Кудин чай свойства: Кудин чай — полезные свойства

Содержание

Кудин чай — полезные свойства

Богатый полезными свойствами кудин — это не совсем чай. Он производится из больших плотных листьев вечнозеленого растения, которое называется падуб широколистный. На территории Китая он растет повсеместно. Место произрастания не влияет на вкусовые и полезные свойства чая кудина. Падуб широколистный растет хорошо в любой китайской провинции.

Почему кудин часто называют чаем? Все дело в производстве. Технология приготовления кудина и чая схожи.

В Поднебесной напиток обожают пить долгожители. Благодаря огромному перечню полезных свойств кудин лидирует в списке самых целебных чаев. Он издавна применяется в китайской медицине.

Какими полезными свойствами обладает чай кудин?
  • Благодаря своим полезным свойствам чай кудин понижает жар и оказывает противовоспалительное воздействие, поэтому рекомендуется при простуде.
  • Напиток помогает при отравлениях.
  • Нормализует давление.
  • Благоприятно воздействует на пищеварение и стимулирует обмен веществ.
  • Являясь сильным антиоксидантом, напиток защищает организм от пагубного влияния внешней среды: плохой экологии, радиационного воздействия.

Кудин славится не только полезными свойствами, но и тонизирующим эффектом: пейте чай, когда нужно повысить работоспособность, проснуться.

Можно ли пить кудин каждый день?

У напитка нет противопоказаний, но ежедневное употребление все-таки не рекомендовано. Обладая множеством полезных свойств, кудин относится, скорее, к лечебным чаям, чем к повседневным напиткам. Чтобы почувствовать оздоровительный эффект и укрепить свой организм, достаточно пить его примерно 2 – 3 раза в неделю.

Кроме того, вам вряд ли захочется пить кудин каждый день. Он очень горький!

Как заваривать чай, чтобы кудин не потерял полезных свойств?
  • Если залить кудин кипятком, настой станет настолько горьким, что вы едва ли сможете пригубить этот напиток. Оптимальная температура воды — 40 – 50 °С. Соблюдая правильный температурный режим, вы получите напиток с горьковатым, но благородным, вкусом.
  • Также нужно знать меру, насыпая в чайник заварку. Достаточно одной палочки кудина на церемонию.
  • Чай настаивают не более 5 – 20 секунд. Слишком горький настой свидетельствует о том, что вы или превысили температурный режим, или насыпали больше 3 – 4 граммов чая.
  • Кудин можно заваривать 7 – 9 раз.

Заказать полезный чай можно в режиме онлайн или по телефону +7 (495) 21-520-21.

Чем полезен чай Кудин — свойства, заварка, противопоказания

21.10.2018

Из чего делают Кудин?

Кудин – это листья падуба широколистного, кустарника, который произрастает, в том числе, в Китае. У падуба высокий и мощный ствол с тёмной корой, ярко-зелеными листьями и красными ягодами. Для чая используются только листья падуба, их собирают вручную, а затем скручивают или прессуют, а бывает, что высушивают прямо так.

Слово «кудин» в переводе с китайского означает «горькая трава». Но горечь можно почувствовать, только если неправильно заварить этот чай. Кудин, заваренный с соблюдением всех правил, имеет терпкий вкус с долгим сладковатым послевкусием и светло-зелёный цвет.

Полезные свойства чая Кудин

Напиток, полученный из Кудина, содержит много витаминов, полезных для жизнедеятельности человека, а также аскорбиновую и никотиновую кислоты, сочетание которых имеет тонизирующий и сосудорасширяющий эффект.

 

 

В чае Кудин также содержатся:

  • дубильное вещество танин, обладающее вяжущим и противовоспалительным действием;
  • кофеин и алкалоиды, тонизирующие нервную систему;
  • эфирные масла, которые обладают антисептическим и антибактериальным воздействием;
  • теин, который образуется в результате взаимодействия кофеина с танином и стимулирует умственную активность, но не вызывает привыкания.

Китайские врачи часто рекомендуют Кудин своим пациентам в качестве общеукрепляющего средства. Этот чай помогает улучшить иммунитет, предотвратить онкологические заболевания, быстро вывести из организма токсины и шлаки. Он благотворно влияет на работу печени и почек, избавляет от кашля и температуры при простуде, бодрит и тонизирует, разжижает кровь и тем самым снижает вероятность образования тромбов, нормализует давление.  Также замечено, что Кудин улучшает память, повышает настроение и работоспособность.

В каком возрасте стоит пить Кудин?

Кудин имеет специфический вкус, который не нравится детям. Поэтому в Китае его не предлагают детям до шести лет. Можно приучать старших ребят к Кудину постепенно: давать чайную ложку напитка натощак в качестве общеукрепляющего средства. Постепенно дозировку можно увеличить до 50 мл.

В пожилом возрасте умеренное употребление Кудина весьма полезно. Он помогает затормозить процессы старения, предотвратить развитие атеросклероза, сохранить активность и способность к восприятию нового в течение долгого времени.  Этот чай можно употреблять при повышенном артериальном давлении и рекомендуется при диабете, поскольку Кудин уменьшает количество сахара в крови. Он полезен для работы сердца, а также способствует восстановлению сил у людей, ослабленных после долгой болезни и лечения.

Кому нельзя пить Кудин?

Чай Кудин противопоказан:

  • во время воспаления кишечника, при остром колите;
  • при язве желудка в период её обострения;
  • во время беременности, в период лактации;
  • детям до 6 лет.

Случаи аллергии и индивидуальной непереносимости Кудина пока не зарегистрированы.

Как правильно заваривать Кудин?

Для заварки нужно всего одно «веретено» Кудина или несколько листьев на кружку или маленький чайник (до 500 мл). Если посуда для заваривания имеет большой объём, порцию заварки следует увеличить вдвое. Если не соблюдать дозировку, чай получится горьким из-за высокой концентрации эфирных масел и дубильных веществ, и вы не сможете его пить.

Оптимальная температура заваривания Кудина – 80 градусов и ниже. Заваренная кипятком даже правильная порция даст горький напиток. Особо тонкий вкус и приятное послевкусие у такого чая получаются при заваривании его водой всего 50 градусов. При низких температурах Кудин сохраняет больше полезных веществ, в том числе витамины и калий, полезный для сердечной мышцы.

Время заваривания Кудина – не более половины одной минуты. Первую заварку традиционно выливают, заваривают чай снова и тогда уже пьют. Кудин можно заваривать большое количество раз (7-8 точно), после пятой заварки время настаивания слегка увеличивается. Оптимально пить такой чай 2-3 раза в неделю, этого вполне достаточно для поддержания общего тонуса организма.

Во время простуды можно пить Кудин каждый день 2-3 дня подряд примерно по 0,5 литра, но не стоит делать этого на голодный желудок, чтобы не заболела печень.

Если вы никогда ещё не пробовали Кудин – советуем сделать это. Вы почувствуете себя более лёгким и беззаботным, из тела исчезнут все напряжения и зажимы.

Чай Кудин: 10 самых важных фактов

Содержание:

Кудин (ку дин) – это вовсе не чай, хотя Кудин продается практически в любом чайном магазине. В этой статье мы собрали самые интересные факты об этом напитке.

Факт 1. Чай Кудин — не чай в привычном смысле.

Кудин изготавливают из листьев вечнозеленого субтропического растения под названием Падуб широколистный (llex latifolia). Кудин в переводе с китайского означает «горькая трава».

Факт 2. Откуда чай Кудин родом?

Падуб произрастает преимущественно в южных провинциях Китая, на влажных, тенистых склонах гор, а также в смешанных лесах по берегам рек. Это невысокое, крепкое деревце с толстыми гладкими ветвями и крупными зелёными листьями с глянцеватым блеском. Цветы падуба мелкие, желтоватые. Они образуются в пазухах листьев весной. Ягоды Падуба небольшие, круглые, желтого, оранжевого или красного цвета, созревают осенью и могут сохраняться на дереве всю зиму.

Факт 3. Как использовали Падуб?

Падуб издавна ценился за декоративные и целебные качества. Им украшали дома в Древнем Риме в дохристианскую эпоху, а впоследствии падуб (или остролист) стал, наравне с омелой, символом Рождества. Друиды считали падуб символом солнца, а североамериканские индейцы готовили противоядия из листьев и черенков падуба чайного (Ilex vomitoria).

Факт 4. А как насчет напитка Матэ?

Сырьем для небезызвестного напитка матэ также служит один из видов падуба – падуб парагвайский (Ilex paraguariensis). Матэ готовят из высушенных, измельченных листьев и молодых побегов.

Факт 5. Полезные свойства чая кудин.

История применения кудина как лекарства в Китае насчитывает не одно столетие. Кудин (или кхудин) китайцы относят к горьким чаям, кху ча. Горький вкус в традиционной китайской медицине соотносится с энергией инь, огнем, сердцем и тонким кишечником. Считается, что горький вкус устраняет излишний жар и огонь, применяется для лечения кашля и одышки, при заболеваниях желудка и кишечника, сопровождающихся тошнотой, рвотой и запорами. Также горечь способствует устранению застоя энергии (ци) в организме.

Проще говоря, чай ку дин обладает общеукрепляющим, тонизирующим, жаропонижающим, противовоспалительным, детоксикационным, диуретическим действием. Кроме того, кудин нормализует артериальное давление, углеводный и липидный обмен и способствует похудению, а еще обладает противоопухолевым эффектом.

Факт 6. Собирают кудин только вручную, небольшими партиями, весной. Затем сырье скручивают, прокаливают и сушат на солнце.

Факт 7. Кудин бывает скрученный, спиральный, связанный, листовой и даже прессованный.

Факт 8. Высший сорт чай кудин – Кудин Шуй Сю

производится из мелких молодых листочков, собранных на Желтой горе (Хуан шань) в провинции Сычуань. Этот сорт поставляли к императорскому двору.

Факт 9. Как пить и как заваривать чай Кудин?

Кудин – отличное профилактическое средство, однако пить часто его не стоит, достаточно заваривать 2-3 раза в неделю, но заваривать правильно, чтобы не получить напиток полынной горечи.

Температура воды – 80 градусов, лучше всего заваривать чай ку дин проливом, 1-2 иголочки на гайвань или чайничек. Первую заварку сливать не обязательно, но желательно, настаивать несколько секунд, увеличивая время по мере остывания воды.  

Кудин также можно заваривать в большом чайнике (3-4 иголочки) или в кружке (достаточно 1 иголочки). 

Главное – соблюсти температурный режим и не передержать заварку. 

Цвет готового настоя кудина желтовато-зеленый, аромат тонкий и благородный, во вкусе присутствует горечь и некоторая терпкость, послевкусие неизменно сладкое. Выдерживает многократное заваривание.

Факт 10. К сожалению, чай кудин частенько становится жертвой предубеждения.

Многие, неправильно заварив кудин при первом знакомстве, не желают это знакомство продолжать, а зря: кудин – отличный помощник в борьбе с целым спектром заболеваний, он наполняет тело легкостью, а сознание – ясностью. А еще кудин хорош в качестве добавки к шу пуэру.

Кудин — Чайная Гавань

Общая информация

Входит в категорию Кху Ча что переводится с китайского как горький чай. По сути, имеет мало общего с чаем, так как изготавливается из листьев деревьев семейства падуб. Относится к лекарственным напиткам и служит хорошей добавкой к сильно-ферментированным чаям, особенно хорошо сочетается с шу пуэром. Выращивается и произрастает на юге центральной части Китая в провинции Сычуань.

Легенда и происхождение

В летописях династии Мин есть запись, где говориться о том, что у  императора Чжу Юаньчжана на закате своих лет  случился заворот кишок. Ни придворные медики, ни даоосские лекари не могли помочь несчастному. Тогда главный советник вспомнил, что в городе Чэнду растет необычное растение, отвар, из листьев которого дарует здоровье и молодость.  Но даже оно не помогало. Но один из придворных врачей по имени Лин Наньи смекнул что, изменив пропорцию сухого чайного листа и температуру воды можно совсем по-другому раскрыть растение. Приготовленный Лином отвар был горьким на вкус и не был похож ни на чай, ни на целебные травы, но достаточно быстро поставил императора на ноги. С тех пор горький чай или как говорят китайцы, Кудин стал знаменит на весь Китай и до сих пор активно используется традиционной медициной.

Технология и производство

Сбор проходит круглый год. Из весеннего и осеннего сырья производят молодой кудин Шуй Сю, ферментация его листа минимальна и состоит он только из верхних листочков и почки. Летом и зимой собирают крупные листья, затем после подвяливания и просушки их прожаривают, дабы законсервировать витамины и микроэлементы. Такой кудин как и прессованный чай может храниться годами.

Дегустация

  • Цвет:  настой от светло-зеленого  до темно-желтого.
  • Аромат: яркий травянистый
  • Вкус:  горьковато-сладкий
  •  Послевкусие: сначала чувствуется легкая горчинка, а затем она плавно переходит в сладость.

Эффект и полезные свойства

Китайцы называют кудин чаем от ста болезней, применяя его в сочетании с другими чаями и разнообразными травами, за счет этого усиливая и дополняя полезные свойства.

Сам по себе кудин обладает следующими свойствами:

  • Предотвращает образование тромбов, разжижая кровь.
  • Стимулирует работу сердечно сосудистой системы, укрепляет стенки сосудов
  • Выводит из организма шлаки и токсины
  • Очищает печень, нормализуя липидный и углеродный обмен.
  • Снимает воспаления и обеззараживает.

Кудин является отличным мочегонным и жаропонижающим  и противовирусным средством. Идеален в осеннее — зимний период .

Как заваривать Кудин

Вода подойдет любая, кроме водопроводной. Посуду можно использовать руководствуясь  своими собственными предпочтениями.

Что бы правильно заварить кудин следуем следующей схеме:

  • Воду подогреваем до 70-75 градусов.
  • Посуду прогреваем и ополаскиваем.
  • На объем 200 мл. кладем 1 иглу или 3-5 гр. рассыпного кудина.
  • Споласкиваем уже подготовленной водой.
  • Заливаем и держим 3-5 сек.
  • К пятой заварке время заваривания увеличивается до 15-20 секунд.

Кудин напиток очень специфический и не терпит ошибок. Стоит немного передержать и настой становится горьким. Температуру воды и время настаивания следует подстраивать под свои вкусовые предпочтения.

Приятного и полезного чаепития!


Чай кудин | Все о целебном китайском чае

Кудин был описан в классическом лечебнике «Компендиум лекарственных веществ», написанном китайским учёным Ли Шичжэнем в 1578 году, где он изначально назывался Dong Qing, что означает «вечнозеленое дерево» (dong – «зима», qing – «зеленый»). Такое довольно общее название привело к путанице относительно исходного сырья для чая, в результате чего для его получения стали использоваться две группы растений: падуб (Ilex) и бирючина (Ligustrum). На сегодняшний день 90% китайского Кудина производится из падуба. Его листья имеют удлиненную суженную форму и немного шершавые на ощупь.

ПОЛЕЗНЫЕ СВОЙСТВА

Кудину приписываются весьма впечатляющие полезные свойства. В традиционной китайской медицине он применяется для снятия жара, очищения головы и глаз, выведения токсинов: его используют при обычной простуде, рините, воспалении и покраснении глаз, головной боли.

В дополнение к этому он снимает беспокойство, утоляет жажду, в особенности у страдающих заболеваниями, сопровождающимися жаром и диареей. Чай разжижает мокроту, помогает при кашле, бронхите. Помимо этого он нормализует пищеварение, активизирует мыслительную деятельность, улучшает память.

Современные исследования подтверждают, что данный чай, будь он произведен из падуба или бирючины, улучшает кровообращение, понижает артериальное давление, а также уровень липидов, включая холестерин. Чай зарекомендовал себя как отличное средство для укрепления сердечной мышцы, улучшения мозговой деятельности и поддержания нормального веса. Основными активными компонентами чая являются тритерпеновые гликозиды (сапонины), образующие кудинозиды и кудинлактоны; он также содержит полифенолы и флавоноиды, схожие с теми, что находятся в обычном чае.

АРЕАЛ ОБИТАНИЯ

Основным местом произрастания падуба является Провинция Гуанси на юго-западе Китая. Здесь был обнаружен старейший падуб, возраст которого насчитывает несколько веков, а высота достигает 30 метров. Под посадки падуба в данной местности отведено порядка 14 000 км2.  Ареалом распространения падуба также являются вся южная и центральная части Китая и Вьетнам.

ОСОБЕННОСТИ ВКУСА И ПРИГОТОВЛЕНИЯ

Знакомство с Кудином оставляет необычные ощущения. Чай имеет чистый, горький вкус, который поначалу может показаться неприятным. Однако горечь быстро сменяется сладостью послевкусия. Привыкание ко вкусу этого напитка происходит довольно быстро, и очень скоро он становится таким же привлекательным, как кофе или другие любимые напитки с горьковатым вкусом. Насыщенность вкуса легко регулировать. На чашку 200 мл может быть достаточно 1 чайного листочка. Правильное заваривание данного чая очень важно во избежание получения слишком горького настоя. Чай заваривается водой температурой не выше 80 градусов. Воду для чая ни в коем случае нельзя доводить до активного кипения — кипячение следует прекращать при появлении ниточек пузырьков, поднимающихся вдоль стенок чайника.

Первая заварка не употребляется, выдерживается несколько секунд и сливается. Вторая заварка выдерживается около 1 минуты, а все последующие увеличиваются по времени примерно на 15-20 секунд, так что последняя заварка выдерживается около 3 минут. Кудин, подобно многим зеленым чаям, способен выдержать несколько заварок, а его листья съедобны и обладают той же пользой, что и чайный настой.

Стоит добавить, что данный чай может быть отличным подспорьем не только в лечении ряда упомянутых выше заболеваний, но и при снижении веса. Однако даже с этим чаем вряд ли стоит рассчитывать на ошеломительный результат без правильного питания и регулярных физических нагрузок.

 

 

Использованы материалы статьи «Кудин чай» Субхути Дхармананды, профессора, Директора Института традиционной медицины, Портланд, штат Орегон, США

Полезные свойства чая Кудин | Чайный Блог • THETEA™

Чай кудин – напиток, который готовят из листьев вечнозеленого падуба. Китайцы называют его Кху Ча, горький чай. И с удовольствием пьют в лекарственных целях уже почти две тысячи лет.

В чем секрет пользы – химический состав кудина

Для приготовления кудина используют листья и почки. Побеги сушат, с помощью прессовки придают им форму иголочек примерно 7 сантиметров в длину и обжаривают, чтобы сохранить аромат и пользу.

Кудин богат ценными веществами, содержит:

  • Витамины А, группы В, С, D, E.
  • Антиоксиданты, аминокислоты.
  • Микроэлементы: цинк, калий, фосфор, магний, кальций, железо.
  • Никотиновую и аскорбиновую кислоты.

В Поднебесной чай кудин называют лекарством от 100 болезней. Эффект можно усиливать или ослаблять концентрацией напитка.

Натуральное лекарство

Если вы не приверженец аптечной химии, пейте китайский чай кудин, свойства напитка помогают укрепить и сохранить здоровье.

Основные полезные свойства чая кудин:

  • Нормализует работу сердца, давление, обмен веществ
  • Укрепляет стенки кровеносных сосудов.
  • Предотвращает развитие атеросклероза.
  • Разжижает кровь, препятствуя образованию тромбов.
  • Выводит из организма токсины, очищает почки.
  • Обладает противовоспалительными и антибактериальными свойствами.
  • Укрепляет защитные функции организма, помогает быстрее победить вирусные и простудные заболевания.
  • Снимает жар, лечит кашель.
  • Уравновешивает нервную систему, избавляет от последствий стрессов и переживаний.
  • Улучшает пищеварение, можно пить для аппетита.
  • Облегчает похмелье.

Благодаря мягкому мочегонному эффекту, способности очищать организм от токсинов и нормализации метаболизма можно пить кудин для похудения. Он избавит от отеков, но без риска обезвоживания.

Содержит больше ферментов, чем зеленый чай, копья ку дин по свойствам омоложения бьют рекорды. Замедляют старение клеток, поддерживают ясность ума и остроту зрения, придают бодрость и снимают усталость. Благодаря способности улучшать глазное кровообращение, кудин полезен людям, чья работа связана с компьютером.

Для мужского и женского здоровья тоже полезен кудин чай, свойства настоя уравновешивают гормональный фон, поддерживают сексуальную активность, представительницам слабого пола помогают справиться с недомоганием в период критических дней.

Особенности применения чая кудин

Полезные свойства чая кудин доказаны научно, но есть противопоказания. Горький настой нельзя пить детям до 12 лет. Также напиток противопоказан беременным и кормящим женщинам.

Если вы решили пить кудин для похудения, не увлекайтесь без меры. Стакан отвара в день – максимум, он нормализует обмен веществ, мягко избавит от отеков и начнет ускорять сжигание жиров.

Для омоложения кожи также применяют китайский чай кудин, свойства горького напитка позволяют использовать его наружно. Настой замораживают, чтобы протирать кубиками льда лицо и шею для тонизирующего эффекта. Скраб из соли с добавлением настоя используют как антицеллюлитное средство. 

польза, противопоказания, рецепты для похудения

Китайский чай Кудин, относится скорее к тем напиткам, которые употребляются не как жаждоутоляющие или приносящие удовольствие, а как оздоровительное средство и профилактика от множества заболеваний.

 

Кудин, его особенности

Полезные свойства этого альтернативного чая, который относится сегодня к экстра классу, известны были еще врачевателям древности Китая. Современникам, связанным с наукой, только и надо было выявить, чем так прельщал древних китайцев 2000 лет назад, этот горький по своему вкусу напиток, или «горькая трава». Оказывается, приготовленный по всем правилам древней культуры употребления, он богат витаминами (А, В, РР С, D, Е), микро и макро – элементами, (в составе: сера, калий, кремень и марганец) , флавоноидами, которых, в Кудине содержится в разы больше, чем в традиционном зеленом чае.

Кудин не имеет никакого отношения к чаю. На самом деле, это скрученные листья растения падуба широколистного, а не чайного куста.

Добывают это волшебное сырье из листьев вечнозелёного экзотического приземистого дерева, которое носит название падуб широколистный, а произрастает в Китае повсеместно. Особую ценность, представляют листья, собранные в провинции Сычуань, у подножия Желтой горы. Скорее всего, из-за более экологически чистого состояния этого места или связанного с местами древнекитайской силы. Кудин, считается элитным чаем, имеет терпкие, с горчинкой, вкусовые качества, и за это получивший название « Горькая слеза».

Полезные свойства

Итак, доказано, что чайный напиток , своим уникальным составом, способен оказывать на человеческий организм самым благоприятным способом. Это отличная профилактика и средство помощи при таких заболеваниях как:

  • Простудные;
  • Гипертонические;
  • Заболевания желудочно-кишечного тракта;
  • Сердечно — сосудистые болезни;
  • Различные отравления.

Доказано, что этот, по истине, уникальный напиток, способен улучшить многие процессы, жизненно важные для нормального функционирования организма:

  • Он прекрасное средство для похудения;
  • Способствует повышению иммунитета;
  • Очищает сосуды;
  • Укрепляет память;
  • Снижает холестерин и выводит шлаки;
  • Снижает глюкозу в крови.

Иными словами, чай Кудин, его полезные натуральные, экологические природные свойства, неоценимы как жаропонижающие, мочегонные, бактерицидные, антиоксидантные, противовоспалительные, детоксикационные и жиросжигающие.

Чай Кудин, его противопоказания

Его польза и вред, а также советы врачей по употреблению очевидны: польза неоценимая, а вреда, практически никакого.

Однако, стоит исключить его из рациона беременным и кормящим младенцев грудным молоком женщинам, так как, несмотря на достаточную изученность чая, его влияние на эту группу, не известно до конца. Чтобы исключить возможные негативные реакции, стоит заменить эту разновидность чая, на более традиционные виды чаев.

Имеется одно серьезное противопоказание для Кудин — чая, это наличие хронического гастроэнтерита. Детям, младше 12 лет, также стоит заменить его обычным черным или зеленым. Для остальных групп людей, заваривать и пить этот полезный напиток, рекомендовано.

Советы врачей:

  • Употребляя напиток, вы насыщаете себя витаминным запасом и минералами, важными для организма.
  • Если у вас ослаблен иммунитет, и вы часто простужаетесь, этот бесценный напиток для вас.
  • Употребляя его систематически, вы помогаете себе в профилактике инсультов, тромбообразования, разжижая при этом кровь.
  • При болезнях печени, также показан этот полезный напиток, он чистит ее и улучшает работоспособность.
  • Чай Кудин для похудения, средство неоценимое. Его можно употреблять и в составе диет и отдельно. Прекрасно помогает сбросить лишние килограммы, очищая при этом желудок, кишечник, от вредных веществ, и удаляя шлаки.
  • Не используйте напиток перед сном, так как он отлично бодрит, поднимает тонус и бодрость.
  • Способствует выводу лишней жидкости и снимает воспаления.
  • Ваша память станет лучше, а мозговые процессы улучшатся.

Как правильно заваривать

Китайскими производителями выпускается несколько сортов чая из листьев падуба. Они имеют «возрастные» отличия по сбору листьев. Отличия есть и в методах сырьевой обработки. Самый элитный, производимый из молодых листочков, это чай Сю. Он более нежен и ароматен. Другие известные виды этого сорта чая, производятся в разных видах:

  • Спиральном;
  • Скрученном;
  • Связанном;
  • Прессованном;
  • Листовом;

Любители чая Кудин, отзывы делают в основном исходя из способов заваривания, и делятся мнением в том, напиток их молодых листьев, охотнее и быстрее в отдаче вкуса и крепости. А другие виды, особенно из больших листьев, более старых по возрасту, отдают вкус медленно, и можно совершить заваривание несколько раз.

Метод 1

Использование чистой природной воды из источников, влияет на вкусовые качества напитка. Не стоит заваривать чай Кудин крутым кипятком, это усиливает его природную горечь. Уберите чайник с огня перед завариванием и пусть он чуть постоит.

Первая заварка нужна для удаления с листьев, пыли, для промывки. Вторая заварка, уже настоящая. В сосуд с горячей водой укладывают три-четыре копья Кудина, спирали или веретена, это зависит от способа обработки, и производят кипячение их до десяти минут. После этого, чай готов к употреблению. Следует знать, что чем дольше он заваривается, тем больше горечи во вкусе.

Метод 2

Промывание палочек происходит в холодной воле. Затем происходит заливка кипятком, настаивание в течение пяти, десяти минут и разлитие по чашкам.

Другие способы заваривания и употребления

Для того, чтобы добиться максимального эффекта при различных заболеваниях, заваривать лекарственное растение и пить его следует при соблюдении особых правил:

  • Если у вас гипертония, принимайте чай до еды за полчаса.
  • Для похудения, выпивайте после принятия пищи, через полтора часа.
  • А если у вас сахарный диабет, выпивайте чашку свежезаваренного полезного «зелья» до первого приема пищи.

Необходимо знать, особенно тем, кто никогда не пробовал этот напиток, что заваренный, он обладает ярко выраженной горечью, особенно, после долгого настаивания, к нему привыкнуть, поэтому, далеко не каждому он покажется привлекательным по вкусовым качествам. Как заваривать чай, чтобы не было сильной горечи? Берите меньше сырья, для заварки, не выдерживайте долго, или покупайте только молодой чай, он не так горчит.

Купить Кудин можно в специализированных чайных магазинах, где вам и посоветуют на выбор любой вид и возраст этого бесценного китайского напитка, чем-то напоминающего, хорошо знакомый зеленый, но превосходящего своими целебными качествами!

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение — проблема во всем мире, и ее распространенность быстро растет [1]. Ожирение вызывается накоплением лишних калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4].Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат (орлистат), одобренный FDA для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина.Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при питании диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей, устойчивых к инсулину за счет регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9]. Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей. С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае в качестве напитка более 2000 лет. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл).Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение выполняли на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай). Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Культура клеток

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем в среде дифференцировки (DM), содержащей 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Штат Миссури), и к культуре добавляли 0,8 мМ изобутилметилксантин (IBMX, Sigma, Сент-Луис, штат Миссури). Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Ген Прямой праймер Обратный праймер
β-Актин TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17]. Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда плазмиды экспрессии котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина. Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом делили на разные группы и затем помещали на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK, или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и холестерина LDL (LDL-c) исследовали с использованием автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) с 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на 10 мкм срез в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела). Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (рисунок S1D) идентичен лупеолу (рисунок S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля для транспортных средств. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): ЭК использовалась только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты RT-PCR в реальном времени уровней экспрессии гена в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * P <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванные диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Далее мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * P <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.1, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK. Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее значение ± стандартная ошибка среднего. N = 7 для всех групп. * P <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП или ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты RT-PCR в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPß, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля для транспортных средств. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют как минимум три независимых эксперимента, а данные представлены как средние значения ± стандартная ошибка среднего.* P <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора целевых генов, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27]. Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также подавлялись в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке крови у пациентов с дислипидемией [29], [30] и улучшает артериальное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи. Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что пониженные уровни липидов и масса тела не могут быть связаны со сниженным всасыванием липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак в сыворотке, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется на экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно подавляется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные позволяют предположить, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение — проблема во всем мире, и ее распространенность быстро растет [1]. Ожирение вызывается накоплением лишних калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4]. Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат (орлистат), одобренный FDA для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина. Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при питании диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей, устойчивых к инсулину за счет регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9]. Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей.С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае в качестве напитка более 2000 лет. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл). Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение выполняли на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Культура клеток

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем в среде дифференцировки (DM), содержащей 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Штат Миссури), и к культуре добавляли 0,8 мМ изобутилметилксантин (IBMX, Sigma, Сент-Луис, штат Миссури). Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Ген Прямой праймер Обратный праймер
β-Актин TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17]. Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда плазмиды экспрессии котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина. Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом делили на разные группы и затем помещали на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK, или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и холестерина LDL (LDL-c) исследовали с использованием автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) с 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на 10 мкм срез в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела). Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (рисунок S1D) идентичен лупеолу (рисунок S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля для транспортных средств. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): ЭК использовалась только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты RT-PCR в реальном времени уровней экспрессии гена в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * P <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванные диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Далее мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * P <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.1, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK. Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее значение ± стандартная ошибка среднего. N = 7 для всех групп. * P <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП или ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты RT-PCR в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPß, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля для транспортных средств. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют как минимум три независимых эксперимента, а данные представлены как средние значения ± стандартная ошибка среднего.* P <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора целевых генов, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27]. Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также подавлялись в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке крови у пациентов с дислипидемией [29], [30] и улучшает артериальное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи. Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что пониженные уровни липидов и масса тела не могут быть связаны со сниженным всасыванием липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак в сыворотке, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется на экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно подавляется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные позволяют предположить, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение — проблема во всем мире, и ее распространенность быстро растет [1]. Ожирение вызывается накоплением лишних калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4]. Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат (орлистат), одобренный FDA для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина. Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при питании диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей, устойчивых к инсулину за счет регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9]. Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей.С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае в качестве напитка более 2000 лет. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл). Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение выполняли на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Культура клеток

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем в среде дифференцировки (DM), содержащей 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Штат Миссури), и к культуре добавляли 0,8 мМ изобутилметилксантин (IBMX, Sigma, Сент-Луис, штат Миссури). Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Ген Прямой праймер Обратный праймер
β-Актин TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17]. Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда плазмиды экспрессии котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина. Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом делили на разные группы и затем помещали на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK, или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и холестерина LDL (LDL-c) исследовали с использованием автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) с 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на 10 мкм срез в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела). Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (рисунок S1D) идентичен лупеолу (рисунок S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля для транспортных средств. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): ЭК использовалась только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты RT-PCR в реальном времени уровней экспрессии гена в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * P <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванные диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Далее мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * P <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.1, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK. Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее значение ± стандартная ошибка среднего. N = 7 для всех групп. * P <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП или ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты RT-PCR в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPß, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля для транспортных средств. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют как минимум три независимых эксперимента, а данные представлены как средние значения ± стандартная ошибка среднего.* P <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора целевых генов, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27]. Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также подавлялись в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке крови у пациентов с дислипидемией [29], [30] и улучшает артериальное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи. Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что пониженные уровни липидов и масса тела не могут быть связаны со сниженным всасыванием липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак в сыворотке, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется на экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно подавляется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные позволяют предположить, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение — проблема во всем мире, и ее распространенность быстро растет [1]. Ожирение вызывается накоплением лишних калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4]. Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат (орлистат), одобренный FDA для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина. Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при питании диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей, устойчивых к инсулину за счет регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9]. Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей.С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае в качестве напитка более 2000 лет. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл). Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение выполняли на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Культура клеток

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем в среде дифференцировки (DM), содержащей 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Штат Миссури), и к культуре добавляли 0,8 мМ изобутилметилксантин (IBMX, Sigma, Сент-Луис, штат Миссури). Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Ген Прямой праймер Обратный праймер
β-Актин TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17]. Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда плазмиды экспрессии котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина. Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом делили на разные группы и затем помещали на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK, или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и холестерина LDL (LDL-c) исследовали с использованием автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) с 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на 10 мкм срез в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела). Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (рисунок S1D) идентичен лупеолу (рисунок S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля для транспортных средств. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): ЭК использовалась только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты RT-PCR в реальном времени уровней экспрессии гена в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * P <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванные диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Далее мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * P <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.1, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK. Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее значение ± стандартная ошибка среднего. N = 7 для всех групп. * P <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП или ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты RT-PCR в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPß, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля для транспортных средств. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют как минимум три независимых эксперимента, а данные представлены как средние значения ± стандартная ошибка среднего.* P <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора целевых генов, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27]. Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также подавлялись в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке крови у пациентов с дислипидемией [29], [30] и улучшает артериальное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи. Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что пониженные уровни липидов и масса тела не могут быть связаны со сниженным всасыванием липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак в сыворотке, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется на экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно подавляется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные позволяют предположить, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Чай Кудин (Ku Ding Cha) в китайской медицине

Использование чая кудинг (Ku Ding Cha) в TCM

Обратите внимание, что вы никогда не должны самостоятельно прописывать ингредиенты TCM. Ингредиент традиционной китайской медицины почти никогда не употребляют отдельно, а только как часть формулы, содержащей несколько ингредиентов, действующих вместе. Проконсультируйтесь с профессиональным практикующим специалистом по традиционной китайской медицине, он сможет лучше вас направить.

Приготовление: Листья собрать и удалить загрязнения. Просушите их в тени.

Дозировка: 3-9 граммов

Основные действия согласно TCM *: Очищает ветер-жар и успокаивает дух.Снимает беспокойство и осветляет глаза.

Основные состояния или симптомы, при которых врачи традиционной китайской медицины могут прописать чай кудинг *: Головная боль Зубная боль Нарушение зрения Тиннитус Дизентерия Чрезмерная жажда Простуда Бронхит Беспокойство Конъюнктивит

Противопоказания *: Не подходит для пациентов с дефицитом Инь или Ци.

Ключевые концепции TCM, лежащие в основе свойств чая кудинг (Ку Дин Ча)

В традиционной китайской медицине (ТКМ) чай кудинг — это растения, относящиеся к категории «травы, укрепляющие и успокаивающие дух». Эти травы являются веществами, которые успокаивают разум и лечат такие симптомы, как беспокойство, учащенное сердцебиение, беспокойство или бессонницу. Они, как правило, обладают успокаивающими свойствами, утяжеляя ци вниз, и, как правило, их следует использовать только в течение ограниченного времени.

Кроме того, чай кудинг — это холодные по своей природе растения. Это означает, что чай кудинг обычно помогает людям, у которых слишком много «тепла» в теле. Баланс между Инь и Ян — ключевая концепция здоровья в традиционной китайской медицине. Говорят, что у тех, у кого слишком много тепла в теле, либо избыток Ян (потому что Ян горячий по своей природе), либо недостаток Инь (Инь по природе холоден). В зависимости от вашего состояния чай кудинг может помочь восстановить гармоничный баланс между Инь и Ян.

Чай Кудинг также имеет горький и сладкий вкус.Так называемая теория «пяти фаз» в китайской медицине утверждает, что вкус ингредиентов традиционной китайской медицины является ключевым фактором их действия в организме. Горькие ингредиенты, такие как чай кудинг, как правило, оказывают очищающее действие на организм, очищая от тепла, высушивая сырость и способствуя выведению через мочеиспускание или дефекацию. С другой стороны, сладкие ингредиенты замедляют острые реакции и выводят токсины из организма. Они также обладают тонизирующим действием, поскольку восполняют ци и кровь.

Вкусы ингредиентов в TCM также определяют, на какие органы и меридианы они нацелены.Считается, что такой чай кудинг нацелен на желудок, печень и легкие. В традиционной китайской медицине желудок отвечает за прием и созревание проглоченной пищи и жидкостей. Ему также поручено спускать переваренные элементы вниз в тонкий кишечник. С другой стороны, печень часто называют «общей» тела, потому что она отвечает за регулирование движения ци и жидкостей организма. Он также играет ведущую роль в уравновешивании наших эмоций. Помимо выполнения дыхания, легкие считаются в традиционной китайской медицине ключевой частью производственной цепочки ци и жидкостей организма, которые питают тело.

Исследование чая кудинг (Ку Дин Ча)

Некоторые исследования показывают, что чай Кудинг, полученный из Ilex или Ligustrum, улучшает кровообращение, снижает кровяное давление и снижает уровень липидов в крови, включая холестерин. Также было обнаружено, что чай Кудинг, приготовленный из L. robustum, помимо дополнительных противовоспалительных свойств обладает такими же антиоксидантными эффектами, как и чай. 1

Источники:

1.LAU Kit Man; Его Превосходительство Жендан; ДОНГ Хуэй; FUNG Kwok Pui и BUT Pui Hay Paul, 2002. «Антиоксидантные, противовоспалительные и гепатопротекторные эффекты Ligustrum robustum», журнал этнофармакологии. vol.83 pp.63-71.

Чай Кудинг | Hello Tea Cup

С изменением погоды в нее легко попасть. Сейчас август, но не всегда так. Воспаление, боли в суставах и просто плохое самочувствие. Вместо того, чтобы ходить в местную аптеку и злоупотреблять лекарствами, отпускаемыми без рецепта, может помочь китайский чай Кудинг, известный своими лечебными свойствами.

Чай Кудин использовался в традиционной китайской медицине на протяжении тысячелетий. Он известен своей горькостью, но некоторые пьющие отмечают сладкое послевкусие. В традиционной китайской медицине чай Кудин известен множеством применений. Он популярен при таких заболеваниях, как улучшение памяти и сосредоточение внимания, помощь при простуде, головных болях и синусите, а также при лечении бронхита. Также считается, что чай Кудинг улучшает пищеварение, снижает кровяное давление и снижает уровень холестерина.Это настоящий чай.

При заваривании этого чая рекомендуется использовать только два или три шипа, если это ваш первый опыт употребления чая из-за его сильного горького вкуса. По мере привыкания к чаю обычно бывает 3-5 порций. Используйте горячую, а не кипящую воду — при температуре 80–90 градусов по Цельсию в течение одной минуты. Шипы можно использовать несколько раз — после второго заваривания вам нужно будет увеличить время заваривания.

Хотя нет никаких медицинских доказательств, подтверждающих это, чай Кудин стал популярным средством для похудания.Причина в том, что неизвестно, происходит ли потеря веса из-за жидкости, а не из-за потери жира. Чай Кудин исследуется и разрабатывается в Китае наряду с другими традиционно используемыми и почитаемыми травами, чтобы можно было установить его традиционно известные преимущества.

Что касается употребления, не пейте чай Кудинг, если вы беременны, недавно родили или кормите грудью, во время менструации, имеете низкое кровяное давление. Если у вас возникнут какие-либо побочные симптомы, прекратите употребление чая.Вы всегда должны проконсультироваться с врачом, прежде чем выбирать диету, и, если у вас есть другие лекарства, обязательно спросите своего врача.

Предупреждения в сторону, чай Кудинг может быть отличной вещью в вашей аптечке, особенно в связи со сменой времен года.

Справочники по чаю

Медицинские доказательства пользы для здоровья чая Кудинг (Кудинг Ча)

Что такое Кудинг (также известный как Кудинг Ча)? Официально это не чай, а трава, отличная от чайного растения (камелия китайская).«Ку» означает «горький» на мандаринском диалекте китайского языка, а «Дин» — «игла». Этот травяной напиток был частью китайской диеты в Южном Китае на протяжении 2000 лет. Он популярен в Китае, потому что это безопасное растение для питья без побочных эффектов. Неудивительно, что его еще называют «женьшенем из чаев», «чаем красоты» или «чаем долголетия». Только в последние годы западные исследования также постепенно демонстрируют поддержку преимуществ чая Кудин. Ниже приводится краткое изложение наиболее важных результатов исследований последних лет (основанное на авторитете исследовательских журналов, в которых они опубликованы, и количестве цитирований в других журналах):

Дезодорация и уменьшение неприятного запаха изо рта с помощью Kuding Cha

Один из первых японских исследователей из трех университетов сообщил, что Кудинг Ча помогает уменьшить естественный запах тела в Журнале сельскохозяйственной пищевой химии.Самым важным открытием стало то, что кудинг ча захватывает в организме «газ аллилметилсульфида», который, как известно, сохраняется как зловонный запах изо рта еще долгое время после употребления чеснока!

Чай Kuding уменьшает дискомфорт от употребления сухого молока

Группа исследователей сообщила в Journal of Food Science and Technology, что чай Kuding снижает дискомфорт при употреблении сухого молока. Это открытие более актуально для некоторых азиатов, которые испытывают аллергические реакции при употреблении молочных продуктов.Был сделан вывод, что потребление чая Ku Ding, по-видимому, снижает «перекисное окисление липидов», вызванное сухим молоком у крыс. Поскольку результаты являются многообещающими, будущие исследования должны быть проведены на людях, чтобы подтвердить преимущества.

Потеря веса: экстракт чая Кудинг предотвращает метаболические нарушения

Китайские исследователи недавно сообщили, что потребление Кудинга может предотвратить метаболические нарушения, вызывающие ожирение / избыточный вес.

Добавить комментарий

Ваш адрес email не будет опубликован.