle protein synthesis. Sustenance and regeneration of muscle core result from myogenic stem cells (satellites) proliferation. The specifics of the cells are its ability for not only muscle but also for adipose proliferation. Age-related decrease of sex hormones level results in deterioration of muscle fibers adaptational properties and contributes to sclerosing processes and degeneration of muscle tissue that eventually becomes a source of pain. It is suggested that sarcopenia in conditions of age-related decrease of sex hormones level may present an additional risk factor for NBP development. Results of a series of studies investigating the influence of analgesics exposure, in particular, nonsteroidal anti-inflammatory drugs, on the reproductive function in biological models are presented. Key words: back pain, non-specific back pain, sarcopenia, NSAIDS, estrogen, testosterone, age-related sex hormones deficit. Key words: back pain, nonspecific back pain, sarcopenia, NSAIDs, estrogene, testosterone, age deficiency of sex hormones.

For citation: Voskresenskaya O.N., Turyanitsa D.O. Non-specific back pain and sarcopenia. Consilium Medicum. 2019; 21 (9): . DOI: 10.26442/20751753.2019.9.190461

Боль в спине является одной из ведущих причин, нарушающих повседневную активность пациентов и приводящих к нарушению трудоспособности в среднем возрасте. До 90% населения в течение своей жизни хотя бы раз испытывают боль в одном из отделов позвоночника. Более 85% из этих случаев относится к так называемой неспецифической боли в спине (НБС), в остальных наблюдениях боль является следствием переломов, реже — воспалительных заболеваний или новообразований [1, 3]. Факторами риска развития боли в спине являются возраст (пик заболеваемости приходится на 40-50 лет), избыточная физическая и, в частности, статическая нагрузка, высокий рост, ожирение, курение. Активно обсуждается роль генетических факторов [2].

НБС отличается нечеткостью в вопросе определения причин ее возникновения. Развитие данного вида боли чаще связывают с биомеханическими нарушениями, и, как правило, выделяют преимущественно три ее источника: мышцу, сустав или спинномозговой корешок. При поражении последнего развивается радикулопатия, встречающаяся в 5-7% случаев. Повреждение мышечного или суставного аппарата в структуре НБС составляет более 90% случаев, однако дифференцировка этих причин представляет значительные трудности вследствие их частой комор-бидности, а поражение нескольких отделов скелетно-мы-шечной системы может приводить к более выраженным нарушениям биомеханики [4].

В последние десятилетия на первый план вышло изуче-

ние причин развития боли, связанных с мышцами, для обозначения которых стали использовать термины «мы-шечно-тонический» и «миофасциальный» синдромы [5]. При указанных синдромах в большинстве случаев можно выявить так называемые триггерные точки — спазмиро-ванные участки мышц или их сухожилия, при пальпации которых возникает боль [6]. В большинстве случаев источником боли служит непосредственно мышца или мышца является одним из ведущих компонентов болевого синдрома.

В настоящее время все большее внимание уделяется такому патологическому состоянию, как саркопения. Сарко-пения сопровождается уменьшением мышечной массы, и, как следствие, мышечной силы. Распространенность сар-копении в популяции по данным различных источников варьирует от 4,3 до 73,3% и зависит от возрастных критериев включения и особенностей исследуемых групп [7].

В патогенезе возникновения саркопении рассматриваются механизмы снижения регулирующего влияния гормональной системы организма в силу ее повреждения или развивающегося с возрастом дефицита половых гормонов (менопаузальные изменения у женщин; возрастной андро-генный дефицит у мужчин). Учитывая, что с возрастом гормональные изменения происходят у подавляющего числа людей, изучение их влияния на состояние мышечного корсета имеет большое значение. Интерес к саркопении как к патологическому состоянию сформировался в 1989 г., с момента введения термина «саркопения» I. Rozenberg.

В 1998 г. R. Baumgartner связал клинические проявления в виде падений и повышенного риска получения травм по мере увеличения возраста с сарко-пенией [8]. В 2010 г. Европейской рабочей группой по саркопении у пожилых людей (EWGSOP), Европейским обществом по клиническому питанию и обмену веществ (ESPEN-SIG) и Международной рабочей группой по саркопении (IWGS) было принято окончательное на данный момент определение саркопении и методика ее диагностики. В 2016 г. саркопения была введена в Международную классификацию болезней 10-го пересмотра как M62.84 [9]. В соответствии с рекомендациями Европейского консенсуса от 2010 г. саркопения определяется как состояние, характеризующееся прогрессирующей и генерализованной утратой мышечной массы и силы с повышением риска неблагоприятных событий, таких как ухудшение качества жизни, инвалидизация и смерть. Диагностическими критериями саркопении являются снижение мышечной массы, мышечной силы и мышечной функции [10]. Для определения массы скелетной мускулатуры используются антропометрия, био-импедансный анализ, тотальное или частичное определение калия в обезжиренных мягких тканях и методы визуализации (компьютерная томография, магнитно-резонансная томография, двухфотонная рентгеновская абсорбциометрия). Для определения силы скелетной мускулатуры чаще используются динамометрия, определение степени сгибания/разгибания коленного сустава, пиковой скорости выдоха. С целью определения функциональных возможностей мышечной ткани в клинических исследованиях используется тест Short Physical Performance Battery (SPPB), тест на определение скорости ходьбы, тест «Подъем по лестнице», тест «Подняться и пройти». Кроме того, на начальном уровне обследования возможно использование опросников SarQol (Sarcopenia and Quality of Life — оценка качества жизни при саркопении) и SARC-F (Strength, Assistance with Walking, Rise from a chair, Climb stairs and Falls — оценка силы, необходимости помощи при ходьбе, подъема со стула, подъема по лестнице и падений) [7].-6 (интерлейкин-6) и VDR (рецептор витамина D) в механизмах реализации мышечной силы и объема мышцы [7]. Причинами вторичной саркопении считают хроническое воспаление, нарушение питания, сниженную физическую активность, первичное повреждение мышцы, другие (неинволюционные) причины нарушения гормонального статуса. В зависимости от степени повреждения мышц в соответствии с рекомендациями

EWGSOP предлагается выделять три стадии развития саркопении: пресар-копения, характеризующаяся уменьшением мышечной массы без изменения ее силы и функции; собственно саркопения, при которой наблюдается уменьшение скелетной мышечной массы и снижение ее силы или функции; тяжелая форма саркопении, сопровождающаяся снижением всех трех параметров [12]. Поддержание мышечного корсета и его регенерация происходят за счет пролиферации миогенных стволовых клеток (сателлитов). Особенностью данного типа клеток является их способность не только к мышечной, но и к жировой пролиферации. В серии исследований, проведенных в последние 10 лет, доказано, что при нарушении адаптации мышечной системы наблюдается тенденция к реализации ство-

Курантил® N

Ш I ДИПИРИДАМОЛ

Вазодилатирующее средство1 Антиагрегант1

Курантил» N 25 таблетки 25 мг № 1201 Курантил® N 75 таблетки 75 мг № 401

ООО «Берлин-Хеми/А.Менарини». 123112, Москва, Пресненская набережная, д. 10, БЦ «Башня на Набережной», блок Б. Тел.: (495)785-01-00, факс: (495)785-01-01. http://vwvw.berlin-chemle.ru

1Ш_Си 11_12_2017. Одобрено 28.11.2017

к!А БЕРЛИН-ХЕМИ

М МЕНАРИНИ

ловых клеток с развитием жировой инфильтрации мышц. Таким образом, постепенное уменьшение массы тела происходит за счет мускулатуры, а повышение — за счет жировых отложений на основе единого субстрата клеток-сателлитов, что усиливает нагрузку на сохраняющиеся мышечные волокна, обеспечивая последующее перерождение мышцы [13]. Возрастное снижение уровня половых гормонов, сопровождающееся нарушением адаптационных свойств мышечных волокон, способствует развитию процессов склерозирования и дегенерации мышечной ткани, которая в последующем становится источником боли. Так, при снижении уровня тестостерона, в среднем начиная с 30 лет, ежегодно мышечная масса уменьшается на 1%, а цикличное колебание уровня половых гормонов может приводить к изменению восприятия уровня боли [14-16]. Данный механизм, предположительно, связан со снижением способности к подавлению хронического воспаления. На биологических моделях было показано, что при кастрации крыс выявляется повышение уровня биологических маркеров воспаления в тканях — циклооксигеназы-2 и проста-гландина Е2, содержание которых уменьшается после начала заместительной терапии тестостероном [17]. Кроме того, использование тестостерона у мужчин способно стимулировать восстановление мышечных волокон, что может создать новую терапевтическую стратегию при лечении боли в спине в условиях возрастного дефицита половых гормонов [18]. Длительное время считалось, что влияние гормональных изменений на процесс развития саркопении более выражено у женщин [19]. Тем не менее исследования последних лет показывают, что протекающий в более стертой форме возрастной дефицит тестостерона у мужчин оказывает не меньшее патологическое действие на мышечное волокно [20]. Саркопения, как и боль в спине, встречается у женщин несколько чаще, чем у мужчин.

По современным представлениям к лечению боли в спине необходимо подходить системно. Так, в соответствии с рекомендациями Российского общества изучения боли, подход к терапии НБС необходимо начинать с образовательной программы для пациента, включающей в себя разъяснение доброкачественности заболевания — класс (уровень) II (В) — и необходимости поддержания двигательной активности — класс (уровень) II (В). Для купирования боли препаратами выбора являются нестероидные противовоспалительные препараты (НПВП) — класс (уровень) II (В), в абсолютном большинстве исследований доказавшие свою эффективность относительно плацебо, а также миорелаксанты — класс (уровень) III (С). По данным российского многоцентрового исследования НОТА (НПВП для Обезболивания: Терапевтический анализ) комбинация НПВП и миорелаксантов обеспечивает лучший терапевтический эффект [4]. Широко используются кинезиотерапия [21] и мануальная терапия [24]. Продолжаются исследования в отношении лечебной физкультуры или комплекса упражнений — класс (уровень) IV ф) [22, 23]. В большинстве случаев радикулопатии, характеризующейся наличием невропатической боли, применением консервативной терапии удается достичь существенного ослабления и регресса болевого синдрома. Как правило, применяются препараты из группы антидепрессантов или антиконвульсантов — класс (уровень) I (А). В случае резистентности боли в спине обсуждаются и иные методы лечения [24, 25].

Число «потребителей» НПВП очень велико и все время растет: на 2016 г. а нашей стране зарегистрированы 19,2 млн людей с болезнями костно-мышечной системы, большинство из которых составляют больные остеоартритом и НБС. В 2017 г. в России продано 125 млн упаковок различных НПВП, среди которых 91,74 млн пришлось на таблетки и капсулы, а 22,67 млн — на инъекционные формы. Факторами, влияющими на эффективность обезболивающего лече-

ния, являются пожилой возраст больного и избыточная масса тела, четкие признаки «воспалительной боли» [4]. Однако необходимо учитывать, что в современных реалиях доступности лекарственных препаратов из группы НПВП нередко отмечается их бесконтрольный прием, а также использование без необходимых показаний. Так, по данным экологических исследований употребление обезболивающих во всем мире так велико, что метаболиты и, зачастую, непосредственно НПВП можно обнаружить в поверхностных слоях водоемов. На основании этого фактора была проведена серия исследований, выявляющая влияние экспозиции анальгетиков, в частности НПВП, на репродуктивную функцию биологических моделей, выявившая нарушение синтеза половых гормонов у исследуемых животных [26-29]. Имеющиеся данные по наблюдению уровня и функциональной активности половых гормонов на фоне применения НПВП у людей противоречивы. Часть исследований не выявляет изменений в связи с приемом НПВП [33], другие — констатируют нарушение синтеза тестостерона на фоне приема препаратов данной группы [30]. Помимо этого, серия исследований в области спортивной медицины, анализировавшая применение НПВП в качестве корректора мышечной боли после занятий спортом, показывает нарушение адаптивных механизмов мышц [31, 32].

Резюмируя изложенное, можно предположить, что саркопения в условиях возрастного дефицита половых гормонов и старения, возможно, выступает в качестве дополнительного фактора риска возникновения НБС. При получении доказательств в соответствующих исследованиях этот факт необходимо будет учитывать для определения терапевтической тактики ведения данной категории пациентов.

Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов.

Conflict of interests. The authors declare that there is not conflict of interests.

Литература/References

1. Парфенов В.А., Исайкин А.И. Боль в нижней части спины: мифы и реальность. — М.: ИМА-ПРЕСС, 2016.

[Parfenov V.A., Isaikin A.I. Pain in the lower back: myths and reality. Moscow: IMA-PRESS, 2016 (in Russian).]

2. Исайкин А.И., Кузнецов И.В., Кавелина А.В., Иванова М.А. Неспецифическая люмбалгия: причины, клиника, диагностика, лечение. Неврология, нейропсихиатрия, психосоматика. 2015; 7 (4): 101-9.

[Isaikin A.I., Kuznetsov I.V., Kavelina A.V., Ivanova M.A. Nespetsificheskaia liumbalgiia: prichiny, klinika, diagnostika, lechenie. Nevrologiia, neiropsikhiatriia, psikhosomatika. 2015; 7 (4): 101-9 (in Russian).]

3. Balagué F, Mannion AF, Pellisé F, Cedraschi C. Non-specific low back pain. Lancet 2012; 379: 482-91.

4. Каратеев А.Е., Погожева Е.Ю., Филатова Е.С. и др. Факторы, влияющие на результаты анальгетической терапии. Результаты Российского многоцентрового исследования НОТА (НПВП для обезболивания: терапевтический анализ). Терапевтический архив. 2018; 90 (6): 65-73.

[Karateev, A.E., Pogozheva, E.Yu., Filatova, E.S. et al. Faktory, vliiaiushchie na rezul’taty anal’ge-ticheskoi terapii. Rezul’taty Rossiiskogo mnogotsentrovogo issledovaniia NOTA (NPVP dlia obez-bolivaniia: terapevticheskii analiz). Therapeutic Archive. 2018; 90 (6): 65-73 (in Russian).]

5. Исайкин А.И., Шевцова Г.Е., Рожков Д.О. и др. Роль мышечного фактора в развитии поясничной боли. Неврология, нейропсихиатрия,психосоматика.2017;9 (2): 95-101. [Isaikin A.I., Shevtsova G.E., Rozhkov D.O. et al. Rol’ myshechnogo faktora v razvitii poiasnichnoi boli. Nevrologiia, neiropsikhiatriia, psikhosomatika. 2017; 9 (2): 95-101 (in Russian).]

6. Парфенов В.А. Причины, диагностика и лечение боли в нижней части спины. Неврология, нейропсихиатрия,психосоматика. 2009;1: 19-22.

[Parfenov V.A. Prichiny, diagnostika i lechenie boli v nizhnei chasti spiny. Nevrologiia, neiropsikhiatriia, psikhosomatika. 2009; 1: 19-22 (in Russian).]

7. Мокрышева Н.Г., Крупинова Ю.А., Володичева В.Л. и др. Саркопения глазами эндокринолога. Ожирение и метаболизм. 2018; 15 (3): 21-7.

[Mokrysheva N.G., Krupinova Iu.A., Volodicheva V.L. et al. Sarkopeniia glazami endokrinologa. Ozhirenie i metabolizm. 2018; 15 (3): 21-7 (in Russian).]

8. Давузов Р.Р., Какеев Б.А., Сабиров И.С. и др. Саркопенический синдром: современный

взгляд на проблему (обзор литературы). Вестн. КРСУ. 2018; 18 (2): 104-8.

[Davuzov R.R., Kakeev B.A., Sabirov I.S. et al. Sarkopenicheskii sindrom: sovremennyi vzgliad na

problemu (obzor literatury). Vestn. KRSU. 2018; 18 (2): 104-8 (in Russian).]

9. Шостак Н.А., Мурадянц А.А., Кондратов А.А. Саркопения и перекрестные синдромы -значение в клинической практике. Клиницист. 2016; 10 (3): 10-4.

[Shostak N.A., Muradiants A.A., Kondrashov A.A. Sarkopeniia i perekrestnye sindromy — znache-nie v klinicheskoi praktike. Klinitsist. 2016; 10 (3): 10-4 (in Russian).]

10. Белая Ж.Е. Саркопения: современные подходы к диагностике и лечению. Эффективная фармакотерапия. 2014; 46: 42-9.

[Belaia Zh.E. Sarkopeniia: sovremennye podkhody k diagnostike i lecheniiu. Effektivnaia farmako-terapiia. 2014; 46: 42-9 (in Russian).]

11. Поворознюк В.В., Дзерович Н.И. Саркопения и Возраст: обзор литературы и результаты собственных исследований. Боль. Суставы. Позвоночник. 2012; 3 (7): 7-13. [Povorozniuk V.V., Dzerovich N.I. Sarkopeniia i Vozrast: obzor literatury i rezul’taty sobstvennykh issledovanii. Bol’. Sustavy. Pozvonochnik. 2012; 3 (7): 7-13 (in Russian).]

12. Чалая В.А., Сеитмеметова С.А. Возрастные изменения мышечной ткани Саркопения. Меж-дунар. студ. науч. вестн. 2019; 1.

[Chalaia V.A., Seitmemetova S.A. Vozrastnye izmeneniia myshechnoi tkani Sarkopeniia. Mezhdu-nar. stud. nauch. vestn. 2019; 1. (in Russian).]

13. Радченко В.А., Дедух Н.В., Ашукина Н.А., Скиданов А.Г. Структурные особенности пара-вертебральных мышц в норме и при дегенеративных заболеваниях поясничного отдела позвоночника (обзор литературы). Ортопедия, травматология и протезирование. 2014; 4: 122-7.

[Radchenko V.A., Dedukh N.V., Ashukina N.A., Skidanov A.G. Strukturnye osobennosti paraver-tebral’nykh myshts v norme i pri degenerativnykh zabolevaniiakh poiasnichnogo otdela pozvo-nochnika (obzor literatury), Ortopediia, travmatologiia i protezirovanie. 2014; 4: 122-7 (in Russian).]

14. Ильясов Р.Р., Калинченко С.Ю., Данилов А.Б. Роль половых гормонов в восприятии боли. Manage pain 2015; 2.

[Il’iasov R.R., Kalinchenko S.Iu., Danilov A.B. Rol’ polovykh gormonov v vospriiatii boli. Manage pain 2015; 2 (in Russian).]

15. Marjolein de Kruijf, Lisette Stolka, M. Carola Zillikens. Lower sex hormone levels are associated with more chronic musculoskeletal pain in community-dwelling elderly women. PAIN 2016; 157: 1425-31.

16. Balter JE, Molner JL. Mechanical Pain Sensitivity and the Severity of Chronic Neck Pain and Disability Are Not Modulated Across the Menstrual Cycle. J Pain 2013; 14 (11): 1450-9.

17. Hideaki Ito, Dong Wang, Xinmin Zha. Castration increases PGE2 release from the bladder epithelium in male rats. Life Sci 2018; 193: 252-6.

18. Buvat J, Maggi M, Guay A, Torres LO. Testosterone deficiency in men: Systematic review and standard operating procedures for diagnosis and treatment. J Sex Med 2013; 10: 245-84.

19. Yi Xiang J. Wang, Menopause as a potential cause for higher prevalence of low back pain in women than in age-matched men. J Orthop Translation 2017; 8: 1-4.

20. Myung Jun Shin, Yun Kyung Jeon, In Joo Kim. Testosterone and Sarcopenia. World J Mens Health 2018; 36 (3): 192-8.

21. Аверченкова А.А., Парфенов В.А. Хроническая боль в нижней части спины (люмбалгия) у пожилых. Клин. геронтология. 2015; 21 (7-8): 3-9.

[Averchenkova A.A., Parfenov V.A. Khronicheskaia bol’ v nizhnei chasti spiny (liumbalgiia) u pozhi-lykh. Klin. gerontologiia. 2015; 21 (7-8): 3-9 (in Russian).]

22. Lizier DT, Perez MV, Sakata RK. Exercises for Nonspecific Low Back Pain Treatment. Revista Bra-sileira de Anestesiologia 2012; 62 (6): 838-46.

23. Emmanuel Gomes Ciolac, Jose Messias Rodrigues-da-Silva. Resistance Training as a Tool for Preventing and Treating Musculoskeletal Disorders. Sports Med 2016; 46 (9): 1239-48.

24. Парфенов В.А., Яхно Н.Н., Кукушкин М.Л. и др. Острая неспецифическая (скелетно-мы-шечная) поясничная боль. Рекомендации Российского общества по изучению боли (РОИБ). Неврология, нейропсихиатрия, психосоматика. 2018; 10 (2): 4-11.

[Parfenov V.A., lakhno N.N., Kukushkin M.L. et al. Ostraia nespetsif i cheskai a (skeletno-myshech-naia) poiasnichnaia bol’. Rekomendatsii Rossiiskogo obshchestva po izucheniiu boli (ROIB). Nev-rologiia, neiropsikhiatriia, psikhosomatika. 2018; 10 (2): 4-11 (in Russian).]

25. Зайченко А.В., Баринов А.Н., Махинов К.А., Брюханова Т.А. Лечение боли в спине, рефрактерной к нестероидным противовоспалительным средствам. МС. 2013;12:89-96. [Zaichenko A.V., Barinov A.N., Makhinov K.A., Briukhanova T.A. Lechenie boli v spine, refrakternoi k nesteroidnym protivovospalitel’nym sredstvam. MS. 2013; 12: 89-96 (in Russian).]

26. Efosa NJ, Kleiner W, Kloas W, Hoffmann F. Diclofenac can exhibit estrogenic modes of action in male Xenopus laevis, and affects the hypothalamus-pituitary-gonad axis and mating vocalizations, Chemosphere 2017; 173: 69-77.

27. Kyunghee Ji, Xiaoshan Liua, Saeram Lee et al. Effects of non-steroidal anti-inflammatory drugs on hormones and genes of the hypothalamic-pituitary-gonad axis, and reproduction of zebrafish. J Hazardous Materials 2013; 254-5, 242-51.

28. Kyunghee Kwak, Kyunghee Ji, Younglim Kho et al. Chronic toxicity and endocrine disruption of naproxen in freshwater waterfleas and fish, and steroidogenic alteration using h395R cell assay. Chemosphere 2018; 204: 156-62.

29. Rossitto M, Marchive C, Pruvost A et al. Intergenerational effects on mouse sperm quality after in utero exposure to acetaminophen and ibuprofen. FASEB J 2019; 33 (1): 339-57.

30. Kristensen DM, Desdoits-Lethimonier C, Mackey AL et al. Ibuprofen alters human testicular physiology to produce a state of compensated hypogonadism. Proc Natl Acad Sci USA 2018; 115 (4): 715-24.

31. Lilja M, Mandic M, Apro W et al. High doses of anti-inflammatory drugs compromise muscle strength and hypertrophic adaptations to resistance training in young adults. Acta Physiol (Oxf) 2018; 222 (2).

32. Schoenfeld BJ. The Use of Nonsteroidal Anti-Inflammatory Drugs for Exercise-Induced Muscle Damage Implications for Skeletal Muscle Development. Sports Med 2012; 42 (12): 1017-28.

33. Hoyer BB, Ramlau-Hansen CH, Bonde JP et al. Use of nonprescription analgesics and male reproductive function. Reprod Toxicol 2017; 74: 70-6.

ИНФОРМАЦИЯ ОБ АВТОРАХ I INFORMATION ABOUT THE AUTHORS

Воскресенская Ольга Николаевна — д-р мед. наук, проф., проф. каф. нервных болезней и нейрохирургии Института клинической медицины ФГАОУ ВО «Первый МГМУ им. И.М. Сеченова» (Сеченовский Университет). E-mail: vos-olga@yandex.ru; ORCID: https://orcid.org/0000-0002-7330-633X

Туряница Денис Олегович — аспирант каф. нервных болезней и нейрохирургии Института клинической медицины ФГАОУ ВО «Первый МГМУ им. И.М. Сеченова» (Сеченовский Университет). E-mail: runeurologist@gmail.com; ORCID: https://orcid.org/0000-0002-8380-9686

Olga N. Voskresenskaya — D. Sci. (Med.), Full Prof., Sechenov First Moscow State Medical University. Email: vos-olga@yandex.ru; ORCID: https://orcid.org/0000-0002-7330-633X

Denis O. Turyanitsa — Graduate Student, Sechenov First Moscow State Medical University. E-mail: runeurologist@gmail.com; ORCID: https://orcid.org/0000-0002-8380-9686

Статья поступила в редакцию / The article received: Статья принята к печати / The article approved for publication:

Нервно-мышечное соединение является фокусом передачи сигналов mTORC1 при саркопении

Уход за животными

Все процедуры были выполнены в соответствии со швейцарскими правилами проведения экспериментов на животных и одобрены ветеринарной комиссией кантона Базель-Штадт. Самцов мышей C57BL / 6JRj приобретали из стареющей колонии в Janvier Labs (Le Genest-Saint-Isle, Франция). Трансгенные мыши TSCmKO и их генотипирование были ранее описаны 11,70 . Однопометники, подвергнутые флоксу на Tsc1 , но не экспрессирующие рекомбиназу Cre, использовали в качестве контроля.

Введение рапамицина

Самцов мышей C57BL / 6JRj содержали в 12-часовом цикле свет-темнота (с 6:00 до 18:00) при 22 ° C (диапазон 20-24 ° C) и 55% (диапазон 45-65%). ) относительной влажности и были адаптированы к индивидуальному помещению и контрольной диете AIN-93M (TestDiet, 58M1-9GH6), содержащей 488 ppm Eudragit (Emtora), в течение 1 месяца до начала экспериментов. За неделю непосредственно перед началом эксперимента были измерены масса тела, потребление пищи, сила захвата и состав тела (с помощью ЭхоМРТ), которые использовались для сбалансированного группового отбора.Каждая группа (30mCON и 30mRM) содержала мышей с почти одинаковым средним значением и стандартным отклонением для каждого измерения. Мышей 30mRM переводили на диету AIN-93M, содержащую 488 ppm инкапсулированного (Eudragit) рапамицина (TestDiet, 58M1-9GH7) для активной композиции рапамицина 42 мг / кг -1 . Потребление пищи и массу тела измеряли еженедельно. Для мышей с массой тела более 34 г мы ограничили ежедневное потребление пищи средним потреблением контрольной группы (3,1 г). Таким мышам с ограничениями ежедневно давали пищу примерно в 17:00.Этот уровень ограничения предотвращал переедание, но не вызывал поведенческих изменений, наблюдаемых у мышей с ограничением калорий, таких как упреждающее поведение, и мыши были неотличимы от своих коллег, получавших ad libitum, по всем параметрам теста. Переедание наблюдалось примерно у половины контрольной группы и у трети мышей, получавших рапамицин, в возрасте от 15 до 20 месяцев. У мышей рапамицина ограничение пищи больше не требовалось к 22-месячному возрасту, в то время как количество мышей ограниченного контроля неуклонно снижалось с 20-месячного возраста и больше не требовалось к 29-месячному возрасту.Мыши, которым давали ограниченную диету, часто ели не всю свою порцию пищи. Оставшуюся пищу взвешивали и рассчитывали еженедельное потребление пищи.

Анализ состава тела

Состав тела, включая жир и мышечную массу, был проанализирован с помощью EchoMRI-100 (EchoMRI Medical Systems) у обездвиженных мышей в сознании.

Функция мышц всего тела

Для произвольного анализа беговых колес мышей сначала приучали к бегу на колесах в течение 3 дней, а затем им предоставили бесплатный доступ к беговым колесам в течение 24 часов каждые 2 месяца.Беговая активность регистрировалась каждую минуту. Данные представлены как общее расстояние, пройденное за 24 часа. Мыши чаще всего бегали рано утром и реже в дневное время. Паттерны активности не различались между группами 10mCON, 30mCON и 30mRM. Для теста перевернутого подвешивания мышей помещали на сетку, которую затем медленно переворачивали вверх дном и удерживали в положении ~ 40 см над коробкой с пенопластом у основания, пока мышь не перестала держаться за сетку. Результативность была принята как лучшее из трех испытаний, разделенных как минимум 30 минутами.Сила захвата на всех конечностях измерялась, помещая мышей на небольшую сетку, прикрепленную к силомеру (Columbus Instruments). После того, как мышь прочно зацепилась за решетку всеми четырьмя лапами, ее осторожно потянули в горизонтальном направлении с постоянной скоростью до тех пор, пока захват не был сломан. Работоспособность измерялась как медиана трех-пяти попыток с отдыхом не менее 10 минут между тестами. Испытания, в которых мышь активно тянула за сетку во время тестирования, были отменены. Один и тот же исследователь провел все измерения силы захвата в одно и то же время дня.

Анализ походки

Анализ походки выполнялся с использованием системы Noldus CatWalk XT 71 в соответствии с инструкциями производителя (Справочное руководство CatWalk XT 10.6). Мышей обучали пересекать освещенную дорожку, проводя по крайней мере три успешных испытания за неделю до испытания. Поскольку тестирование проводилось в светлое время суток, перед завершением теста мышей «прогревали» на балансировочной балке с вращающимся стержнем со скоростью 12 об / мин в течение 10 минут. Программное обеспечение CatWalk XT использовалось для анализа параметров походки.Длина шага — это расстояние между последовательными постановками лапы. Скорость и продолжительность поворота относятся к периоду, когда лапа не соприкасается со стеклянной пластиной. Рабочий цикл относится к фазе стояния в процентах от всего цикла шага, то есть стоя + мах. База поддержки относится к расстоянию между двусторонними лапами. Время выдержки — это период времени, в течение которого лапа контактирует со стеклом между шагами. Для каждой мыши было выполнено не менее трех совместимых прогонов.

Комплексная система мониторинга лабораторных животных (CLAMS)

CLAMS (Columbus Instruments, Колумбус, Огайо) использовалась для оценки двигательной активности, расхода энергии, потребления кислорода (VO 2 ), производства CO 2 (VCO 2 ) и коэффициент респираторного обмена (RER), который представляет собой отношение VCO 2 к VO 2 .RER зависит от использования энергетического субстрата в диапазоне от 1 до 0,7, что указывает на предпочтительное использование углеводов и липидов соответственно. Двигательная активность измерялась по осям x , y и z с использованием инфракрасных лучей. Расход энергии был рассчитан с использованием значений VO 2 и RER и впоследствии нормирован на площадь поверхности тела (масса тела −0,75 ). Данные собирались в течение 3 дней подряд, а для анализа использовались последние 24 часа (с 6:00 до 18:00).

Сила мышц in vitro

Для измерения силы мышц EDL и SOL in vitro мышцы были осторожно иссечены и помещены на изолированную мышечную систему 1200 A (Aurora Scientific, Аврора, Онтарио, Канада) в ванне для органов, содержащей 60 мл раствора Рингера (137 мМ NaCl, 24 мМ NaHCO 3 , 11 мМ глюкозы, 5 мМ KCl, 2 мМ CaCl 2 , 1 мМ MgSO 4 и 1 мМ NaH 2 PO 4 ) который был газирован 95% O 2 , 5% CO 2 при 30 ° C.После определения оптимальной длины мышцы стимулировали импульсами 15 В. Мышечную силу регистрировали в ответ на импульсы длительностью 500 мс с частотой 10–250 Гц. Утомляемость мышц оценивали по 6-минутной стимуляции с частотой 200 Гц для EDL и 120 Гц для SOL соответственно. Для оценки силы, стимулируемой нервом, по сравнению с силой, стимулируемой мышцами, in vitro, мышцы SOL были рассечены с прикрепленным седалищным нервом и установлены в системе, описанной выше. Мышцы стимулировали либо косвенно, через седалищный нерв через всасывающий электрод (с импульсами 4 В), либо напрямую через пару электродов, помещенных в ванну с обеих сторон мышцы 72 .

Иммуноокрашивание поперечных срезов мышц

Мышцы были помещены в среду с оптимальной температурой для резки (OCT, Tissue-Tek) в состоянии покоя и быстро заморожены в оттаиваемом изопентане в течение ~ 1 мин перед переносом в жидкий азот и хранением при -80 ° C . Срезы мышц (10 мкм) вырезали из середины живота при -20 ° C на криостате (Leica, CM1950), собирали на адгезионных слайдах SuperFrost Plus (VWR) и хранили при -80 ° C. Срезы из каждого экспериментального условия всегда помещали на одном и том же предметном стекле для обеспечения точного сравнения.Для типирования волокон срезы блокировали и повышали проницаемость в PBS, содержащем 10% козьей сыворотки и 0,4% тритона X-100, в течение 30 минут перед инкубацией в течение 2 часов при комнатной температуре в растворе первичных антител, содержащем BA-D5, SC-71, BF- F3 и ламинин (# 11575, Abcam) и 10% козья сыворотка. Антитела BF-F3, BA-D5 и SC-71 были разработаны профессором Стефано Скьяффино и получены из Гибридомного банка исследований развития, разработанного под эгидой Национального института детского здоровья и человеческого развития и поддерживаемого Университетом Айовы. Кафедра биологии.Срезы промывали четыре раза по 10 мин в PBS, а затем инкубировали в растворе вторичных антител, содержащем DyLight 405 (# 115-475-207, Jackson), Alexa568 (# A-21124, Invitrogen), Alexa488 (# A-21042, Invitrogen. ), Alexa647 (# 711-605-152, Jackson) и 10% козьей сыворотки. Затем срезы промывали четыре раза по 10 мин в PBS и наносили на них антибактериальное средство ProLong ™ Gold (Invitrogen). Для централизованных ядер, специфичных для определенного типа волокон, окрашивание волокон типа I было заменено окрашиванием DAPI в мышцах TA и EDL, тогда как окрашивание волокон типа IIB было заменено на DAPI, а окрашивание волокон DyLight 405 (# 115-475-207, Jackson) было заменено на Вторичное антитело Alexa488 (# A21141, Invitrogen) в мышце SOL.Для окрашивания pS6 срезы фиксировали в 4% PFA в течение 10 мин до иммуноокрашивания. Первичные использованные антитела были pS6235 / 236 (# 2211, Cell Signaling) и Laminin-2α (# 11576, Abcam). Вторичными антителами были Alexa647 (# 711-605-152, Jackson), Alexa488 (# 112-545-003, Jackson) и конъюгат α-бунгаротоксина Alexa555 (# B35451, Invitrogen). Мышечные срезы были визуализированы в Biozentrum Imaging Core Facility с помощью сканера слайдов Axio Scan.Z1 (Zeiss), оборудованного соответствующими полосовыми фильтрами. Макросы Fiji были разработаны собственными силами, чтобы позволить автоматический анализ типов мышечных волокон или pS6-положительных волокон (на основе пороговых значений интенсивности) и площади поперечного сечения мышц (т.е.е., минимальный диаметр Ферета, исходя из сегментации ячеек) 73 . Все макросы и скрипты, использованные в этом исследовании, доступны по запросу.

Экстракция белка и вестерн-блот-анализ

Клетки промывали ледяным PBS и лизировали в буфере RIPA (50 мМ трис-HCl, pH 8, 150 мМ NaCl, 1% NP-40 (Roche), 0,5% дезоксихолат натрия , 0,1% SDS, ингибиторы протеаз и фосфатаз (Roche)). Рассеченные мышцы мгновенно замораживали, измельчали ​​в жидком азоте и лизировали в буфере RIPA с 20 мМ EDTA перед обработкой ультразвуком и инкубацией в течение 2 часов при 4 ° C.Нерастворимый материал удаляли центрифугированием (16000 × g , 30 мин, 4 ° C). После корректировки концентраций белка (определяемых анализом BCA) с помощью буфера RIPA образцы нагревали в течение 5 минут при 95 ° C в буфере Лэммли (0,1 М трис-HCl, pH 6,8, 10% глицерин, 2% SDS, 0,04% бромфеноловый синий, и 1% β-меркаптоэтанол). Белки разделяли на гелях NuPAGE 4–12% Bis-Tris (Life Technologies) и переносили на нитроцеллюлозные мембраны. Затем мембраны блокировали 5% BSA0.1% Tween20 в TBS в течение 45 мин при комнатной температуре, а затем инкубировали в течение ночи при 4 ° C с первичными антителами, разведенными в блокирующем растворе. Затем мембраны промывали 3 × 10 мин в TBS перед инкубацией во вторичных антителах, конъюгированных с пероксидазой хрена, разведенных в блокирующем растворе. После промывки мембран в течение 3 × 10 мин в TBS иммунореактивность визуализировали с использованием набора субстратов KLP LumiGlo Chemiluminescence Substrate Kit (Seracare) с аппаратом Fusion Fx (Vilber). Обилие белка определяли количественно с помощью FusionCapt Advance (Vilber) или ImageJ как среднее значение серого минус фон и нормализовали по белку домашнего хозяйства.

Клеточная культура

Миобласты мыши C2C12 культивировали при 37 ° C в атмосфере 5% CO 2 в DMEM (61965026, Gibco) с добавлением 10% (об. / Об.) Фетальной бычьей сыворотки (FBS, Biological Industries) и 1% (об. / об.) пенициллин / стрептомицин (Sigma, питательная среда). После достижения слияния клетки с низким числом пассажей (P6 – P10) инкубировали в DMEM с добавлением 2% (об. / Об.) Лошадиной сыворотки (Biological Industries) и 1% (об. / Об.) Пенициллина / стрептомицина (среда для дифференцировки) в течение 5 дней. –6 дней, чтобы вызвать образование зрелых многоядерных мышечных трубок.Чтобы вызвать истощение, зрелые мышечные трубки инкубировали в среде для дифференцировки, содержащей 20 нг мл -1 рекомбинантного фактора некроза опухоли-альфа мыши (TNFα, Gibco) и 100 нг мл -1 рекомбинантного гамма-интерферона мыши (IFNγ, Gibco) для 24 ч. Рапамицин (LC Laboratories) вводили за 1 ч до лечения цитокинами. Для исследования подавления активности mTORC1 рапамицином зрелые мышечные трубки инкубировали в 10 нМ рапапмицине или 200 нМ Torin1 (Millipore) в течение 24 часов. Аутофагический поток измеряли путем блокирования системы аутофагии-лизосомальной деградации с помощью 200 нМ бафиломицина A1 (Med Chem Express) за 4 часа до лизиса.

Диаметр миотрубок

Миотрубки культивировали в 12-луночных планшетах, как описано выше. Среду аспирировали, и клетки дважды промывали в течение 5 мин PBS Дульбекко pH 7,4 (Sigma) для предотвращения отслоения. Затем клетки фиксировали 3,7% PFA в D-PBS в течение 15 мин и трижды нейтрализовали PBS без MgCl 2 / CaCl 2 (Gibco). Клетки блокировали и повышали проницаемость в PBS, содержащем 3% (мас. / Об.) БСА без IgG (Jackson) и 0,5% Triton X-100 (Sigma), в течение 1,5 ч при комнатной температуре.После этого мышечные трубки промывали 3 × 5 мин PBS. Первичные кроличьи антитела против десмина (1: 300, ab15200, Abcam) разводили в блокирующем растворе (5% (мас. / Об.) БСА без IgG в PBS) и инкубировали при 4 ° C в течение ночи. На следующий день первичное антитело удаляли, и клетки трижды промывали PBS в течение 5 мин. Вторичное антитело Alexa488 (1: 400, A-11034, молекулярные зонды) и DAPI (1: 10 000) разводили в блокирующем растворе и инкубировали в течение 1,5 ч при комнатной температуре. Затем клетки промывали 3 × 5 мин PBS и хранили в защищенном от света PBS при 4 ° C до визуализации.Миотрубки были проанализированы, и изображения были получены с помощью инвертированного флуоресцентного микроскопа (Leica DMi 8) и программного обеспечения Leica Application Suite X (Leica). На лунку делали по четыре изображения из заранее определенных областей в каждом квадранте с увеличением × 10. Мы определили миотрубки как клетки desmin + , содержащие по крайней мере три ядра и имеющие трубчатую структуру. Диаметр 50–80 мышечных трубок измеряли в каждой лунке с помощью программного обеспечения для анализа изображений Fiji, а средний диаметр каждой лунки использовали для статистического анализа.

RT-qPCR

Для экспериментов с клеточными культурами миотрубки лизировали в буфере RLT (Qiagen), и РНК экстрагировали с помощью RNeasy ® Mini Kit (Qiagen) с обработкой протеиназой K и ДНКазой в соответствии с инструкциями поставщика. . Чистоту РНК определяли с использованием Nanodrop ONEC (Thermo Scientific). кДНК генерировали с помощью набора для синтеза кДНК iScript TM (Bio-Rad) с использованием 500 нг экстрагированной РНК в соответствии с руководством поставщика. Образцы кДНК хранили при -20 ° C.RT-qPCR выполняли в двух экземплярах с помощью прибора LightCycler 480 (Roche Diagnostics) с использованием 384-луночных планшетов LightCycler с герметизирующей фольгой (Roche). Реакционный объем 10 мкл содержал смесь FastStart Essential DNA Green Master Mix (2X, Roche), прямой и обратный праймеры и матрицу кДНК (разведенная 1: 5). Праймеры были разработаны с использованием программного обеспечения Genious ® 10 74 , а специфичность подтверждена с помощью инструмента поиска базового локального выравнивания (BLAST) 75 . Потенциальное образование шпильки, комплементарность и сайты самоотжига были подтверждены как отрицательные с помощью OligoCalc 76 .Амплификацию одного продукта ПЦР подтверждали кривой диссоциации точки плавления, и значения исходного цикла количественного определения (Cq) рассчитывали с помощью LightCycler 480. Данные анализировали с использованием метода сравнительного Cq (2 — ΔΔCq ). Необработанные значения Cq генов-мишеней были нормализованы к значениям Cq гена домашнего хозяйства (β-актина), который был стабильным между условиями, а затем дополнительно нормализован к контрольной группе для простоты визуализации. Использованы следующие праймеры:

Tp53 : прямой — CACGTACTCTCCTCCCCTCAAT; обратный — AACTGCACAGGGCACGTCTT

Atf4 : вперед — AGCAAAACAAGACAGCAGCC; обратный — ACTCTCTTCTTCCCCCTTGC

Ppp11r15a : вперед — GACCCCTCCAACTCTCCTTC; обратный — CTTCCTCAGCCTCAGCATTC

Hspa5 : вперед — TTCAGCCAATTATCAGCAAACTCT; обратный — TTTTCTGATGTATCCTCTTCACCAGT

Ddit3 : вперед — CCACCACACCTGAAAGCAGAA; обратный — AGGTGAAAGGCAGGGACTCA

Sqstm1 : вперед — AGGGAACACAGCAAGCTCAT; обратная сторона — GACTCAGCTGTAGGGCAAGG

Окрашивание НМС целиком и количественная оценка морфологии

Для окрашивания НМС мышцу фиксировали 4% PFA в течение 1 ч и разрезали на пучки.Пучки мышц были проницаемы с помощью 2% Triton X-100, нейтрализованы 100 мМ глицином и заблокированы блокирующим раствором (3% BSA, 0,5% Triton X-100 и 0,01% NaN3 в PBS). Затем мышечные пучки инкубировали со смесью первичных антител против синаптофизина и нейрофиламента-200 73 или 2h4 / SV2 43 в блокирующем растворе в течение ночи при 4 ° C. После промывки пучки инкубировали в растворе вторичных антител (α-бунгаротоксин, конъюгированный с Alexa555 (B35451, Invitrogen) и DAPI).Для группы TSCmKO полный анализ НМС выполняли на мышах, трансгенно экспрессирующих YFP в двигательных нейронах 77 . Следовательно, окрашивание пресинапса не проводилось в группе мышей TSCmKO. Изображения NMJ с размером кадра 512 × 512 были получены на конфокальном микроскопе Zeiss LSM 700 с объективом × 63. Изображения были проанализированы с использованием программного обеспечения ImageJ в соответствии с рабочим процессом «NMJ-morph», как описано ранее 43 . Количество аксональных входов, концевых разрастаний НМС и фрагментов AChR подсчитывали при трехмерной реконструкции конфокальных стеков с помощью программного обеспечения Imaris.

Электрофизиология in situ

Электрофизиологические записи in situ одиночных НМС TA и SOL выполнялись, как описано ранее 78,79 . Вкратце, мышей в возрасте 2–3 месяцев умерщвляли с помощью ингаляции CO 2 , а мышцы TA и SOL удаляли и закрепляли в чашке, заполненной сильгардом. После окрашивания 10 мкМ 4- (4-диэтиламиностирил) -N-метилпиридиния йодидом (4-Di-2ASP, Invitrogen, Carlsbad, CA), НМС визуализировали с помощью эпифлуоресцентного микроскопа и перфузировали со скоростью 3–6 мл в сутки. минута с внешним раствором, содержащим (в мМ) 118 NaCl, 0.7 Mg 2 SO 4 , 2 CaCl 2 , 3,5 KCl, 26,2 NaHCO 3 , 1,7 NaH 2 PO 4 и 5,5 глюкозы (pH 7,3–7,4, 20–22 ° C) , уравновешенный 95% O 2 и 5% CO 2 . Токи на торцевых пластинах регистрировались с помощью двухэлектродных фиксаторов напряжения. Нерв к мышце TA или SOL стимулировали с помощью внеклеточного вольфрамового электрода (FHC Inc., США). Мышечные волокна были раздавлены от полосы концевой пластинки, чтобы устранить сокращения при стимуляции нерва, и удерживающий потенциал был установлен на уровне -45 мВ.

Электромиография с повторяющейся стимуляцией нервов

Электромиографические свойства GAS-мышцы были измерены с использованием аппарата Keypoint EMG (Meridian, Neurolite AG) 73 . Мышей анестезировали внутрибрюшинной инъекцией кетамина (111 мг / кг, Pfizer) и ксилазина (22 мг / кг, Streuli Pharma). Седалищный нерв стимулировали последовательностями из десяти стимуляций (длительность 0,04 мс, амплитуда 10 мА и 2-минутная пауза между последовательностями) с увеличивающейся частотой от 3 Гц до 15 Гц.Потенциалы действия регистрировались в мышце GAS с помощью игольчатого электрода, помещенного непосредственно в брюшко мышцы (электрод сравнения вводился подкожно возле ахиллова сухожилия). Снижение CMAP рассчитывалось как процент между первой и четвертой стимуляциями.

Лазерная микродиссекция и секвенирование

ТА-мышца была быстро рассечена и немедленно погружена в 1 мл раствора Кребса-Рингера, содержащего a-бунгаротоксин, конъюгированный с Alexa488 (B13422, молекулярные зонды), на 1 час.Затем мышцы мгновенно замораживали в охлаждаемом жидким азотом изопентане (Sigma-Aldrich) и частично заливали 10% трагакантовой камеди (Sigma-Aldrich). До 30 серийных поперечных срезов 20 мкм были вырезаны при -20 ° C на криостате (Leica) и помещены на стеклянные предметные стекла, обработанные RNase AWAY ® (Sigma-Aldrich) (Menzel). Затем срезы обезвоживали в 100% этаноле внутри камеры криостата в течение 5 минут и хранили при -80 ° C в 50-миллилитровых конических пробирках, содержащих несколько граммов осушителя (Silica Gel Orange, ROTH) для предотвращения регидратации тканей.Микродиссекцию с лазерным захватом (LCM) проводили с использованием системы PALM MicroBeam (Zeiss). Процесс микродиссекции визуализировали с помощью камеры AxioCam ICc, подключенной к компьютеру и управляемой программным обеспечением PALM RoboSoftware (Zeiss). Синаптические области были визуализированы с помощью объектива × 20, и для каждого образца было собрано ~ 300 синаптических областей (NMJ) и 300 внесинаптических (XNMJ) областей, равных примерно 0,65 мм². Выбранные области были вырезаны и катапультированы лазерными импульсами в режиме «autoLPC» в непрозрачные пробирки для ПЦР AdhesiveCap 500 (Zeiss).Ткань гомогенизировали пипеткой и лизировали в течение 5 мин при комнатной температуре с использованием буфера для одноклеточного лизиса (635013, Clontech) с добавлением ингибитора РНКазы (Roche Diagnostics), а затем немедленно хранили при -80 ° C до дальнейшей обработки. Важно отметить, что процесс продолжался менее 1 часа, чтобы избежать деградации РНК эндогенными тканевыми РНКазами. Подготовка библиотеки РНК выполнялась с использованием набора SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech).

Экстракция РНК для наборов данных стареющего рапамицина и TSCmKO

Для набора данных стареющего рапамицина быстрозамороженные мышцы TA, TRI, GAS и SOL от шести мышей на группу измельчали ​​и лизировали в буфере RLT (Qiagen) и обработанные протеиназой К (Qiagen).Обработку ДНКазой и выделение РНК проводили с помощью автоматизированного iColumn 24 (AccuBioMed) с использованием мини-набора AccuPure Tissue RNA Mini (AccuBioMed). Чистоту и целостность РНК проверяли на Bioanalyser (Agilent), а концентрацию РНК определяли с помощью набора для анализа РНК Quant-iT ™ RiboGreen ™ и флурометра Qubit (Invitrogen). Библиотеки готовили с помощью TruSeq Stranded mRNA HT Sample Prep Kit. Последовательное секвенирование с парными концами с длиной считывания 101 пара оснований выполняли на платформе Illumina HiSeq2500.Один выброс в группе 30mCON SOL был идентифицирован и исключен из дальнейшего анализа на основании явной технической ошибки. Для набора данных TSCmKO поли (A) + РНК экстрагировали из цельных мышечных лизатов EDL с использованием набора Dynabeads mRNA DIRECT (61011, Invitrogen). Библиотеки были подготовлены в соответствии с протоколом «Направленная подготовка образца mRNA-seq» от Illumina. Библиотеки подвергали одноцепочечному секвенированию с длиной считывания 50 пар оснований на платформе Illumina HiSeq 2000.

Статистический анализ

Все значения выражены как среднее ± SEM, если не указано иное.Данные были проверены на нормальность и однородность дисперсии с использованием теста Шапиро-Уилка и Левена, соответственно. Данные были проанализированы в GraphPad Prism 8. Тесты Стьюдента t использовались для парных сравнений, в то время как односторонние ANOVA с апостериорным LSD-тестом Фишера использовались для сравнения между тремя группами, пока ANOVA достигло статистической значимости. Двусторонний дисперсионный анализ с апостериорными тестами Сидака или двусторонний дисперсионный анализ с повторными измерениями для нескольких записей с течением времени использовался для сравнения между группами с двумя независимыми переменными.При необходимости сообщаются как значимые различия ( P <0,05), так и тенденции ( P <0,1).

Анализ дифференциальной экспрессии

Анализ дифференциальной экспрессии выполняли с помощью EdgeR, доступного в пакете Bioconductor 80 . Обратите внимание, что ген был включен в анализ только в том случае, если он имел по крайней мере 1 счет на миллион (CPM) в количестве образцов, соответствующем минимальному количеству образцов в каждом условии. Экспрессия генов считалась статистически разной в двух условиях, если коэффициент ложного обнаружения (FDR) был меньше 0.05 81 . Используя EdgeR, были рассчитаны логарифмические изменения экспрессии генов между парами всех условий и использованы для корреляционного анализа, тепловых карт и анализа обогащения набора генов (GSEA).

Анализ обогащения набора генов

Распределение наборов генов в ранжированных списках генов было исследовано с использованием GSEA 82 . Ранжирование основывалось на логарифмических изменениях экспрессии генов между двумя интересующими условиями. Обогащение считалось значительным, если FDR был <0.01.

Анализ онтологии генов

Чтобы охарактеризовать функции генов, идентифицированных в ходе анализа, мы выполнили анализ онтологии генов (GO) с использованием базы данных для аннотаций, визуализации и интегрированного обнаружения (DAVID) 83 . Категории «GOTERM_BP_DIRECT», «GOTERM_MF_DIRECT» и «GOTERM_CC_DIRECT» использовались для аннотации генов, а термины GO со значением P <0,01 считались значительно обогащенными.

Иерархическая кластеризация

Иерархическая кластеризация генов была основана на евклидовом расстоянии между изменениями экспрессии генов в заявленных условиях (см.рис.6д).

Приложение Shiny

Чтобы сделать наши наборы данных с высокой пропускной способностью и инструменты анализа данных доступными для исследовательского сообщества, мы разработали интерактивное веб-приложение с использованием пакета R Shiny (версия 0.14.2, https: //cran.r-project .org / web / packages / shiny / index.html). Для каждого набора данных приложение поддерживает построение графиков экспрессии генов, анализ дифференциальной экспрессии, анализ главных компонентов и выравнивание экспрессии генов с основными компонентами 80,84 .Кроме того, приложение может отправлять гены, полученные в результате анализа, в STRING 85 для дальнейшего исследования межбелковых взаимодействий и выполнения анализа GO. Доступ к приложению можно получить по следующей ссылке: https://sarcoatlas.scicore.unibas.ch/

Обработка данных RNA-seq

чтения RNA-seq были подвергнуты 3 ‘адаптеру и поли (A) / poly (T ) обрезка хвоста с помощью Cutadapt v1.9.1 86 . Следующие 3′-адаптерные последовательности были использованы для создания библиотек RNA-Seq и затем обрезаны:

Набор данных «Aging-RM»: Read1 5′-AGATCGGAAGAGCACACGTC-3 ‘

Read2 5′-AGATCGGAAGAGCGTCGTGT-3′

«TSCmKO ”Набор данных: Read1 5′-TGGAATTCTCGGGTGCCAAG-3 ‘

Набор данных« NMJ »: Read1 5′-CTGTCTCTTATACACATCTCC-3′

Считывания короче 20 и 30 нуклеотидов отбрасывались для одно- и парно-концевых библиотек соответственно.В качестве контрольного транскриптома мыши мы рассматривали последовательности кодирующих белок транскриптов с уровнем поддержки 1-3 на основе сборки генома GRCm38 (выпуск 92) и аннотаций транскриптов из базы данных Ensembl 87 . Программа Kallisto v0.43.1 использовалась для построения индекса транскриптома с параметрами по умолчанию и выравнивания отфильтрованных чтений 88 . Для выравнивания библиотек однонаправленных RNA-Seq мы использовали параметры «–single» и «-l» и «-s», соответствующие среднему значению и стандартному отклонению длины фрагмента, соответственно, оцененным для каждого образца с помощью BioAnalyzer.Для выравнивания специфичных для цепей чтений из наборов данных «Aging-RM» и «TSCmKO» мы использовали параметры «–rf-stranded» и «–fr-stranded» соответственно. Для выравнивания отфильтрованных чтений из всех наборов данных мы использовали параметр «–pseudobam», который сохраняет псевдо-выравнивания kallisto в файл BAM.

Отображенные чтения назначались транскриптам взвешенным образом: если чтение было однозначно отображено в транскрипт, то счетчик чтения транскрипта увеличивался на 1; если чтение было сопоставлено с n различных транскриптов, счетчик чтения каждого транскрипта увеличивался на 1/ n .Обрезка 3′-адаптера, индексация эталонного транскриптома, сопоставление библиотек RNA-Seq и присвоение сопоставленных считываний транскриптам выполняли с помощью среды рабочего процесса Snakemake 89 . 6.$

(1)

Экспрессию гена получали суммированием нормализованной экспрессии связанных с ним транскриптов. Для каждого гена подсчеты считывания транскриптов, связанных с этим геном, также суммировались и в дальнейшем использовались для анализа дифференциальной экспрессии.

Согласование экспрессии гена с основными компонентами

Данные экспрессии генов определяют многомерное пространство, где каждый ген можно рассматривать как точку, координаты которой являются уровнями экспрессии в отдельных образцах.Глобальные взаимосвязи между образцами могут быть обнаружены путем определения направлений в пространстве образцов, которые отражают большую часть вариаций в экспрессии генов 84,90 . Здесь мы описываем, как мы использовали этот подход, с помощью набора игрушечных данных, состоящего из трех «образцов» и 26 «генов», измеренных для каждого образца. Экспрессия генов в этих образцах была случайным образом выбрана из многомерного нормального распределения, так что 20 генов существенно не различаются по уровню экспрессии между образцами (значение P теста t ≥ 0.01), три имеют значительно более низкую экспрессию, а три — значительно более высокую экспрессию в образце 3 по сравнению с другими образцами (значение P теста t <0,01). Мы визуализировали эти данные на дополнительном рис. S10A, в трехмерном пространстве образцов, где каждая точка соответствует гену. Чтобы идентифицировать образцы со значительно разными паттернами экспрессии генов, а также гены, которые больше всего способствуют этому различию, мы использовали разложение по единичным значениям (SVD).

Сначала мы построили матрицу с m столбцов (выборки) и n строк (гены), так что каждая ячейка в матрице содержит уровень экспрессии определенного гена в конкретном образце в логарифмической шкале (logTPM). .Обратите внимание, что ген рассматривался для анализа только в том случае, если он имел по крайней мере 1 TPM в количестве образцов, соответствующем минимальному количеству образцов в каждом условии. Чтобы сделать данные сопоставимыми по выборкам и генам, мы центрировали столбцы и строки матрицы, вычитая средние значения столбцов и строк из каждой ячейки. 2}}.$

(4)

Обычно больше всего интересуют компьютеры, которые объясняют наибольшую долю дисперсии. В нашем игрушечном примере PC \ (\ vec v_1 \) объясняет около 85% дисперсии в наборе данных (дополнительный рисунок S10D). Направления ПК определяются их координатами в пространстве выборки — чем больше похожи координаты, тем больше похожи образцы. В нашем примере координаты, соответствующие отсчетам 1 и 2 ПК \ (\ vec v_1 \), подобны друг другу и сильно отличаются от координаты, соответствующей отсчету 3.

Рис. 8: SarcoAtlas.

Графическое представление плана эксперимента, номеров групп, продолжительности лечения и мышц, проанализированных для трех новых наборов данных, созданных, проанализированных и доступных через удобное для пользователя приложение SarcoAtlas (https://sarcoatlas.unibas.ch/) . SarcoAtlas позволяет заинтересованным пользователям строить и извлекать данные экспрессии для интересующего гена, а также выполнять анализ основных компонентов или дифференциальной экспрессии на любом из трех новых наборов данных: (1) саркопения и рапамицин, (2) микродиссекция НМС с помощью лазерного захвата. обогащенные и не-NMJ (XNMJ) области и (3) модель ускоренной саркопении TSCmKO.Кроме того, списки генов можно легко передать в строку для визуализации взаимодействий и исследования онтологии генов. Рисунок создан на BioRender.com.

Мы использовали геометрический подход для идентификации генов, связанных с ПК \ (\ vec v_j \). Каждый ген k может быть представлен в пространстве выборок вектором \ (\ vec g_k \), проведенным от начала координат до точки с координатами, соответствующими k -й строке матрицы G . Для представления вектора ПК \ (\ vec v_j \) мы использовали его координаты в пространстве выборки, полученном выше, а затем вычислили как величину проекций, так и корреляцию векторов генов с ПК \ (\ vec v_j \).Векторы генов, выровненные с \ (\ vec v_j \) и с высокими абсолютными значениями проекции на ПК \ (\ vec v_j \), вносят наибольший вклад в дисперсию, объясняемую ПК \ (\ vec v_j \). Дополнительный рис. S10E иллюстрирует эти концепции, показывая проекции репрезентативного вектора гена (синяя стрелка) на ПК \ (\ vec v_1 \) и \ (\ vec v_2 \), а также углы между вектором гена и ПК. 2}} }.$

(6)

Мы считали корреляцию между вектором гена и PC значимой, если абсолютное значение было ≥0,4. Для примера с игрушкой корреляции между ПК \ (\ vec v_1 \) и \ (\ vec v_2 \) и векторами генов изображены на дополнительном рис. S10H, I, соответственно. Цифры показывают, что существенно разные гены в образце 3 имеют как значимые абсолютные проекции, так и корреляции с вектором \ (\ vec v_1 \). Эти гены внесли наибольший вклад в дисперсию в нашем примере с игрушкой.

Сводка отчетов

Дополнительная информация о дизайне исследований доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Поздние нервно-мышечные расстройства в дифференциальной диагностике саркопении | BMC Neurology

Все пациенты с NMD были бы ошибочно классифицированы как тяжелые саркопении и положительно прошли скрининг на саркопению с помощью опросника SARC-F. Таким образом, гериатрические пациенты, страдающие обычными НМД с поздним началом, могут быть ошибочно диагностированы как саркопенические, и их НМД остается недиагностированным.Надежный диагноз может быть поставлен только тогда, когда клиницисты осведомлены о важных дифференциальных диагнозах и их диагностических рекомендациях.

Представленные NMD в целом являются редкими заболеваниями по сравнению с саркопенией. Тем не менее, исследования показывают, что распространенность DM2 и IBM может быть выше, чем ожидалось [19, 26]. Это может быть частично связано с тем фактом, что пожилые пациенты, страдающие NMD с симптомами, подобными саркопении, проходят обследование и лечение в основном терапевтами или гериатрами.Они могут игнорировать или упускать из виду потенциально поздние нервно-мышечные расстройства. Наш отчет основан на показательных случаях, поэтому мы не можем сообщить какие-либо данные о распространенности НПВ среди гериатрических или саркопенических когорт пациентов. Помимо нервно-мышечного поражения, внемышечные проявления, такие как болезни сердца и легких, катаракта и другие заболевания глаз или изолированная дисфагия, должны рассматриваться в спектре нервно-мышечных расстройств в пожилом возрасте, особенно при СД2. Основываясь на одном из немногих отчетов о миопатиях у пожилых пациентов, Эчаниз-Лагуна сообщил о 15 пациентах старше 70 лет.Из этих 15 пожилых пациентов у 50% была воспалительная миопатия, у 32% — генетически обусловленная миопатия, у 16% — миопатия неустановленной причины и у 2% — токсическая миопатия. У пожилых пациентов чаще наблюдаются миалгия, воспалительная миопатия и рак [24]. Таким образом, в нашем отчете делается попытка повысить осведомленность о саркопении как о важном нервно-мышечном дифференциальном диагнозе.

Наши участники с IBM и DM2 были старше 75 лет, когда диагноз их NMD был подтвержден (Таблица 3).Задержка диагностики включает месяцы для ALS, годы для IBM или более десяти лет для DM2 [4, 11, 19]. Высокий возраст начала заболевания в сочетании с задержкой диагностики делает возможным, что пациенты с недиагностированными НПВ входят в число гериатрических пациентов.

Лечащие врачи должны учитывать ДР, когда наблюдается очаговое или асимметричное поражение мышц. Асимметричное поражение в начале заболевания типично для ИБМ, здесь особенно слабость сгибателей пальцев и разрастание проксимальных мышц широкой мышцы бедра, тогда как при БАС картина слабости более обобщенная и быстро прогрессирующая [4, 13].Разница в HGS обеих сторон была наибольшей у наших участников с IBM и ALS (60% и 73%, таблица 3). При СД2 проксимальная слабость, например подъем по лестнице — клинический признак, особенно если он сочетается с миалгией и скованностью. Необъяснимые побочные различия в HGS, обнаруженные во время скрининга на саркопению, могут указывать на другой диагноз, чем саркопения. В то время как диагноз саркопении согласно EWGSOP2 требует значений ниже определенных пороговых значений, слабость или снижение мышечной функциональности при NMD чаще определяется оценками, основанными на шкале MRC [1, 6, 8].Поскольку текущий алгоритм скрининга на саркопению не включает дальнейшую оценку в случае изолированного или асимметричного поражения определенных групп мышц, следует рассмотреть дополнительные методы обследования. Обследование по шкале MRC-Scales в сочетании с оценкой черепных нервов и рефлексов позволит выявить не только асимметричное или изолированное поражение определенных групп мышц, но также поражение верхних и нижних мотонейронов. Если оценка дает признаки NMD, может быть организована дополнительная диагностика — например, определение CK, электромиография, оценка мышечной ткани или генетический анализ.

Так как повышенный уровень КК в исследуемых NMDs возникает непоследовательно (Таблица 3), сила различения довольно ограничена [4, 7, 19]. Тем не менее, уровни КФК ниже до пограничных обычно обнаруживаются у пожилых людей, возможно, из-за саркопении [27]. Таким образом, возможна дифференциация саркопении и NMD по уровням CK.

Электромиография выявляет признаки активной и хронической денервации при БАС, в том числе в клинически не пораженных мышцах [7]. Для дифференциальной диагностики БАС помимо измерения КК может быть полезна электромиография, если клинический синдром указывает на заболевание мотонейронов.

При СД2 миотонию более надежно выявлять с помощью электромиографии, чем с помощью нервно-мышечных исследований. Электромиография также способствует диагностике ИБГ, однако электромиография была исключена из текущих рекомендаций частично из-за часто встречающихся нейрогенных паттернов, приводящих к неправильной диагностике БДН [8]. Биопсия мышц способствует обеспечению или исключению определенных NMD, что отражено в наших гистопатологических данных (рис. 1) [7, 15].

Следует отметить, что лечебные методы лечения исследуемых НМД пока отсутствуют [8, 9, 11].Тем не менее ретроспективное исследование Miró et al. [28] показали мышечные заболевания у 35% людей в возрасте 65 лет и старше, которым была сделана биопсия мышц из-за слабости или повышенного КК. Остается неясным, у скольких пациентов с саркопенией упущен диагноз излечимого мышечного заболевания.

В дополнительных анкетах ни один из наших участников не набрал полных баллов. Интересно, что у пациента с СД2 был самый низкий показатель IADL и самый высокий показатель MNA®, что указывает на сильное влияние его болезни на независимость и более низкий личный риск недоедания.Если присутствует дисфагия, исследования глотания с использованием оптоволоконной эндоскопической оценки глотания (FEES) для дифференциальной диагностики являются оправданными. Согласно данным Winter et. al [17]. Более распространенное ожирение при СД2 контрастирует с кахексией, которая возникает при БАС и ИБГ в течение месяцев или лет из-за их различного нейрогенного или воспалительного патогенеза [4, 11, 18]. Корреляция более серьезного снижения мышечной силы с более высокой жировой массой при СД2 совпадает с наблюдениями IADL-инвалидности у пациентов с ожирением и саркопенией [18, 29].Таким образом, избыточный вес нашего пациента с СД2 может способствовать его серьезным функциональным ограничениям. Наконец, недостаточное питание, по-видимому, играет роль в саркопении и исследованных нами НПВ, поскольку дисфагия рассматривается как возможный симптом [1, 6, 13, 26]. Недоедание или, по крайней мере, риск недоедания оценивали у всех пациентов. Неясно, способствует ли этот факт развитию саркопенического фенотипа при NMDs или является выражением более тяжелого и быстрого мышечного поражения.

Потеря взрослых стволовых клеток скелетных мышц приводит к возрастной дегенерации нервно-мышечных соединений

Существенные изменения:

1) В рукописи отсутствуют данные, прямо показывающие, что постсинаптические миоядра происходят из мышечных стволовых клеток.Наиболее важные данные для этой идеи представлены на Рисунке 3; однако невозможно сделать вывод, что постсинаптические ядра исходят из сателлитных клеток, основываясь только на этих данных. Присутствие GFP (рис. 3A, B) только доказывает, что сателлитные клетки присутствуют во всем данном мышечном волокне, в том числе проксимальнее постсинаптической области. Дополнительные подходы (например, создание мышей с ядерным, а не мембранным GFP, или маркировка сателлитных клеток ядерным маркером ex vivo и инъекция в синаптическую область, чтобы увидеть, где их ядра попадают в уже сформированные мышечные волокна), чтобы доказать, что Постсинаптические миоядра исходят из сателлитных клеток и, таким образом, теряются после истощения этой клеточной популяции.Если такие данные доступны, их следует добавить в рукопись. Если нет, то авторы должны смягчить свой вывод, как указано в Обсуждении — «В частности, SCs являются источником постсинаптических миоядер» созревших мышечных волокон, поскольку просто нет данных, прямо подтверждающих это.

Мы создали Pax7CreER; Мыши Rosa26nTnG (P7nTnG), которые несмываемым образом маркируют SC после введения тамоксифена с ядерным GFP (nGFP). Через 4,5 месяца мышам P7nTnG вводили тамоксифен, и сразу же или через 6 недель после этого собирали отдельные миофибриллы EDL.Сразу после введения тамоксифена только СК Pax7 + были помечены nGFP. Посредством анализа НМС через 6 недель после введения тамоксифена наблюдались постсинаптические миоядра nGFP +. Эти результаты включены в новый рисунок 3 — приложение 1 к рисунку и сопроводительный текст, включенный в разделы «Методы» (подраздел «Животные») и «Результаты» (подраздел «СК вносят вклад в НМС взрослых и среднего возраста, но не в возрасте», последний абзац).

2) Авторы утверждают, что у старых животных происходит небольшая денервация («отсутствие сильной денервации»).Но на рисунке 1 большинство НМС полностью или частично денервированы, и эти данные представлены как частично отсутствующий нерв (Inn). Эти результаты, по-видимому, подтверждают опубликованные данные, показывающие, что большинство пожилых НМС частично денервированы, а меньшая часть населения полностью денервирована. Хотя авторы утверждают, что их дополнительные данные (рис. 1 — рис. 2) о том, что программа транскрипции миоядер в старых мышцах отличается от программ, наблюдаемых в определенный момент времени после перерезки седалищного нерва, дополнительно подтверждают отсутствие денервации в старых мышцах, это очевидно. неясно, как была выбрана эта временная точка и какое совпадение можно было ожидать, что могло бы привести к противоположному выводу, учитывая, что модель рассечения седалищного нерва, очевидно, является гораздо более серьезной, а также очень другой хирургической моделью.Таким образом, вывод о наличии ограниченной денервации в старых мышцах не особенно убедителен, и авторам рекомендуется изменить метку «Inn» на этом рисунке 1 на частично иннервируемую (PI) или частично денервированную (PD).

Мы модифицировали графики на рисунках 1, 3 и 4 и соответствующий текст, чтобы включить в них обозначения полной денервации (Den) и частичной иннервации (PI). Мы согласны с тем, что травмы седалищного нерва более серьезны, чем возрастное снижение мышечной массы; однако такие модели использовались для изучения старения мышц (Xu et al., J Cachexia Sarcopenia Muscle, 2017). Режим денервации / реиннервации для рисунка 1 — приложение к рисунку 2 был выбран на основе исследования Liu et al., eLife 2015, где было продемонстрировано, что такая модель действительно приводит к полной или частичной иннервации с дегенерированной морфологией НМС, сродни тому, что есть наблюдается в старых мышцах. Частичное совпадение нашего режима денервации / реиннервации и старения — это стойкость дегенерированной морфологии НМС. Мы включили утверждения для вышеперечисленного, где представлен рисунок 1 — приложение к рисунку 2 (подраздел «Полная денервация не является характерной чертой старых скелетных мышц»).

3) Поскольку предполагается, что потеря миоядер вызывает старение НМС, важно показать, что миоядра исчезают до старения НМС. Однако нет данных, подтверждающих, что эта последовательность событий происходит во время старения. Вместо этого показано, что такое же количество ядер присутствует в НМС 12 по сравнению с 6-месячным возрастом, см. Рисунок 3. Поскольку перисинаптические шванновские клетки также подвержены старению, важно определить их вклад в НМС-ассоциированные ядра. в молодых и старых мышцах.Ответ на эти вопросы позволит лучше установить взаимосвязь между старением НМС и потерей миоядер, специфически полученных из стволовых клеток.

Данные, представленные на рисунке 3, получены с помощью дисперсионного анализа. В соответствии с запросом для сравнения СМС Ctrl возрастом 6 и 12 месяцев мы провели попарный t-тест. Попарное сравнение показывает, что через 12 месяцев наблюдается значительное увеличение доли НМС с 0–2 постсинаптическими миоядрами или постсинаптическими дегенерированными НМС. В отличие от нас, не было существенной разницы в пресинаптических дегенеративных (т.е.е. частично иннервируется) НМС в 12 месяцев по сравнению с 6 месяцами. Теперь мы включили эти результаты в рисунок 3 — приложение к рисунку 3.

Хорошо известно, что шванновские клетки находятся на стороне нервных окончаний и, насколько нам известно, не участвуют в постсинаптических миоядрах и не обладают миогенным потенциалом (подраздел «Полная денервация не является характерной чертой старых скелетных мышц», последний абзац ). Напротив, мы не наблюдали пресинаптических ядер, меченных GFP, у мышей P7mTmG или P7nTnG во время старения (это исследование) или атрофии мышц при денервации / реиннервации (Liu et al., eLife , 2015). Поскольку сателлитные клетки являются основным источником миоядер во время репарации или регенерации, мы сосредоточились на постсинаптическом миоядерном числе.

4) Рисунок 3D предполагает уменьшение включения новых сателлитных клеток в целом (уменьшение общего количества волокон mGFP +) с возрастом. Однако это немного противоречит здравому смыслу, учитывая повышенную частоту центрально-ядерных волокон, обычно обнаруживаемых в старых мышцах (например, Valdez et al. 2010). Могут ли авторы объяснить / прокомментировать это?

Как и просили, мы прокомментировали вклад сателлитных клеток в центральное зародышеобразование, см. Последний абзац Обсуждения.Центральное зародышеобразование часто используется как индикатор миофибрилл, которые в какой-то момент претерпели серьезный приступ дегенерации и регенерации. Таким образом, на рисунке 6 Valdez et al. Исследование 2010 года показало, что в какой-то момент между 5 и 23-24 месяцами небольшая часть миофибрилл претерпела серьезный приступ дегенерации и регенерации, причина и время которого неизвестны. Несмотря на это, слияние предшественников, происходящих из SC, в миофибриллы наблюдалось без заметного центрального зародышеобразования, см. Keefe et al., Nat Comm, 2015; Лю и др., eLife , 2015; Pawlikowski et al., Skeletal Muscle, 2015.

.

5) Вероятно, что миоядра, связанные с НМС, диссоциируют от постсинаптической области в атрофированных мышечных волокнах. Эту возможность следует изучить или обсудить.

Мы согласны с тем, что постсинаптические миоядра могли быть смещены с возрастом (Bruusgaard et al., J Appl Physiol, 2006), однако, учитывая общее снижение числа миоядер, начиная с 12 месяцев (Brack et al., J Cell Sci, 2005) вполне вероятно, что этому способствуют как утрата, так и смещение. Как было предложено, мы включили обсуждение вышеизложенного (Обсуждение, третий абзац).

6) Включение сателлитных клеток в миофибриллы в системе Spry1OX также приведет к сверхэкспрессии Spry1 в дифференцированных волокнах. Т.о., некоторые из эффектов, которые авторы видят в отношении защиты от возрастной дисфункции НМС в этой системе, могут быть связаны с функциями Spry1 в волокнах. Поэтому важно оценивать уровень экспрессии трансгена в мышечных волокнах с течением времени, и в идеале эту проблему следует решать экспериментально путем анализа системы сверхэкспрессии, в которой индуцируется специфическая для волокон гиперэкспрессия Spry1, или, возможно, путем трансплантации сателлитных клеток дикого типа, а не трансплантации. их существующая система Spry1OX (хотя это может быть технически сложной задачей).Эта проблема особенно актуальна, поскольку о Spry1 сообщалось как о негативном регуляторе передачи сигналов ERK, а активация ERK была связана с атрофией мышц в определенных условиях (например, Lemire et al., 2012). Таким образом, возможно, что введение Spry1 в миофибриллы посредством слияния сателлитных клеток в системе Spry1OX защищает их от последующей возрастной атрофии. Если авторы не могут предоставить прямые экспериментальные доказательства по этому поводу, они должны подробно обсудить эту возможность и соответствующим образом пересмотреть свои выводы.

Подобно Lemire et al. При исследовании мышц пациентов с хронической обструктивной болезнью легких сообщалось о повышенном уровне p38 MAPK, ERK1 / 2 и JNK в мышцах, ведущих малоподвижный образ жизни (Williamson et al., J Physiol, 2003). Ни в одном из исследований не ясно, какие клетки (т.е. миофибриллы, SC, интерстициальные клетки, кровеносные сосуды и т. Д.) Содержали повышенную активность. К сожалению, у нас нет специальной системы Spry1OX для миофибр. Соответственно, мы предоставили дополнительное обсуждение, чтобы включить возможность активности миофибрилл Spry1OX, происходящих из SC, в качестве альтернативы (подраздел «Животные»).Кроме того, мы также изменили наши утверждения и выводы, чтобы учесть эту возможность (подраздел результатов «Возрастные НМС и целостность скелетных мышц улучшается при сверхэкспрессии Spry1 в SC», Обсуждение, второй абзац, подраздел «Животные» и заголовок легенды на Рисунке 4). .

https://doi.org/10.7554/eLife.26464.023

Ослабление возрастных изменений в нервно-мышечных синапсах мышей за счет ограничения калорийности и физических упражнений

Abstract

Клеточная основа возрастного снижения поведения остается неясной, но вероятными кандидатами являются изменения в синапсах.Соответственно, положительное влияние на нервную функцию ограничения калорийности и физических упражнений, которые являются одними из наиболее эффективных известных методов лечения старения, также может быть опосредовано синапсами. В качестве отправной точки в проверке этих идей мы изучили скелетно-нервно-мышечное соединение (НМС), большой доступный периферический синапс. Сравнение НМС у молодых взрослых и старых мышей выявило множество связанных с возрастом структурных изменений, включая набухание аксонов, отрастание, синаптическую отслойку, частичное или полное удаление аксонов из некоторых постсинаптических участков и фрагментацию постсинаптической специализации.Изменения были значительными к 18 мес. И серьезными к 24 мес. Пожизненная диета с ограничением калорий значительно снизила частоту пре- и постсинаптических аномалий у 24-месячных мышей и уменьшила связанную с возрастом потерю двигательных нейронов и обновление мышечных волокон. Один месяц упражнений (бег колеса) у 22-месячных мышей также уменьшил возрастные синаптические изменения, но не повлиял на количество двигательных нейронов или оборот мышечных волокон. Покадровая визуализация in vivo показала, что упражнения частично обращали вспять синаптические изменения, которые уже произошли.Эти результаты демонстрируют критическое влияние старения на синаптическую структуру и предоставляют доказательства того, что вмешательства, способные увеличить продолжительность здоровья и продолжительность жизни, могут частично обратить вспять эти возрастные синаптические изменения.

Старение сопровождается многочисленными функциональными изменениями как центральной, так и периферической нервной системы (1). До недавнего времени считалось, что многие из этих возрастных изменений были вторичными по отношению к дегенерации нейронов. Однако недавние исследования показывают, что гибель нейронов незначительна в большинстве областей стареющей нервной системы (2).Хотя существует много возможных объяснений (3–6), особенно привлекательная гипотеза состоит в том, что некоторые возрастные изменения психической функции являются результатом синаптических изменений. Подтверждая эту идею, изменения количества синапсов, плотности шипов и синаптической пластичности были зарегистрированы в мозге стареющих людей и экспериментальных животных (1, 7, 8).

Если синаптические изменения лежат в основе возрастных дефектов нервной функции, можно рассматривать синапсы как мишени для лечения, которое минимизирует снижение.Два режима образа жизни, которые последовательно продемонстрировали, что они увеличивают продолжительность жизни и смягчают возрастные изменения нервной функции, — это ограничение калорийности и упражнения (9). Поскольку клеточные основы возрастных изменений умственной деятельности неясны, неудивительно, что средства, с помощью которых упражнения и ограничение калорийности ослабляют эти изменения, также неизвестны. Однако для обоих режимов синаптические изменения занимают видное место среди предложенных механизмов (9, 10).

Препятствием на пути прогресса в этой области является сложность и разнообразие синаптического нейропиля в головном мозге, что затрудняет детальный анализ стареющих центральных синапсов.Поэтому было трудно определить, изменяется ли структура синапсов с возрастом. Напротив, скелетные нервно-мышечные соединения (НМС) идеальны для анализа синаптической архитектуры: они очень доступны, относительно просты, функционально однородны и настолько больше, чем центральные синапсы, что их размер и форму можно оценить при помощи светового микроскопа (11). Более того, в нескольких исследованиях были отмечены различия в нервно-мышечной структуре между молодыми взрослыми и пожилыми грызунами (12–16) и людьми (17, 18).Здесь мы охарактеризовали и количественно оценили эти изменения и определили их временной ход с использованием трансгенных мышей, у которых моторные аксоны были несмываемым образом помечены флуоресцентными белками (19). Затем мы оценили влияние ограничения калорийности и упражнений на эти синаптические изменения. Оба эти вмешательства смягчают возрастное снижение мышечной функции (20–24), но мало что известно об их влиянии на НМС (25). Мы показываем здесь, что оба условия значительно притупляют связанные с возрастом структурные изменения в НМС.Наконец, мы демонстрируем, что положительные эффекты упражнений не являются результатом предотвращения возрастной потери двигательных нейронов или дегенерации мышечных волокон, а скорее отражают частичное обращение структурных изменений, которые уже произошли.

Результаты

Измененные НМС в скелетных мышцах пожилого возраста.

Чтобы начать это исследование, мы оценили структурные изменения в НМС старых мышей. Для оптимизации визуализации аксонов и нервных окончаний мы использовали трансгенных мышей, которые экспрессируют YFP во всех моторных аксонах (19).Рецепторы ацетилхолина (AChR), агрегированные в постсинаптической мембране, были помечены флуоресцентно-меченным α-бунгаротоксином (fBTX), высокоселективным лигандом для AChR. Мы сравнили НМС в мышцах передней большеберцовой мышцы молодых взрослых (1-3 мес.) И старых (24-28 мес.) Мышей. У молодых взрослых> 99% AChR-богатых постсинаптических сайтов были прикреплены терминальными ветвями единственного YFP-меченного моторного аксона (Fig. 1 A ). В каждом месте соединения претерминальный аксон был толстым и относительно постоянным по калибру.Агрегаты AChRs образуют непрерывные длинные ветви, каждая точно выровненная с аксональной ветвью (Fig. 1 C ).

Рис. 1.

Возрастные изменения нервно-мышечной системы. ( A ) Передняя большеберцовая мышца молодой взрослой мыши, экспрессирующая YFP в моторных аксонах. В показанной области два нервных пучка (желтые) иннервируют отдельные мышечные волокна. AChR были помечены Alexa-594-BTX (красный). Полное сопоставление нервных окончаний и AChR характерно для молодых животных.( B ) Передняя большеберцовая мышца у 24-месячной мыши. Денервированные (стрелки) и частично освобожденные сайты AChR, а также заметные вздутия аксонов (стрелки) являются обычными. Молодые взрослые ( C ) и пожилые ( D J ) НМС показаны при большем увеличении. Возрастные изменения включали полную денервацию постсинаптического сайта AChR ( D ), фрагментацию и слабо помеченные участки рецепторов ( E ) и рецепторов, которые только частично покрыты нервным окончанием ( E F ). ).В некоторых случаях иннервирующие аксоны очень тонкие ( G ), несут большие вздутия проксимальнее нервного окончания ( H ), многократно иннервируют один НМС ( I ) или расширяют отростки за пределы рецепторной области ( J ). ). [Масштабные линейки: 50 мкм ( A B ) и 10 мкм ( C J .)

НМС в мышцах мышей в возрасте ≥24 мес. Несколько отличались от таковых у молодых взрослых . Во-первых, кластер AChR на некоторых мышечных волокнах не контактировал с аксоном (рис.1 B стрелки и D ). Чаще аксоны не полностью занимали постсинаптический аппарат, оставляя сайт AChR частично денервированным (Fig. 1 E и F ). Во-вторых, старые соединительные AChR часто фрагментировались на небольшие островки (Рис. 1 D F ). В некоторых случаях островки были слабо видны, что указывало на снижение плотности AChR внутри них (рис. 1 E стрелка ). В-третьих, претерминальные и терминальные аксоны часто были деформированы.Некоторые аксоны были намного тоньше, чем те, что наблюдались в более молодом возрасте (Рис. 1 G ), тогда как другие имели увеличенное варикозное расширение вен, обычно в пределах 10–50 мкм от НМС (Рис. 1 H ). В-четвертых, в некоторых НМС два аксона сходились в одном и том же постсинаптическом участке (рис. 1 I и рис. S1), картина напоминает полинейрональную иннервацию, наблюдаемую во всех НМС новорожденных (11), но в <0,1% НМС. молодых взрослых мышей. Эта множественная иннервация могла быть результатом прорастания аксонов в НМС, который уже был частично или полностью денервирован.В подтверждение этой возможности мы иногда наблюдали тонкие ростки, которые выходили за пределы постсинаптического сайта (Fig. 1 J ).

Чтобы определить динамику этих изменений, мы проанализировали переднюю большеберцовую мышцу в разном возрасте (рис. 2). Никаких существенных структурных различий между НМС мышей в возрасте 1 и 6 месяцев не наблюдалось. Однако через 12 мес у нескольких НМС наблюдалась фрагментация, предтерминальные отеки и частичная денервация. Полностью денервированные и многократно иннервируемые синаптические участки, терминальные отростки и варикозное расширение аксонов присутствовали к 18 мес.К 24 мес. НСС значительно отличались от молодых взрослых во всех проанализированных категориях. Мы также проанализировали небольшое количество животных в возрасте 36 месяцев. К этому возрасту все НМС были фрагментированы, и другие возрастные изменения были более распространенными, чем наблюдаемые у 24-месячных животных (рис. S2).

Рис. 2.

Динамика возрастных аномалий в НМС. Частота возрастных аномалий, показанных на рис. 1, была определена количественно с использованием критериев, подробно описанных в SI Materials and Methods .Было проанализировано более 100 НМС от трех животных в каждом возрасте.

Чтобы проверить, возникли ли какие-либо из наблюдаемых возрастных изменений как следствие долговременной экспрессии флуоресцентного белка в моторных аксонах, мы окрашивали старых мышей дикого типа fBTX плюс антитела к нейрофиламентам и белкам синаптических везикул для маркировки AChR. , аксоны и нервные окончания соответственно. Не было разницы в частоте каких-либо аномалий в иммуноокрашенных НМС у 24-месячных животных дикого типа по сравнению с животными, экспрессирующими YFP (рис.S3 и Таблица S1). Эти результаты согласуются с предыдущим сообщением (26) о том, что дефекты моторных аксонов у трансгенных мышей встречаются не чаще, чем у мышей дикого типа. Таким образом, длительная экспрессия YFP не вызывает описанных выше синаптических изменений.

Ограничение калорийности снижает возрастные изменения в НМС.

Затем мы оценили НМС 24-месячных мышей, получавших диету, в которой калорийность была снижена на 40%, начиная с 16-недельного возраста (27). Поскольку эти мыши, которые были получены из Национального института здоровья, могли отличаться по фону от мышей, выращенных в нашем учреждении, мы сравнили их с мышами того же возраста, которые были идентичны по фону группе с ограничением калорий, но получали стандартную пищу. диета.Мышцы окрашивали fBTX и антителами к нейрофиламентам и белкам синаптических везикул, как указано выше.

Ограничение калорийности в возрасте от 4 до 24 месяцев привело к сохранению многих НМС в передней большеберцовой мышце (рис. 3 A и B и рис. S4 A C ). Частота фрагментированных, слабых и денервированных постсинаптических участков и нервных окончаний, несущих терминальные отростки, была значительно ниже у мышей с ограничением калорийности, чем в контроле (рис.3 C F ). Аналогичные результаты были получены на тонкой и икроножной мышцах (рис. 3 C F и рис. S5). Точно так же ограничение калорийности уменьшило частоту атрофии аксонов и расширенного варикозного расширения вен. Таким образом, ограничение калорийности снижает пагубное влияние возраста на структуру НМС.

Рис. 3.

Влияние ограничения калорийности на возрастные изменения в НМС. ( A и B ) НМС от tibialis anterior 24-месячных мышей, которых кормили ad libitum (Old-Ctrl) ( A ) или кормили диетой с ограничением калорий, начиная с возраста 16 недель (Старый CR) ( B ).Мышцы окрашивали fBTX плюс антитела к нейрофиламентам и синаптотагмин-2. ( C F ) Частота возрастных аномалий в НМС передней большеберцовой мышцы (большеберцовая мышца), медиальной икроножной (икроножной) и тонкой (грацильной) мышц 5- и 24-месячных мышей, получавших ad libitum и 24-месячных мышей с ограничением калорийности питания. Каждая полоса показывает среднее значение ± SEM по меньшей мере от 100 НМС по меньшей мере от четырех мышей. * P <0,02 по тесту t . (Масштаб: 10 мкм.)

Упражнения ослабляют возрастные изменения в НМС.

Чтобы оценить влияние упражнений на СМП, мы поместили 22-месячных животных с или без доступа к беговым колесам в течение 1 мес. В этих условиях мониторинг подтвердил (28), что старые мыши бегали со скоростью около 4 км / день. Упражнения снижали частоту фрагментированных, слабых и денервированных постсинаптических участков в передней большеберцовой, тонкой и икроножной мышцах (рис. 4 A D и рис. S4 D E и S6 A В ).Влияние на пресинаптические свойства было менее значительным: изменения денервации и прорастания были незначительно значимыми (рис. 4 E F ).

Рис. 4.

Влияние физических упражнений на возрастные изменения в НМС. ( A и B ) НМС от tibialis anterior 23-месячных мышей, содержащихся в стандартных клетках (Old-Ctrl) ( A ) или содержащихся в стандартных клетках в течение 22 месяцев с последующим предоставлением свободного доступа к бегу. колесо на 1 мес (Old-Ex) ( B ).Мышцы окрашивали, как показано на рис. 3. ( C F ) Частота возрастных аномалий в НМС передней большеберцовой мышцы (большеберцовая мышца), медиальной икроножной (икроножной) и тонкой (gracilis) мышц 5- или 23-месячных мышей, которых содержали в стандартных клетках (Young-Ctrl и Old-Ctrl) или предоставили бесплатный доступ к беговому колесу в течение их последнего месяца (Young-Ex и Old-Ex). Каждая полоса показывает среднее значение ± SEM по меньшей мере от 100 НМС по меньшей мере от четырех мышей. * P <0,01 по тесту t .(Масштаб: 10 мкм.)

Мы также спросили, влияют ли упражнения на структуру НМС у молодых взрослых мышей. Никаких значительных эффектов свободного бега в течение 1 месяца не наблюдалось, когда упражнения начинались в возрасте 4 месяцев (рис. 4 C F ).

Местные и системные эффекты ограничения калорийности и физических упражнений.

Чтобы определить, было ли влияние упражнений на структуру НМС системным, мы исследовали треугольную мышцу грудины на внутренней поверхности грудной клетки и грудинно-сосцевидную мышцу на шее.Во время произвольных упражнений ни одна из мышц, скорее всего, не задействуется максимально (29). Возрастные изменения в треугольной мышце грудины и грудино-сосцевидном отростке были аналогичны описанным выше для мышц конечностей (рис. 5 A B и рис. S7 A ), но упражнения не оказали заметного влияния на структуру НМС. в любой из мышц (рис. 5 C и E H и рис. S7 B ). Пожизненное ограничение калорийности значительно ослабило возрастные изменения в треугольной мышце грудины, исключив возможность того, что эта мышца была невосприимчивой к модулирующим воздействиям (рис.5 D H ). Эти результаты предполагают, что влияние 1 мес. Упражнений на структуру НМС ограничивается мышцами, непосредственно участвующими в упражнениях.

Рис. 5.

Влияние ограничения калорийности и физических упражнений на возрастные изменения НМС треугольной мышцы грудины. ( A D ) НМС из triangularis sterni молодого взрослого человека (Young-Ctrl) ( A ) и мыши в возрасте от 23 до 24 месяцев, которых кормили ad libitum (Old-Ctrl) ( B ), которым был предоставлен доступ к беговому колесу в течение их последнего месяца (Old-Ex) ( C ), или поддерживался на ограниченном калорийности умерших в возрасте 16 недель (Old-CR) ( D ).( E H ) Частота возрастных аномалий в НМС из четырех групп, представленных в ( A D ). Каждая полоса показывает среднее значение ± SEM по меньшей мере от 100 НМС по меньшей мере от четырех мышей. * P <0,01 по тесту t . (Масштаб: 10 мкм.)

Отчетливые эффекты ограничения калорийности и физических упражнений на дегенерацию моторных аксонов и мышечных волокон.

Хотя старение сопровождается незначительной гибелью нейронов в большинстве популяций нейронов, у стареющих грызунов и людей наблюдается потеря значительного количества моторных нейронов (20, 24, 30).Точно так же возрастная саркопения включает дегенерацию мышечных волокон (31), многие из которых быстро заменяются регенерацией новых волокон (32, 33). Поскольку эти изменения могут быть причиной или результатом изменений в НМС, мы спросили, были ли они ослаблены ограничением калорийности или упражнениями.

Чтобы оценить потерю нейронов у старых мышей, мы сравнили количество аксонов в глубоком малоберцовом нерве, который иннервирует переднюю большеберцовую мышцу и другие мышцы-разгибатели ног. Среднее количество миелинизированных аксонов в этом нерве у пожилых мышей было примерно на 30% меньше, чем у молодых взрослых мышей (рис.6 A и B ). Аналогичные результаты были получены для нерва, который иннервирует подъязычную мышцу (72 ± 9 против 49 ± 6 аксонов; потеря 32%; P <0,002, n = 5). Поскольку эти нервы содержат сенсорные и моторные аксоны, мы также исследовали вентральные корешки, которые содержат только эфферентные аксоны. Число аксонов в вентральном корешке L1 было примерно на 35% меньше у старых животных, чем у молодых взрослых (245 ± 14 против 168 ± 18, P = 0,004, n = 3).Потеря моторных аксонов, вероятно, является результатом гибели моторных нейронов, потому что высокие уровни активированной каспазы-3, индикатора гибели клеток, наблюдались в крупных нейронах вентрального рога старения, но не в спинном мозге молодых взрослых ( Рис. S8).

Рис. 6.

Потеря моторных аксонов и регенерация мышечных волокон у старых животных. ( A ) Поперечный разрез малоберцового нерва, окрашенный антителами к нейрофиламентам (NF) (красный) и S100 (зеленый) для маркировки аксонов и шванновских клеток, соответственно.( B ) Количество аксонов, присутствующих в большеберцовом нерве, у контрольных мышей в возрасте 5 месяцев (Young-Ctrl) и от 23 до 24 месяцев (Old-Ctrl), мыши в возрасте 23 месяцев при условии бесплатного доступа к беговому колесу в течение их последнего месяца (Old-Ex) и 24-месячным мышам с ограничением калорийности (Old-CR). Связанная с возрастом потеря моторного аксона ослабляется у мышей с ограничением калорийности, но не тренируемых. ( C и D ) Мышцы мышей в возрасте 5 и 24 месяцев окрашивали DAPI для выявления ядер. Центральные ядра, указывающие на дегенерацию и регенерацию волокна, указаны стрелками.( E ) Процент поперечного сечения мышечных волокон с центральными ядрами. Связанное с возрастом увеличение частоты центрально-ядерных волокон ослабляется у мышей с ограниченными калориями, но не тренируемых в группе мышей. Каждая полоса показывает среднее значение ± SEM, по крайней мере, от четырех мышей. * P <0,03 по тесту t . (Шкала: 10 мкм.)

Мы использовали центрально расположенные ядра в качестве индикатора оборота мышечных волокон; их присутствие означает, что одно мышечное волокно отмерло, а на его месте регенерировало другое (34).Частота поперечных сечений мышечных волокон с центральными ядрами была в 5-10 раз выше в мышечных волокнах старых, чем молодых взрослых мышей (рис. 6 C и D ). Центрально расположенные ядра присутствовали в <2% поперечных срезов молодых взрослых мышечных волокон в мышцах нижних конечностей, но примерно в 12%, 16% и 18% поперечных срезов старых волокон в икроножной, передней большеберцовой мышцах и gracilis соответственно.

Ограничение калорийности уменьшало возрастную потерю двигательных нейронов и увеличение оборота мышечных волокон (рис.6 B и E ), что соответствует предыдущим результатам (33, 35). В отличие от этого, режим упражнений, который мы использовали, не влиял на количество аксонов или на оборот мышечных волокон (рис. 6 B и E ). Хотя более длительный период упражнений может уменьшить потерю аксонов или оборот мышечных волокон, наши результаты показывают, что положительное влияние упражнений на НМС не является вторичным по отношению к восстановлению аксонов или мышечных волокон.

Упражнения частично обращают вспять возрастные структурные изменения в СМП.

Сравнение результатов на рис. 2 и 4 предполагает, что 1 мес. Упражнений у старых мышей снижает долю НМС со структурными аномалиями до более низкого уровня, чем было в начале периода упражнений. Этот замечательный эффект наблюдается при отсутствии значительных изменений числа мотонейронов или оборота мышечных волокон (рис. 6). Как упражнения уменьшают старение НМС? Возможные клеточные механизмы включают потерю наиболее сильно затронутых НМС с избирательным удержанием менее затронутых, демонтаж аберрантных НМС и сборку новых, а также отмену изменений, которые уже произошли в отдельных НМС.Чтобы различить эти возможности, мы применили протоколы покадровой визуализации, разработанные для грудино-сосцевидной мышцы (36, 37), для длинного разгибателя пальцев (EDL) задней конечности. Животных анестезировали, обнажали мышцу и метили AChR с помощью субнасыщающей дозы fBTX. НМС были визуализированы у 2- и 22-месячных мышей, а затем животных возвращали в их клетки. Половине 22-месячных животных был предоставлен свободный доступ к беговому колесу. Они выздоравливали в течение 1-2 дней и тренировались так же энергично, как и однопометники, изображения которых не регистрировались.Через месяц НМП были перемещены и снова обследованы.

Форма, размер и топология НМС мало изменились за месяц в EDL-мышце молодых взрослых мышей (рис. S9), что согласуется с предыдущими результатами для грудино-сосцевидной мышцы (37). Напротив, дегенеративные изменения накапливались во многих НМС у сидячих старых мышей. Некоторые богатые AChR ветви распадались на фрагменты, а некоторые богатые AChR участки исчезли (рис. 7 A ). НМС тренированных мышей представляли промежуточную картину: они были более стабильными, чем у сидячих старых мышей, но демонстрировали более высокую степень динамизма, чем у молодых взрослых.Поразительно, что в течение месяца упражнений некоторые фрагменты, богатые AChR, сливались с образованием непрерывных ветвей, и появлялись некоторые новые богатые AChR области (Рис. 7 B D ). Многие НМС проявляли как регрессивные (фрагментацию, потеря AChR), так и прогрессирующие (слияние, появление новых областей, богатых AChR).

Рис. 7.

Покадровая визуализация показывает, что упражнения частично обращают вспять возрастные изменения в структуре НМС. ( A D ) Пары микрофотографий НМС, полученных дважды с приблизительно 35-дневным интервалом.( A ) Контрольное животное. Некоторые AChR-богатые области исчезали (*) или становились фрагментированными (стрелки) между представлениями. ( B D ) Животные, которых тренируют в течение 1 мес. Между просмотрами. Новые богатые AChR области были добавлены рядом (стрелка в B ) или между кластерами AChR (маленькая стрелка в C и левые вставки ). Некоторые фрагменты AChR сливались во время периода нагрузки (большие стрелки в C и D ). ( E G ) Изменения в морфологии НМС между видами, оцененными четырьмя людьми, слепыми к тому, какие пары микрофотографий (например, в A C ) были получены от контрольных (Cont) и тренированных мышей (Ex ).Тонкими линиями показаны оценки индивидуумов, жирной линией — среднее значение для всех четырех ( n = 21 НМС от четырех контрольных и 32 НМС от пяти тренированных мышей). ( E ) НМС, в которых площадь, богатая AChR, увеличивалась или уменьшалась ( P <0,005). ( F ) Процент НМС, в которых фрагментация увеличилась ( P <0,03). ( G ) Процент НМС, в которых слились фрагменты, богатые AChR ( P <0,02). Значения P взяты из парного теста t .[Масштабные линейки: 10 мкм ( A C ) и 6,7 мкм ( C Вставки , D ).]

Обширный динамизм старых НМС мешал попыткам количественно оценить изменения с помощью простых показателей, используемых ранее (36 ). В качестве альтернативы мы представили немаркированные пары начальных и конечных изображений НМС четырем наблюдателям, которые не принимали участие в экспериментах, и попросили их оценить, как степень фрагментации AChR изменялась в течение месяца между просмотрами и добавлялись ли новые AChR- богатые регионы опередили потерю синаптических регионов.Оценки всех четырех наблюдателей были в качественном согласии: больше НСС в группе, ведущей малоподвижный образ жизни, чем в группе, выполняющей упражнения, за месяц стали более фрагментированными между взглядами (65% против 28%; P <0,03), больше НСС в группе, занимающейся упражнениями, чем группа, ведущая малоподвижный образ жизни, стала менее фрагментированной (18% против 6%; P <0,02), а чистое добавление AChR было больше в НМС, выполняющих упражнения, чем в группе, ведущей сидячий образ жизни (+ 17% против -16%; P < 0,005) (Рис.7 E G ). Мы пришли к выводу, что упражнения могут частично обратить вспять возрастные изменения в структуре НМС.

Обсуждение

Благоприятное влияние ограничений в питании и физической активности на умственную функцию было достаточно задокументировано, и обе схемы способны затупить или отсрочить возрастное снижение нервных и нервно-мышечных способностей (9, 10, 20, 23, 28) . Здесь мы спросили, влияют ли эти схемы на темп или характер возрастных изменений в синаптической структуре. В качестве первого шага мы классифицировали и количественно оценили возрастные структурные изменения в НМС. В некоторых мышцах конечностей и грудной клетки большинство постсинаптических участков фрагментируются на небольшие островки к возрасту 24 мес.Многие претерминальные аксоны ненормально тонкие или растянутые. Некоторые НМС иннервируются частично или многократно, конфигурация наблюдается в <0,1% соединений молодых взрослых. Уровни AChR низкие на некоторых постсинаптических участках. Около одной трети моторных аксонов потеряно, и около одной десятой НМС полностью денервированы. Многие мышечные волокна атрофичны, а некоторые демонстрируют признаки дегенерации и регенерации - оба признака клинически значимого мышечного истощения, известного как саркопения (31). Изменения проявляются к 18 мес., А их тяжесть возрастает в течение следующего года, и этот период у мышей C57BL / 6 уходит далеко в пожилой возраст, средняя продолжительность жизни которых составляет 26 мес. (32).Использование мышей XFP позволило нам предоставить более количественное и полное представление о возрастных аксональных изменениях, чем было доступно (11–14).

Взяв за основу эти результаты, мы оценили влияние ограничения калорийности и физических упражнений на структуру НМС. Наш главный результат состоит в том, что оба режима ослабляют многие возрастные синаптические изменения. Например, частота фрагментированных постсинаптических структур, тусклых пятен AChR и частичной или полной денервации ниже у животных, подвергшихся физической нагрузке или ограниченных калорийностью, чем у контрольных животных, соответствующих возрасту и штамму.С другой стороны, эффекты двух схем различаются в нескольких отношениях. Во-первых, воздействие упражнений на сегменты аксонов, не противоположных синаптическим сайтам, менее поразительно, чем влияние ограничения калорий: частота терминального разрастания, аксональной атрофии и отека снижается первым, но не вторым. Во-вторых, ограничение калорийности, но не физических упражнений, замедляет возрастную потерю двигательных нейронов и мышечных волокон. Эти различия заслуживают внимания, потому что они предполагают, что влияние упражнений на синаптическую структуру не является косвенным следствием экономии моторных нейронов или мышечных волокон.Наконец, ограничение калорийности затронуло все исследованные мышцы, но упражнения затронули только те мышцы, которые были проработаны. Этот результат предполагает, что положительное влияние упражнений на синапс является результатом локальных взаимодействий. Например, повышенная активность при тренировке мышц может привести к усилению регуляции трофических факторов мышц, что, в свою очередь, улучшит поддержание синапсов (20).

Хотя различные эффекты физических упражнений и ограничения калорийности на НМС предполагают, что они действуют посредством разных механизмов, две ошибки делают эту интерпретацию преждевременной.Во-первых, грызуны с ограничением калорийности более активны, чем те, кого кормят ad libitum (38, 39). Таким образом, некоторые положительные эффекты ограничения калорийности могут быть вторичными по отношению к повышенной активности и, таким образом, механически подобны изменениям, зависящим от физических упражнений. Во-вторых, продолжительность двух схем сильно различалась: ограничение калорийности применялось в раннем взрослом возрасте, но упражнения предлагались в течение 1 месяца в пожилом возрасте. Таким образом, потеря двигательных нейронов и обновление мышечных волокон, вероятно, были значительно продвинуты к тому времени, когда были предложены упражнения, поэтому у этого режима не было возможности оказать сильное влияние на эти параметры.Чтобы отделить различия в режимах от разницы во времени, важно варьировать продолжительность каждого из них.

Драматическое воздействие 1 мес упражнений на структуру НМС повысило вероятность того, что этот режим не просто снизил темп возрастных изменений, но фактически обратил вспять изменения, которые уже произошли. Покадровая съемка in vivo оказала прямую поддержку этой идее. Хотя ранее сообщалось, что режимы образа жизни улучшают поведенческие характеристики (28, 40), насколько нам известно, не было доказательств обращения вспять связанных с возрастом структурных изменений, которые могли бы объяснить это улучшение.NMJ обещает быть полезным препаратом не только для анализа этого обращения, которое также может происходить в центральной нервной системе, но и для оценки роли молекул, таких как сиртуины и инсулиноподобные факторы роста, которые могут регулировать или ослаблять возрастные синаптические изменения.

Материалы и методы

Трансгенные мыши Thy1-XFP были описаны ранее (19). Мы получили три набора мышей C57BL / 6 из Национального института старения: мышей в возрасте от 4 до 5 и от 22 до 24 мес., Которые получали стандартную диету ad libitum, и мышей в возрасте 24 мес. получал диету с ограничением калорий (27).Некоторым мышам на стандартной диете был предоставлен неограниченный доступ к беговому колесу в течение 30 дней. Расстояние бега контролировалось электронным способом (Lafayette Instruments). Эксперименты проводились в соответствии с протоколами на животных, утвержденными комитетами по изучению животных Гарвардского университета и Института Солка.

Для гистологического анализа AChR окрашивали 5 мкг / мл БТК, конъюгированного с Alexa-594 (молекулярные зонды). Аксоны и нервные окончания визуализировали по экспрессии YFP или CFP у трансгенных мышей и с помощью иммуноокрашивания антителами к компонентам аксонов и синаптических везикул у мышей дикого типа.Срезы периферического нерва окрашивали антителами к нейрофиламентам и S100. Срезы спинного мозга окрашивали антителами к активированной каспазе 3. Аксоны малоберцового нерва анализировали с помощью конфокальной микроскопии. Методы визуализации НМС были модифицированы по сравнению с ссылкой 37. Протоколы и критерии оценки возрастных изменений подробно описаны в SI Materials and Methods .

Благодарности

Эта работа была поддержана грантами Национальных институтов здравоохранения (AG32322, J.Р.С. и J.W.L. и AG10435 для F.H.G.) и грант от Ellison Medical Foundation (для J.R.S. и J.W.L.). Г.В. поддерживается грантом Национального института неврологических расстройств и инсульта.

Сноски

  • 2 Кому может быть адресована корреспонденция. Электронная почта: jeff {at} mcb.harvard.edu или sanesj {at} mcb.harvard.edu.
  • Вклад авторов: G.V., J.C.T., H.K., G.D.C., F.H.G., J.W.L. и J.R.S. спланированное исследование; G.V., J.C.T., H.K. и G.D.C. провел исследование; G.V., J.C.T., H.K., J.W.L. и J.R.S. проанализированные данные; и G.V., J.C.T., H.K., J.W.L. и J.R.S. написал газету.

  • Авторы заявляют об отсутствии конфликта интересов.

  • Эта статья представляет собой прямое представление PNAS.

  • Эта статья содержит вспомогательную информацию на сайте www.pnas.org/lookup/suppl/doi:10.1073/pnas.1002220107/-/DCSupplemental.

ЧАСТЬ ВТОРАЯ — Тренер Эми PT

Наш долг… сопротивляться старости, компенсировать ее недостатки, бороться с ней, как мы бы боролись с болезнью; принять режим здоровья; практиковать умеренные упражнения; и принимать достаточно еды и питья, чтобы восстановить свои силы.’» — Цицерон 44 г. до н.э.

С возрастом мы начинаем терять силу скелетных мышц и мышечную массу. Во второй части серии «Секреты борьбы с влиянием старения на опорно-двигательную систему» ​​тренер Эми рассказывает, как можно бороться с потерей мышечной силы и массы с помощью тренировок с отягощениями. Давайте начнем с понимания того, что происходит с нашими мышцами, а затем погрузимся в рекомендации тренера Эми по замедлению воздействия старения на ваши мышцы с помощью укрепления.

Саркопения — потеря мышечной массы

Сочетание саркопении и потери мышечной силы приводит к значительному снижению физической работоспособности и функциональности. Эта потеря работоспособности и функций может привести к порочному кругу упадка, как описано в нашей статье: Секреты борьбы с влиянием старения на опорно-двигательный аппарат.

Саркопения затронет более 200 миллионов человек в следующие 40 лет.

Саркопения вызывается рядом факторов, включая усиление воспаления и уменьшение количества нервно-мышечных соединений.Хорошая новость в том, что мы можем контролировать оба этих фактора. Для получения информации о минимизации и контроле воспаления ознакомьтесь с нашими статьями о воспалении и старении / сухом иглы.

Нервно-мышечные соединения — точка, где нервная клетка упирается в мышечную клетку и посылает ей химическое сообщение о сокращении, позволяя мышце функционировать.

Сила и масса мышц связаны с нервно-мышечными соединениями. Мышцы имеют много соединений. Представьте себе комнату, полную ламп, каждая из которых снабжена электрическими шнурами, передающими электричество.Теперь представьте, что комната — это двуглавая мышца, электрические шнуры — это нервные волокна, а каждая лампа представляет собой множество мышечных волокон двуглавой мышцы. Когда мы перерезаем электрические шнуры, в комнате становится темнее, так же как потеря соединений приводит к ослаблению двуглавой мышцы.

Нервно-мышечные соединения нужны не только для движения скелета, но и для поддержания мышечного тонуса и предотвращения атрофии мышц. Как нам замедлить или остановить потерю этих соединений? Как нам их получить больше?

Ответ: прогрессивные упражнения с отягощениями (RET).

RET часто вызывает в воображении образы Арнольда Шварценеггера 1980-х годов, но сопротивление не обязательно должно проявляться в виде огромных гантелей и рывков. Сопротивление может включать в себя силу тяжести, вес тела, полосы сопротивления, кувшин с молоком, высоту, такую ​​как холмы, напряжение на велосипеде и даже воду!

Чтобы получить максимальную пользу от RET, необходимо задействовать несколько групп мышц одновременно. и должны задействовать большие группы мышц. Например, поход по гравийному холму более полезен, чем собирать шарики пальцами ног.Оба тренируют внутренние мышцы стопы, но только повторения на гравийной тропе задействуют многие большие группы мышц.

Для достижения наилучшего результата и предотвращения травм тренер Эми рекомендует изменить свой распорядок дня. Выбирайте варианты, которые вам нравятся, которые поддерживают вашу мотивацию и постоянство. Вносите изменения один раз в месяц, чтобы увеличивать интенсивность, частоту или продолжительность, а также меняйте типы упражнений, чтобы получить постоянную пользу. Если вы продолжаете делать одно и то же снова и снова, не изменяя и не прогрессируя, тело адаптируется и больше не будет создавать новую мышечную массу или соединения.

Выполняйте домашнее задание

Перед тем, как приступить к выполнению любых упражнений, следуйте этим советам:

  • Ищите тренеров, личных тренеров и инструкторов с высочайшим уровнем квалификации. Они должны иметь степень бакалавра (или выше) в области физических упражнений и / или сертификат Американского колледжа спортивной медицины (ACSM) или Национальной ассоциации силы и кондиционирования (NSCA).

  • Проконсультируйтесь с врачом перед тем, как начать новую тренировку.

  • Лицам с особыми медицинскими показаниями, такими как остеопороз, эндопротезирование суставов и остеоартрит, следует обратиться к физиотерапевту за помощью в начале программы.

  • Если вам больше 65 лет, ознакомьтесь с опросом «Упражнения и скрининг для вас» (EASY) — инструментом, который поможет вам составить рекомендации по соответствующим программам упражнений.

Примеры упражнений с отягощениями

Попробуйте следующие упражнения с отягощениями:

  • Пилатес с реформатором / гантелями / бандажами и массой тела

  • Весы / ленты для силовой йоги и вес тела

  • напряжение — интервальная тренировка высокой интенсивности или холмы

  • Плавание *, особенно с упражнениями на силу (продвинутые с веслами)

  • Водная аэробика * / ходьба по воде с оборудованием сопротивления, таким как весла

  • Походы по холмам / ступени

    * включает упражнения с отягощением и сердечно-сосудистые упражнения

Сдерживайте воздействие старения двойным ударом, сочетая сопротивление с упражнениями для сердечно-сосудистой системы.Ознакомьтесь с нашей предстоящей статьей о том, как сердечно-сосудистые упражнения замедляют старение.

Myasthenia Gravis: основы практики, история вопроса, анатомия

  • Strauss AJL, Seigal BC, Hsu KC. Демонстрация иммунофлуоресценции связывания комплемента мышечной фракции глобулина сыворотки при миастении Gravis. Proc Soc Exp Biol . 1960. 105: 184.

  • Патрик Дж., Линдстрем Дж. М.. Аутоиммунный ответ на рецептор ацетилхолина. Наука . 1973 г.180: 871.

  • Jaretzki A 3rd, Barohn RJ, Ernstoff RM, et al. Миастения гравис: рекомендации по стандартам клинических исследований. Рабочая группа Медицинского научного консультативного совета Американского фонда миастении Гравис. Неврология . 2000 г., 12 июля. 55 (1): 16-23. [Медлайн].

  • Padua L, Stalberg E, LoMonaco M, Evoli A, Batocchi A, Tonali P. SFEMG в диагностике глазной миастении. Clin Neurophysiol . 2000 июл.111 (7): 1203-7. [Медлайн].

  • Gilhus NE, Verschuuren JJ. Миастения гравис: классификация подгрупп и терапевтические стратегии. Ланцет Нейрол . 2015 14 октября (10): 1023-36. [Медлайн].

  • Кизи Дж. Клиническая оценка и лечение миастении. Мышечный нерв . 2004 г., 29 (4): 484-505. [Медлайн].

  • Саперштейн Д.С., Барон Р.Дж. Лечение миастении. Семин Нейрол .2004 24 марта (1): 41-8. [Медлайн].

  • Zinman L, Ng E, Bril V. IV иммуноглобулин у пациентов с миастенией: рандомизированное контролируемое исследование. Неврология . 2007 13 марта. 68 (11): 837-41. [Медлайн].

  • Мандават А., Камински Х. Дж., Каттер Дж., Катирджи Б., Альшехли А. Сравнительный анализ терапевтических возможностей, используемых при миастении. Энн Нейрол . 2010 декабрь 68 (6): 797-805. [Медлайн].

  • Гроб Д., Бруннер Н., Намба Т., Пагала М.Пожизненное течение миастении. Мышечный нерв . 2008 г., 37 (2): 141-9. [Медлайн].

  • Bershad EM, Feen ES, Suarez JI. Кризис миастении. South Med J . 2008 Январь 101 (1): 63-9. [Медлайн].

  • Evoli A, Tonali PA, Padua L. Клинические проявления коррелируют с антителами против MuSK при генерализованной серонегативной миастении гравис. Мозг . 2003 октябрь 126 (Pt 10): 2304-11. [Медлайн].

  • Сандерс ДБ, Ховард Дж. Ф., Месси Дж. М..Серонегативная миастения. Энн Нейрол . 1987. 22: 126.

  • Гайдос П., Шевре С., Тойка К. Внутривенный иммуноглобулин при миастении. Кокрановская база данных Syst Rev . 2008 23 января. CD002277. [Медлайн].

  • Вулф Г.И., Камински Х.Дж., Абан И.Б., Минисман Г., Куо Х.С. и др. Рандомизированное исследование тимэктомии при миастении. N Engl J Med . 2016 11 августа. 375 (6): 511-22. [Медлайн].

  • Селитра ММ.Нервно-мышечное соединение позвоночных. Селпитер ММ. Нервно-мышечные соединения позвоночных: общая морфология, молекулярная организация и функциональные последствия . Нью-Йорк: Алан Лисс; 1987. 1-54.

  • Stickler DE, Massey JM, Sanders DB. MuSK-антитела положительная миастения гравис: клинические и электродиагностические закономерности. Clin Neurophysiol . 2005 сентябрь 116 (9): 2065-8. [Медлайн].

  • Ричман Д.П., Агиус Массачусетс. Лечение аутоиммунной миастении. Неврология . 23 декабря 2003 г. 61 (12): 1652-61. [Медлайн].

  • Schneider-Gold C, Gajdos P, Toyka KV, Hohlfeld RR. Кортикостероиды при миастении. Кокрановская база данных Syst Rev . 2005 18 апреля. CD002828. [Медлайн].

  • Драхман Д.Б., Джонс Р.Дж., Бродский Р.А. Лечение рефрактерной миастении: «перезагрузка» высокими дозами циклофосфамида. Энн Нейрол . 2003 Январь 53 (1): 29-34. [Медлайн].

  • Meriggioli MN, Ciafaloni E, Al-Hayk KA, et al.Микофенолат мофетил при миастении: анализ эффективности, безопасности и переносимости. Неврология . 2003 25 ноября. 61 (10): 1438-40. [Медлайн].

  • Деймир Ф., Гунгор-Тунцер О, Йилмаз В., Парман Й., Сердароглу П., Оздемир С. и др. Клиническое сравнение анти-MuSK-, анти-AChR-положительной и серонегативной миастении гравис. Неврология . 2007 г. 20 февраля. 68 (8): 609-11. [Медлайн].

  • Evoli A, Tonali PA, Padua L, Monaco ML, Scuderi F, Batocchi AP, et al.Клинически коррелирует с антителами против MuSK при генерализованной серонегативной миастении. Мозг . 2003 октябрь 126 (Pt 10): 2304-11. [Медлайн].

  • Martignago S, Fanin M, Albertini E, Pegoraro E, Angelini C. Гистопатология мышц при миастении с использованием антител против MuSK и AChR. Neuropathol Appl Neurobiol . 2009 Февраль 35 (1): 103-10. [Медлайн].

  • Keller DM. Поздняя миастения связана с повышенным риском рака. Medscape Medical News . 2 июля 2013 г. [Полный текст].

  • Лю CJ, Chang YS, Teng CJ и др. Риск экстратимического рака у пациентов с миастенией на Тайване: общенациональное популяционное исследование. евро J Neurol . 2012 май. 19 (5): 746-51. [Медлайн].

  • О SJ, Дхалл Р., Янг А., Морган МБ, Лу Л., Клауссен Г.К. Статины могут усугубить миастению. Мышечный нерв . 2008 Сентябрь 38 (3): 1101-7. [Медлайн]. [Полный текст].

  • Хардинг А. Диагностика детской миастении может быть сложной задачей, как показывают исследования. Медицинские новости Medscape. Доступно на http://www.medscape.com/viewarticle/811117. Дата обращения: 23 сентября 2013 г.

  • Vanderpluym J, Vajsar J, Jacob FD, Mah JK, Grenier D, Kolski H. Клинические характеристики детской миастении: надзорное исследование. Педиатрия . 2013 9 сентября [Medline].

  • Guptill JT, Sanders DB, Evoli A.Миастения гравис с антителами против MuSK: клинические данные и ответ на лечение в двух больших когортах. Мышечный нерв . 2011 Июль 44 (1): 36-40. [Медлайн].

  • J P Sieb. Myasthenia gravis: новости для клиницистов. Клин Экспер Иммунол . Март 2014. 175 (3): 408–418. [Полный текст].

  • Engel AG. Приобретенная аутоиммунная миастения. В: Engel AG, Franzini-Armstrong C, eds. Миология: фундаментальная и клиническая. 2-е изд. .1994. 1769-1797.

  • Куреши А.И., Чаундри М.А., Мохаммад И. и др. Дыхательная недостаточность как первое проявление миастении. Медицинский Мониторинг . 2004 г., 10 (12): CR684-9. [Медлайн].

  • Тиндалл RS. Гуморальный иммунитет при миастении: биохимическая характеристика приобретенных антирецепторных антител и клинические корреляции. Энн Нейрол . 1981, 10 ноября (5): 437-47. [Медлайн].

  • Сандерс ДБ, Эль-Салем К., Мэсси Дж. М., МакКонвилл Дж., Винсент А.Клинические аспекты серонегативного MG с положительным результатом на антитела к MuSK. Неврология . 24 июня 2003 г. 60 (12): 1978-80. [Медлайн].

  • Zhang B, Tzartos JS, Belimezi M, Ragheb S, Bealmear B, Lewis RA, et al. Аутоантитела к липопротеин-связанному белку 4 у пациентов с двойной серонегативной миастенией. Arch Neurol . 2012 Апрель 69 (4): 445-51. [Медлайн].

  • Romi F, Skeie GO, Gilhus NE. Стриарные антитела при миастении: реактивность и возможное клиническое значение. Arch Neurol . 2005 г., 62 (3): 442-6. [Медлайн].

  • Phillips LH 2nd, Melnick PA. Диагностика миастении в 1990-е гг. Семин Нейрол . 1990 марта, 10 (1): 62-9. [Медлайн].

  • Toth L, Toth A, Dioszeghy P, Repassy G. Электронистагмографический анализ оптокинетического нистагма для оценки глазных симптомов при миастении гравис. Акта Отоларингол . 1999. 119 (6): 629-32. [Медлайн].

  • Ян Цюй, Вэй М, Сун Ф, Тянь Дж, Чен Х, Лу К.Оптокинетический нистагм с открытым и закрытым контуром (ОКН) у пациентов с миастенией и немиастенией. Эксперимент Нейрол . 2000 ноябрь 166 (1): 166-72. [Медлайн].

  • Мовагар М, Славин МЛ. Влияние местного тепла по сравнению со льдом на блефароптоз в результате миастении глаза. Офтальмология . 2000 декабрь 107 (12): 2209-14. [Медлайн].

  • Бенатар М. Систематический обзор диагностических исследований миастении. Нервно-мышечное расстройство .2006 июл.16 (7): 459-67. [Медлайн].

  • Pascuzzi RM. Жемчужины и подводные камни в диагностике и лечении нарушений нервно-мышечного соединения. Семин Нейрол . 2001 21 декабря (4): 425-40. [Медлайн].

  • Лисак РП. Миастения Гравис. Варианты лечения Curr Neurol . 1999 июл.1 (3): 239-250. [Медлайн].

  • Gold R, Schneider-Gold C. Современные и будущие стандарты лечения миастении. Нейротерапия . 2008 г., 5 (4): 535-41. [Медлайн].

  • Hoch W, McConville J, Helms S, Newsom-Davis J, Melms A, Vincent A. Аутоантитела к рецепторной тирозинкиназе MuSK у пациентов с миастенией гравис без антител к рецепторам ацетилхолина. Нат Мед . 2001 марта, 7 (3): 365-8. [Медлайн].

  • Pasnoor M, Wolfe GI, Nations S, et al. Клинические данные при миастении с положительной реакцией на MuSK-антитела: СШАопыт. Мышечный нерв . 2010 Март 41 (3): 370-4. [Медлайн].

  • [Рекомендации] Бенатар М., Камински Х.Дж. Отчет о доказательствах: медикаментозное лечение миастении глаза (обзор, основанный на фактах): отчет Подкомитета по стандартам качества Американской академии неврологии. Неврология . 2007, 12 июня. 68 (24): 2144-9. [Медлайн].

  • Харт И.К., Сатхасивам С., Шаршар Т. Иммунодепрессанты при миастении. Кокрановская база данных Syst Rev .17 октября 2007 г. CD005224. [Медлайн].

  • Dalakas MC. Внутривенный иммуноглобулин при аутоиммунных нервно-мышечных заболеваниях. ДЖАМА . 2004 г. 19 мая. 291 (19): 2367-75. [Медлайн].

  • Зинман Л., Брил В. Лечение ВВИГ миастении: эффективность, ограничения и новые терапевтические стратегии. Энн Н. И Акад. Наук . 2008. 1132: 264-70. [Медлайн].

  • Aydin Y, Ulas AB, Mutlu V, Colak A, Eroglu A.Тимэктомия при миастении. Евразийский журнал J Med . 2017 Февраль 49 (1): 48-52. [Медлайн].

  • Лейте М.И., Штробель П., Джонс М. и др. Меньше изменений тимуса у MuSK-антител-позитивных, чем у MuSK-негативных по антителам MG. Энн Нейрол . 2005 Март 57 (3): 444-8. [Медлайн].

  • Говард Дж. Ф. младший, Уцугисава К., Бенатар М. и исследовательская группа REGAIN. Безопасность и эффективность экулизумаба в резистентной генерализованной миастении (REGAIN) с положительными антителами к рецепторам ацетилхолина (REGAIN): рандомизированное, двойное слепое, плацебо-контролируемое, многоцентровое исследование фазы 3. Ланцет Нейрол . 2017 16 декабря (12): 976-986. [Медлайн].

  • Маппиди А., Уцугисава К., Бенатар М. и исследовательская группа REGAIN. Безопасность и эффективность экулизумаба при генерализованной миастении в долгосрочной перспективе. Мышечный нерв . 2019 июл 60 (1): 14-24. [Полный текст].

  • Диас-Манера Дж., Мартинес-Эрнандес Э., Керол Л., Клоостер Р., Рохас-Гарсия Р., Суарес-Кальвет X и др. Длительный лечебный эффект ритуксимаба при миастении МуСК. Неврология . 2012 17 января. 78 (3): 189-93. [Медлайн].

  • Nieto IP, Робледо JP, Pajuelo MC и др. Факторы прогноза миастении, леченной тимэктомией: обзор 61 случая. Энн Торак Хирург . 1999 июн. 67 (6): 1568-71. [Медлайн].

  • Cataneo AJM, Felisberto G Jr, Катанео, округ Колумбия. Тимэктомия при нетимоматозной миастении — систематический обзор и метаанализ. Орфанет J Редкий Диск . 2018 июн 25.13 (1): 99. [Медлайн].

  • Таканами И., Абико Т., Коидзуми С. Терапевтические результаты у пациентов с тимэктомией и миастенией гравис. Ann Thorac Cardiovasc Surg . 2009 15 декабря (6): 373-7. [Медлайн].

  • Goldstein SD, Yang SC. Оценка роботизированной тимэктомии с использованием рекомендаций Американского фонда миастении Гравис. Энн Торак Хирург . 2010 апр. 89 (4): 1080-5; обсуждение 1085-6. [Медлайн].

  • Марулли Г., Скьявон М., Периссинотто Э. и др.Хирургические и неврологические результаты после роботизированной тимэктомии у 100 последовательных пациентов с миастенией. J Thorac Cardiovasc Surg . 2013 март 145 (3): 730-5; обсуждение 735-6. [Медлайн].

  • Plauché WC. Миастения у матерей и их новорожденных. Clin Obstet Gynecol . 1991 г., 34 (1): 82-99. [Медлайн].

  • Brooks M. PLEX и IVIG — эффективные варианты поддерживающей терапии у молодых MG. Медицинская информация Reuters .6 марта 2014 г. [Полный текст].

  • Лью В.К., Пауэлл Калифорния, Слоан С.Р. и др. Сравнение плазмафереза ​​и внутривенного иммуноглобулина в качестве поддерживающей терапии ювенильной миастении. JAMA Neurol . 2014 г. 3 марта [Medline].

  • Как стареют мышцы и как упражнения могут его замедлить

    Хорошая новость заключается в том, что упражнения могут предотвратить и даже обратить вспять потерю мышц и слабость. Недавние исследования показали, что физическая активность может способствовать здоровью митохондрий, увеличивать обмен белка и восстанавливать уровни сигнальных молекул, участвующих в мышечной функции.Но хотя ученые много знают о том, что идет не так в процессе старения, и знают, что упражнения могут замедлить неизбежное, детали этой взаимосвязи только начинают проявляться в центре внимания.

    Скелетная мышца человека

    © РЕГЕНТЫ МИЧИГАНСКОГО УНИВЕРСИТЕТА

    Роль мышечных стволовых клеток

    Скелетная мышца состоит из многоядерных волокон, образованных слиянием клеток-предшественников мышц или миобластов во время эмбрионального и внутриутробного развития и постнатально до ткань достигает взрослого размера.Зрелые волокна являются постмитотическими, то есть больше не делятся. В результате во взрослом возрасте рост и восстановление мышц возможны только благодаря наличию мышечных стволовых клеток.

    В 1961 году биофизик из Рокфеллеровского университета Александр Мауро с помощью электронной микроскопии впервые описал мышечные стволовые клетки, назвав их «сателлитными клетками» из-за их расположения на периферии мышечного волокна. 1 Впоследствии исследователи продемонстрировали, что клетки-сателлиты — единственные клетки, способные восстанавливать мышцы, что объясняет, почему восстановление после мышечных травм у пожилых людей происходит медленно и часто неполно: количество сателлитных клеток падает с 8 процентов от общего числа ядер мышц в молодых людей всего до 0.8 процентов в возрасте от 70 до 75 лет.

    Конечно, виновато снижение способности сателлитных клеток делиться и восстанавливаться, но исследования не подтверждают эту идею. В новаторских исследованиях, проведенных в 1989 году, биологи Брюс Карлсон и Джон Фолкнер из Мичиганского университета показали, что мышца, выделенная у двухлетней крысы, восстанавливается быстрее и лучше при пересадке двух-трехмесячным крысам. 2 Совсем недавно мы изолировали эти клетки от молодых и старых взрослых и были удивлены, обнаружив, что сателлитные клетки пожилого человека росли в культуре так же, как и от молодых людей. 3

    Однако исследованные нами сателлитные клетки пожилого человека показали драматические изменения в их эпигенетических отпечатках с репрессией многих генов метилированием ДНК. Один ген, названный sprouty 1 , известен как важный регулятор покоя клеток. Снижение экспрессии sprouty 1 может ограничивать самообновление сателлитных клеток и может частично объяснять прогрессирующее снижение количества сателлитных клеток, наблюдаемое в мышцах человека во время старения.Действительно, стимуляция экспрессии sprouty 1 предотвращает возрастную потерю сателлитных клеток и противодействует возрастной дегенерации нервно-мышечных соединений у мышей. 4

    ИЗМЕНЕНО ИЗ © ISTOCK, jxfzsy

    Митохондриальные участники

    Другими вероятными виновниками старения мышц являются митохондрии, электростанции мышц. Для эффективной работы скелетным мышцам необходимо достаточное количество полнофункциональных митохондрий. Эти органеллы составляют от 5 до 12 процентов объема мышечных волокон человека, в зависимости от активности и специализации мышц (быстро сокращающиеся или медленные).Исследования показывают, что аномалии морфологии, количества и функции митохондрий тесно связаны с потерей мышечной массы, наблюдаемой у пожилых людей.

    В 2013 году Дэвид Гласс из Novartis и его коллеги обнаружили, что маркеры митохондриального метаболизма значительно снижались с возрастом у крыс, и это коррелировало с началом саркопении. 5 Хотя результаты просто коррелируют, время и почти идеальная взаимосвязь между снижением экспрессии митохондриальных генов и началом саркопении является убедительным доказательством того, что митохондриальная дисфункция может быть движущей силой саркопении.Экспрессия генов и выработка белков, которые регулируют деление и слияние митохондрий — процессы, которые поддерживают объем и функцию митохондрий — также упали, предполагая, что динамика митохондрий также нарушается во время старения мышц.

    Как и в случае снижения мышечных стволовых клеток, основной причиной плохого здоровья митохондрий может быть регуляция генов. В 2016 году Алиса Панерек и ее коллеги из Института медицинских наук Нестле и Манчестерского столичного университета в Великобритании исследовали транскриптомы мышц крысы и человека и обнаружили, что предрасположенность к саркопении у обоих видов тесно связана с дерегуляцией генных сетей, участвующих в митохондриальных процессах. , регуляция внеклеточного матрикса и фиброза, образование избыточной соединительной ткани в мышце, вызванное накоплением белков внеклеточного матрикса. 6

    Контроль качества белка

    Даже если они едят много белка, пожилые люди часто не могут поддерживать мышечную массу, вероятно, потому, что их тела не могут превращать белки в мышцы достаточно быстро, чтобы идти в ногу с естественной скоростью разрушения тканей. Более того, мышцы пожилых людей подвергаются более низкому уровню аутофагии — процессу, который в здоровых условиях перерабатывает использованные и поврежденные белки, органеллы и другие клеточные структуры. Это может привести к дисбалансу между производством и деградацией белка, что, вероятно, связано со старением мышц.

    См. «Ешьте себя, чтобы жить: роль аутофагии в здоровье и болезнях»

    Также могут быть другие способы, которыми снижение аутофагии может способствовать как потере мышечной массы, так и мышечной слабости во время старения. Чтобы поддерживать мышечную силу, мышечные клетки должны избавляться от внутриклеточного мусора, который накапливается с течением времени. В случае мышечных клеток этот мусор включает старые органеллы, такие как митохондрии и эндоплазматические ретикулы, скопления поврежденных белков и свободные радикалы, которые со временем могут стать цитотоксичными.Перерабатывая митохондрии, мышечные волокна повышают выработку энергии и сохраняют функцию мышц. Если мышечные волокна не справятся с этими потенциально опасными объектами, они станут меньше и слабее. Разумеется, в исследовании группы Марко Сандри из Университета Падуи в Италии у мышей, в скелетных мышцах которых отсутствовал один из основных генов, контролирующих аутофагию, Atg7, наблюдалась значительная потеря мышц и возрастная мышечная слабость. 7

    Сигналы крови

    В 2005 году биолог стволовых клеток Стэнфордского университета Томас Рандо и его коллеги объединили кровообращение молодых и старых мышей и обнаружили, что факторы в крови молодых мышей способны омолаживать восстановление мышц у старых мышей.В настоящее время хорошо известно, что уровни циркулирующих гормонов и факторов роста резко снижаются с возрастом и что это влияет на старение мышц. Действительно, заместительная гормональная терапия может эффективно обратить вспять старение мышц, отчасти за счет активации путей, участвующих в синтезе белка.

    См. «Как старые клетки могут вернуть молодость».

    Как стареют мышцы: саркопения, потеря мышечной массы с возрастом, может начаться уже в 30 лет и поражает значительную часть пожилых людей. К счастью, упражнения могут бороться со старением мышц, вероятно, обращая вспять многие возрастные физиологические изменения, лежащие в основе этого снижения.См. Полную инфографику: WEB | PDF

    © scott leighton

    Кроме того, мышца сама по себе является секреторным эндокринным органом. Белки, вырабатываемые мышцами при сокращении, попадают в кровь либо сами по себе, либо заключенные в мембраносвязанные везикулы, которые защищают их от разрушения циркулирующими ферментами. Бенте Педерсен из Центра воспаления и метаболизма и Центра исследований физической активности в Дании был первым, кто использовал термин миокин для описания этих белков. Секретированные миокины могут действовать локально на мышечные клетки или другие типы клеток, такие как фибробласты и воспалительные клетки, чтобы координировать физиологию мышц и восстановление, или они могут оказывать влияние на отдаленные органы, такие как мозг.

    Хотя некоторые из этих миокинов были идентифицированы — в культуре мышечные волокна человека секретируют до 965 различных белков — исследователи только начали понимать их роль в старении мышц. Первый идентифицированный миокин, интерлейкин-6 (ИЛ-6), участвует в поддержании мышц, снижая уровни воспалительных цитокинов в мышечной среде, увеличивая при этом стимулируемое инсулином поглощение глюкозы и окисление жирных кислот. Пожилые люди с высоким уровнем циркулирующего IL-6 более склонны к саркопении.Другой миокин, инсулиноподобный фактор роста 1 (IGF-1), может вызывать набухание мышечных волокон, в том числе после тренировки. Уровни IGF-1 снижаются с возрастом, как и уровни рецептора клеточной поверхности, с которым связывается IGF-1, а мыши, которые сверхэкспрессируют IGF-1, устойчивы к возрастной саркопении.
    Натали Вигери и ее коллеги из Института метаболических и сердечно-сосудистых заболеваний INSERM-Тулузского университета во Франции недавно открыли новый миокин, который они назвали апелином. 8 Исследователи продемонстрировали, что этот пептид может корректировать многие метаболические пути, которые нарушены в стареющих мышцах.При введении старым мышам апелин стимулировал образование новых митохондрий, стимулировал синтез белка, аутофагию и другие ключевые метаболические пути, а также усиливал регенеративную способность стареющих мышц за счет увеличения количества и функции сателлитных клеток. Как и в случае с IGF-1, уровни циркулирующего апелина у людей снижаются с возрастом, что позволяет предположить, что восстановление уровней апелина до уровней, измеренных у молодых людей, может улучшить саркопению.

    Упражнения для борьбы со старением мышц

    Хотя причины потери мышечной массы многочисленны и сложны, в настоящее время имеется множество доказательств того, что упражнения могут предотвратить или обратить вспять многие из этих возрастных изменений, в то время как бездействие ускоряет старение мышц.Ранее в этом году, например, Джанет Лорд из Университета Бирмингема и Стивен Харридж из Королевского колледжа Лондона исследовали мышцы 125 велосипедистов-любителей мужского и женского пола и показали, что регулярные физические упражнения в течение всей жизни могут замедлить старение мышц: потерь в мышцах нет. мышечная масса или мышечная сила среди тех, кто был старше и регулярно тренировался. Что еще более удивительно, иммунная система тоже не сильно постарела. 9

    Влияние упражнений на здоровье мышц, вероятно, действует через столько же механизмов, сколько и лежащих в основе возрастной потери мышечной массы и слабости.Например, количество сателлитных клеток можно увеличить с помощью упражнений, и у активных пожилых людей этих клеток больше, чем у людей, ведущих малоподвижный образ жизни. Это причина, по которой упражнения перед операцией на бедро и колено могут ускорить выздоровление у пожилых людей.

    Физическая активность также влияет на митохондрии мышц. Недостаток упражнений снижает эффективность и количество митохондрий в скелетных мышцах, в то время как упражнения способствуют здоровью митохондрий. В прошлом году Катерина Тецце в лаборатории Сандри в Университете Падуи определила сильную корреляцию между снижением уровней OPA1, белка, участвующего в формировании митохондрий, и снижением мышечной массы и силы у пожилых людей, в то время как уровни OPA1 были поддерживаются в мышцах спортсменов старшего возраста, которые регулярно тренировались на протяжении всей своей жизни. 10

    Возрастные мышечные заболевания

    Саркопения является частью общего процесса старения, но может быть запущена преждевременно при некоторых поздних мышечных заболеваниях. Например, окулофарингеальная мышечная дистрофия (OPMD) — редкое генетическое заболевание, которое в первую очередь поражает мышцы век (окуло) и горла (глотки). Мутации в гене полиаденилата полиаденилата ядерного 1 (PABPN1) приводят к продукции аномального белка, который образует агрегаты только в ядрах мышечных волокон.Позднее начало заболевания, которое обычно проявляется в возрасте от 50 до 60 лет, предполагает, что пораженные мышцы успешно справляются с аномальным белком в течение многих лет. Однако способность справляться с аномальными белками с возрастом снижается, и дисбаланс между элиминацией и агрегацией может вызвать начало OPMD.

    OPMD показывает механистическое сходство с тяжелыми дегенеративными нарушениями, при которых нарушенный метаболизм РНК и патологические сборки РНК-связывающих белков участвуют в образовании цитоплазматических или ядерных агрегатов.У пациентов со спиноцеребеллярной атаксией, БАС, болезнью Альцгеймера, Хантингтона или Паркинсона эти агрегаты образуются в нейронах. В случае миотонической дистрофии и миозита с тельцами включения они образуются в мышечных волокнах. Определение точного изменения метаболизма РНК — интересный вопрос, с которым сталкиваются исследователи, изучающие старение мышц. Следует отметить, что все эти заболевания также характеризуются аномальными митохондриями, которые наблюдаются в стареющих мышцах.

    Исследования этих болезней должны вести не только к конкретным методам лечения, но и к вмешательствам в отношении здорового в целом стареющего населения.Верно и обратное: понимание того, как остановить старение мышц, может предоставить инструменты для улучшения патологических состояний. Поэтому сотрудничество между областями патофизиологии и старения для изучения этих заболеваний, для которых существуют животные и клеточные модели, должно стать предметом будущих исследований.

    Физические упражнения могут даже стимулировать мышечные клетки поддерживать более молодой уровень транскриптов генов и белков. Например, Срикумаран Наир из клиники Майо в Рочестере, штат Миннесота, и его коллеги обнаружили, что высокоинтенсивные аэробные интервальные тренировки обращают вспять многие возрастные различия в составе мышц, включая восстановление уровней митохондриального белка. 11 Саймон Мелов из Института исследований старения Бака и Марк Тарнопольски из Университета Макмастера в Канаде и их коллеги обнаружили, что, в то время как здоровые пожилые люди (средний возраст 70 лет) имели профиль экспрессии генов, который соответствовал митохондриальной дисфункции ранее. Что касается программы тренировок с отягощениями, то всего за шесть месяцев этот генетический отпечаток полностью изменился до уровней экспрессии, сравнимых с уровнями, наблюдаемыми у молодых людей. Кроме того, упражнения улучшили мышечную функцию: пожилые люди были на 59 процентов слабее, чем молодые люди до тренировки, и только на 38 процентов после нее. 12 Различные типы упражнений могут вызывать различные, но специфические реакции в мышцах. Например, в то время как силовые тренировки эффективны для наращивания мышц, согласно работе Наира, интервальные тренировки высокой интенсивности в виде аэробных упражнений, таких как езда на велосипеде и ходьба, оказали наибольшее влияние на клеточном уровне в борьбе с возрастными потерями и слабостью.

    Физические упражнения могут предотвратить или обратить вспять многие из этих возрастных изменений, тогда как бездействие ускоряет старение мышц.

    Физические упражнения также влияют на аутофагию. В декабре 2011 года Сандри и его коллеги первыми сообщили на мышах, что активность аутофагии может быть усилена добровольной физической активностью, в данном случае бегом на беговой дорожке. 13 В январе 2012 года команда Бет Левин из Юго-западного медицинского центра Техасского университета подтвердила, что упражнения быстро увеличивают активность аутофагии и что аутофагия необходима для того, чтобы упражнения имели положительный эффект: физически активные мыши, которые не могли усилить аутофагию. не показали увеличения мышечной массы, содержания митохондрий или чувствительности к инсулину после бега. 14

    Наконец, упражнения также могут восстанавливать уровни миокинов, которые снижаются с возрастом. Например, когда пожилые люди следовали регулярной программе физической активности, наблюдалась прямая корреляция между улучшением их физической работоспособности и увеличением уровня циркулирующего апелина. 15 Точно так же Иван Баутманс из Брюссельского университета показал, что повышенные уровни циркулирующих маркеров воспаления коррелируют с мышечной усталостью у гериатрических пациентов, а тренировки с отягощениями снижают воспалительные миокины у молодых людей. 16

    С помощью этих и других механизмов, которые нам еще предстоит открыть, упражнения могут улучшить общую силу у пожилых людей и, в частности, метаболическую энергию скелетных мышц. Будучи самой многочисленной тканью в среднем человеческом теле, составляя от 30 до 40 процентов его общей массы, мышцы имеют решающее значение не только для передвижения и дыхания, но также для гомеостаза глюкозы, липидов и аминокислот. Таким образом, возрастная потеря мышечной массы и качества способствует общей метаболической дисфункции, обычно наблюдаемой у пожилых пациентов.У пожилых женщин после часа быстрой ходьбы на следующий день повысилась чувствительность к инсулину. 17 Таким образом, никогда не поздно заняться физическими упражнениями, чтобы попытаться бороться с последствиями старения мышц.

    Детальное понимание молекулярных и клеточных путей, участвующих в старении мышц, может проложить путь к разработке терапевтических вмешательств для ускорения синтеза белка и увеличения мышечной массы. На данный момент регулярные упражнения в сочетании с правильным питанием по-прежнему являются наиболее эффективным способом борьбы с саркопенией и, возможно, старением в целом.В дополнение к подробному описанию основных причин старения мышц, будущие исследования должны быть направлены на определение оптимальных программ физических упражнений и питания для борьбы с возрастной потерей и слабостью мышц. Это может не значительно увеличить продолжительность жизни человека, но, безусловно, поможет людям достичь конца своей жизни в более здоровом состоянии.

    Джиллиан Батлер-Браун изучает нервно-мышечные заболевания и генную терапию в Сорбоннском университете, INSERM, Institut de Myologie, Centre de Recherche en Myologie, в Париже, Франция.В том же учреждении Винсент Мули изучает регенерацию мышц при здоровье и болезнях, Энн Биго изучает старение мышц, а Capucine Trollet изучает возрастные мышечные заболевания и генную терапию.

    Ссылки

    1. А. Мауро, «Сателлитная клетка волокон скелетных мышц», J Biophys Biochem Cytol , 9: 493–95, 1961.
    2. B.M. Карлсон, Дж. Фолкнер, «Трансплантация мышц между молодыми и старыми крысами: возраст хозяина определяет выздоровление», Am J Physiol , 256: C1262–66, 1989.
    3. A. Bigot et al., «Возрастное метилирование подавляет SPRY1, что приводит к нарушению восстановления покоя и потере пула резервных стволовых клеток в мышцах пожилого возраста», Cell Rep , 13: 1172–82, 2015 .
    4. W. Liu et al., «Потеря взрослых стволовых клеток скелетных мышц приводит к возрастной дегенерации нервно-мышечных соединений», eLife , 6: e26464, 2017.
    5. C. Ibebunjo et al., «Геномные и протеомные профилирование выявляет снижение функции митохондрий и нарушение нервно-мышечного соединения, вызывающее саркопению у крыс », Mol Cell Biol , 33: 194–212, 2013.
    6. A. Pannérec et al., «Надежная нервно-мышечная система защищает скелетные мышцы крысы и человека от саркопении», Aging , 8: 712–28, 2016.
    7. E. Masiero et al., «Аутофагия необходима для поддерживать мышечную массу », Cell Metab , 10: 507–15, 2009.
    8. A. Besse-Patin et al.,« Влияние тренировок на выносливость на экспрессию миокинов в скелетных мышцах у мужчин с ожирением: идентификация апелина как нового миокина. , ” Int J Obes, 38: 707–13, 2014.
    9. N.А. Дуггал и др., «Основные характеристики иммунного старения, включая снижение выработки тимуса, улучшаются за счет высоких уровней физической активности во взрослом возрасте», Aging Cell , 17: e12750, 2018.
    10. C. Tezze et al., «Возрастная потеря OPA1 в мышцах влияет на мышечную массу, метаболический гомеостаз, системное воспаление и старение эпителия», Cell Metab , 25: 1374–89.e6, 2017.
    11. R. Sreekumar et al., «Gene профиль экспрессии в скелетных мышцах диабета 2 типа и эффект лечения инсулином », Diabetes , 51: 1913–20, 2002.
    12. S. Melov et al., «Упражнения с отягощениями обращают вспять старение скелетных мышц человека», PLOS ONE , 2: e465, 2007.
    13. F. Lo Verso et al., «Аутофагия не требуется для поддержания физических упражнений и Активность PRKAA1 / AMPK, но важна для предотвращения повреждения митохондрий во время физической активности », Autophagy , 10: 1883–94, 2014.
    14. C. He et al.,« Регулируемая BCL2 аутофагия, индуцированная физическими упражнениями, необходима для мышечной глюкозы. гомеостаз », Nature , 481: 511–15, 2012.
    15. C. Vinel et al., «Exerkine apelin обращает вспять возрастную саркопению», Nat Med , DOI: 1010.1038 / s41591-018-0131-6, 2018.
    16. P. Arnold et al., «Peripheral мышечная усталость у госпитализированных гериатрических пациентов связана с циркулирующими маркерами воспаления », Exp Gerontol , 95: 128–35, 2017.

    Добавить комментарий

    Ваш адрес email не будет опубликован.