Вред газированных напитков на организм человека: Исследовательский проект «Влияние газированных напитков на организм человека»

Содержание

Влияние газированных напитков на желудочно-кишечный тракт — Информио

Цель исследовательской работы: доказать отрицательное влияние газированных напитков на организм человека через исследование состава и свойств веществ, из которых они состоят.

Задачи, поставленные для реализации исследовательской работы :

  1. изучить историю появления газированных напитков
  2. исследовать свойства основных элементов газированных напитков их влияние на организм человека
  3. изучить действие газированных напитков их влияние на белок животного

Предмет исследования: влияние газированных напитков на организм человека.

Объект исследования: сладкие газированные напитки

Введение.

Проблема чрезмерного употребления газированных напитков актуальна, поскольку напитки эти широко рекламируются по телевидению и в журналах. Человек, особенно ребенок, поддается влиянию красочной, яркой рекламы и с удовольствием покупает и пьет приятный на вкус, бодрящий напиток, который причиняет вред его организму.

Еще Гиппократ говорил: « Человек рождается здоровым, а многие болезни к нему приходят через рот с пищей».

В питьевой воде углекислый газ играет роль консерванта, и, обладая обеззараживающим, дезинфицирующим, антимикробным действием, дает возможность длительно хранить воду. Также, существует мнение, что вода с пузырьками газа утоляет жажду быстрее, нежели негазированная вода.

Напиток из лечебного минерального источника нельзя подвергать никакой специальной обработке, чтобы не уничтожить полезные для здоровья компоненты. Содержащийся в минеральных водах природный углекислый газ в силу своего антимикробного действия позволяет им оставаться чистыми и сохранять свои лечебные свойства, несмотря на возможные загрязнения. Также нередко газирование используют, чтобы избавить напиток от неприятного привкуса.

 

Читать работу полностью (оригинал работы):

Влияние газированных напитков на желудочно-кишечный тракт

как влияют на организм человека. Politeka

В газировке нет витаминов, нет белков, не жиров, но в ней очень много углеводов, за счет них газировка очень калорийная

Как газировка влияет на сердечно-сосудистую систему

Даже если ты пьешь не простую, а диетическую газировку, ты все еще находишься в группе высокого риска сердечно-сосудистых осложнений. Наблюдения Университета Майами (США) за 2 тыс. 564 людьми показало, что люди, которые пили диетические газированные напитки каждый день, на 61% чаще страдали от сердечно-сосудистых проблем.

Таким образом, кардиологи сделали вывод, что не содержащая сахара газировка не может быть оптимальной заменой сладких напитков и так же вредна для сердца. В течение 9 лет обследования было зафиксировано 559 сосудистых событий, в том числе ишемического и геморрагического инсульта, связанного с разрывом ослабленных кровеносных сосудов.

Даже после учета факторов возраста, пола, расы, этнической принадлежности, курения, физической активности, истории хронических болезней, потребления алкоголя и ежедневного количества калорий, частое употребление газировки, даже диетической, приводило к развитию сердечных расстройств. Выбор

диетической газировки это попросту самообман, уверены врачи. Для здорового образа жизни она также вредна, как и перенасыщенная сахаром обычная содовая. Тем, кто хочет вести здоровый образ жизни медики предлагают утолять жажду минеральной водой или зеленым чаем.

Популярные статьи сейчас Показать еще

Что входит в состав газировки

  1. Сахар – в среднем на один стакан напитка приходится около 5 ложек сахара. Если остановится и подумать, то цифра получится большая, учитывая то количество напитков, которые выпиваются в жару. Как результата – появление проблем с зубами (кариеса), лишний вес, а может быть, и сахарный диабет.
  2. Ароматизаторы – все, конечно же, понимают, что никакими ягодами и фруктами не пахло и близко, а на самом деле так пахнут химические соединения.
  3. Углекислый газ на фоне всех прочих факторов, можно сказать, почти безвреден. Неприятные ощущения он принесёт только тем, у кого есть заболевания желудка, он разрушает микрофлору внутри него, а также может приводить к вздутию живота, отрыжке и изжоге.
  4. Лимонная кислота – это самый популярный консервант, который используют все производители. Он разрушает зубную эмаль, а, значит, помогает развиться кариесу. Ещё один консервант – это ортофосфорная кислота, она легко вымывает кальций, который нужен костям.

Вред сладких газированных напитков на организм человека

Газировка при регулярном потреблении приводит к следующим последствиям:

Формирование устойчивости к инсулину

. Быстрый скачок сахара от стакана газировки обеспечен. Это перегружает поджелудочную и провоцирует выброс инсулина. Постоянное ее употребление доказано вдвое увеличивает шанс заболеть диабетом второго типа;

Стимуляция развития ожирения. Повышение процентного содержания жира происходит и из-за высокой калорийности напитков, быстрого подъема инсулина и увеличения аппетита уже через 15-30 минут после ее употребления;

Гастроэнтерологические проблемы. Пузырьки газа приводят к раздражению слизистой, провоцируют развитие метеоризма и увеличивают аппетит. Если выпивать ее на голодный желудок, то в скором времени можно получить букет из гастрита и постоянных проблем с кишечником;

Развитие сосудистых патологий. Постоянное повышение сахара приводит к хрупкости сосудов, а содержание кофеина в таких напитках вызывает спазмирование сосудов различного калибра;

Развитие жировой дистрофии печени. Наблюдения ученых подтверждают, что частое потребление сладкой газировки способно вызывать перерождение клеток печени. Механизм этого перерождения запускается резкими скачками инсулина после питья газированной подслащенной воды. Клетки заполняются жиром и теряют свои функции;

Остеопорозные изменения костей. Некоторые напитки содержат компоненты, вымывающие кальций из костей. Остеопороз в молодом возрасте вполне может спровоцировать регулярное потребление газировки даже в небольших количествах;

Кариес. Обилие сахара и кислот разрушает зубную эмаль, а употребление напитков холодными только усиливает отрицательное воздействие на зубы.

Весть этот список не просто перечисление, это предупреждение об опасности.

Газированные напитки допустимы в рационе, но только как исключение. Постоянное их употребление может оказать только вред. Они не дают ни насыщения, ни необходимой энергии, а высокое содержание сахара от них в крови однозначно вызовет сонливость и повышенный аппетит.

Альтернатива газировке

Вода – самый простой, дешевый и безвредный способ утолить жажду: что в жару теряем, то и восполняем. Попадая в организм, чистая питьевая вода, что называется, быстро идет в дело, позволяя поддерживать жизнедеятельность без лишней нагрузки.

Квас – тоже хорошо, если соблюдены минимум три условия: квас натуральный – хлебный или чайный, свежий и с минимальным количеством сахара.

Зеленый чай, в отличие от черного, не обладает мочегонным эффектом, поэтому им вполне можно утолять жажду. Однако он должен быть некрепким и несладким. Травяной чай в качестве альтернативы не подходит: у всех трав есть противопоказания, к тому же увлечение ими не проходит бесследно для печени.

Если очень хочется именно газировки, ее можно заменить водой, смешанной с соком. Хорошо утоляет жажду и освежает вода с кусочком лимона, огурцом, мятой или голубикой. Такой напиток легко можно приготовить дома. В нем мало калорий, зато много витаминов. В жаркий летний день утолить жажду поможет холодный чай. В него можно добавить пару кубиков льда. Однако злоупотреблять им не стоит – в чае содержится кофеин.

Вместо газировки также можно пить натуральные соки. Причем лучше не из пакетов, а соки-фреш. Для приготовления сока в домашних условиях понадобится блендер или соковыжималка.

Так же не стоит забывать о таких прохладительных напитках, известных нам с детства – компоты и морсы. Для приготовления компота залей водой свежие фрукты или ягоды и провари минут 20-30.

Подумайте, нужно ли вам такое удовольствие от потребления сладких газированных продуктов, которыми вы хотите усложнить свою жизнедеятельность? Не верьте рекламированию специалистами в области маркетологии, сохраняйте состояние своего здоровья и здоровья ваших деток. Существует ряд убедительных аргументов в пользу непризнания газировки, а в её защиту ни одного аргумента, так что все-таки следует целиком отказаться от её потребления.

Научно-исследовательские работы

Разделы
Авторы работ

А Б В Г Д Е Ё Ж З И Й К Л М Н О П Р С Т У Ф Х Ц Ч Ш Щ Ы Э Ю Я

Руководители работ

А Б В Г Д Е Ё Ж З И Й К Л М Н О П Р С Т У Ф Х Ц Ч Ш Щ Ы Э Ю Я

Работы: ВсеИзбранныеВ помощь учителюКонкурс «Учебный проект» Учебный год: Все2015 / 20162014 / 20152013 / 20142012 / 20132011 / 20122010 / 20112009 / 20102008 / 20092007 / 20082006 / 20072005 / 2006 Сортировка: По алфавитуПо новизне

  • Экологическая сказка, главный герой которой — теленок Гаврюша.

  • Данная работа представляет собой газету с рубриками под общим названием «La France culturelle» («Культурная Франция»). В рубриках затронуты вопросы изменения облика современного города и, в частности, преобразование старых зданий внутри и снаружи, развитие сети ресторанов русской кухни в Париже и знакомство с пятью наиболее провокационными французскими фильмами о непростых взаимоотношениях мужчины и женщины.

  • Электронная газета по материалам, выбранным самостоятельно участниками проекта.

  • В нашем классе есть предмет «Основы православной культуры». Вместе с учителем его ведет священник. Это очень интересно. Вы умеете правильно красить яйца на Пасху? А что вы знаете о Святках и Масленице? Я помогу ответить на эти вопросы. Читайте нашу газету, в ней много познавательного.

  • В данной работе рассматривается возможность информирования учащихся по вопросам здорового образа жизни с помощью выпуска газеты «Неболейка». Во введении рассказана необходимость создания газеты. В основной части — результаты анкетирования одноклассников и их родителей по вопросам актуальности и эффективности газеты, а также диагностика возможного влияния газеты на технику чтения учащихся. В заключение представлен план работы издательства на текущий учебный год.

  • Творческий проект экологической направленности выполнен с целью привлечения общественного внимания к проблемам экологии, конкретно, к защите первоцветов. Фотографии и рисунки выполнены на экскурсиях и в походах выходного дня. Тексты подобраны из научно-познавательных книг, энциклопедий и материалов интернета. В текстах также отражено отношение детей к браконьерам и обращение к людям с просьбой сохранить цветы в природе.

  • В работе представлены несколько выпусков газеты, освещающей спортивную жизнь нашей школы.

  • Данная работа в форме заочного путешествия знакомит учащихся с одним из старинных городов Германии — Мюнхеном, а также способствует развитию социокультурной и лингвистической компетенции учащихся 7-8-х классов.

  • Творческая работа представляет собой газету, созданную в программе Microsoft Office Publisher, посвященную новостям из школьной жизни.

  • Работа содержит наблюдения за языком современной прессы, исследуются источники и причины проникновения в язык средств массовой информации жаргонизмов. Использованы разные формы исследования: наблюдение, соцопросы, анкетирование и анализ, результаты которых и отражены в презентации.

  • В работе представлена школьная газета «W.W.W.ЮИД.ru «, которая представляет собой печатное издание. В ней помещена информация о количестве ДТП за 2007 — 2008-й годы, интервью с водителем школьного автобуса, звездные советы водителям и др.

  • Данная работа представляет собой газету на английском языке, которая содержит статьи, написанные студентами нашего техникума. Данные статьи посвящены истории нашего учебного заведения, а также творческим мероприятиям, проводимым в его стенах, планам на будущее и перспективам развития.

  • Данная творческая работа представляет собой газету, созданную в программе Microsoft Office Publisher и посвященную кино.

  • Тема исследования: газетный заголовок как отражение активных процессов в русском языке. Проведен анализ более 1000 заголовков местных газет «Абакан» и «Хакасия», отмечена специфика заголовков, исследованы лексические средства выразительности, дан сравнительный анализ наиболее частых конструкций в обеих газетах. Также подробно рассмотрен прием цитации.

  • Работа посвящена сравнительному анализу популярных газированных напитков (Fanta, Coca-Cola, Sprait, Крем-сода, Лимонад). Представлен литературный обзор по теме исследования, определена популярность газированной воды различных производителей среди учащихся 1-9-х классов на основе социологического опроса. На основании исследования кислотных свойств газированных напитков представлены доказательства их отрицательного влияния на организм человека.

  • Мы очень любим газированную воду, но недавно узнали, она не полезна для человека. И мы решили разобраться, что же скрывается под тонной рекламы и центнером мифов.

  • Газированная вода – вред или польза? Этот вопрос давно интересует детей и их родителей. Данный проект доказывает отрицательное влияние газированных напитков на организм человека через исследование их кислотных свойств на основе изученной литературы, проведённых опытов и анкетирования среди обучающихся и их родителей.

  • Очень часто дети слышат от взрослых о вреде газированной воды, такой, как «Фанта», «Кока — кола», «Спрайт». Авторы решили проверить, так ли это на самом деле, и поставили в классе опыт, о результатах которого рассказано в данной работе. Текст написан занимательным, доступным языком и сопровождается презентацией.

  • В работе определяется степень опасности употребления газированной воды, продающейся в школьном буфете.

  • Данная работа посвящена сравнительному анализу популярных газированных напитков (Fanta, Coca-Cola, «Леда», «Дана», «Фруктайм»). В литературный обзор вошли разделы, посвященные истории возникновения газированных напитков, технологии их производства и влиянию на организм человека. Практическая часть работы включает результаты проведения школьного социологического опроса и анализ некоторых свойств газированных напитков (содержание диоксида углерода, масса сухого вещества, рН и т.д.).

  • В работе отражена тенденция развития российского рынка безалкогольных напитков.

  • Автор исследует химический состав газированных напитков на примере кока-колы. В работе приводятся результаты исследования состава с помощью химического эксперимента. Приводятся также результаты социологического опроса и анализ отношения школьников к потреблению колы и её влиянию на организм.

  • В проекте ученица изучает историю возникновения газированных напитков, их состав, проводит ряд опытов, в результате которых делает выводы о влиянии газированных напитков на организм человека. Также ученица предлагает несколько рецептов приготовления лимонада в домашних условиях.

  • Автор исследует газированные напитки: историю, изготовление, виды, свойства, а также отношение учащихся младших классов к газированным напиткам. Привлечение внимания детей к вредным свойствам газированных напитков делает исследование актуальным.

  • Автор решил узнать, из чего состоят газированные напитки и так ли они вредны для человека, как об этом говорят. В работе исследован химический состав газированных напитков на примере кока-колы. Приведены результаты исследования состава с помощью химического эксперимента, а также результаты социологического опроса и анализ отношения школьников к потреблению кока-колы и её влиянию на организм. Текст написан занимательным доступным языком.

  • Исследовательская работа о значении газированных напитков. Основная задача проекта состоит в том, чтобы изучить состав газированных напитков и убедиться в их отрицательном влиянии на здоровье человека.

  • Мы пьем сладкие газированные напитки, подчас не задумываясь о том вреде, который они могут нанести нашему организму. А вред этот довольно велик, о чем твердят общества по защите прав потребителей во многих странах. Так что же скрывают производители газированных напитков за яркими этикетками и рекламной пропагандой? В работе описана история создания газированных напитков; их классификация и химический состав; физиологическое воздействие основных компонентов газированной воды на организм человека. Проведен эксперимент по исследованию химического состава наиболее употребляемых сладких газированных напитков.

  • Наш организм на 80% состоит из воды. Для поддержания водного равновесия мы пьем каждый день. Кто-то предпочитает кофе, кто-то чай, а дети чаще всего пьют газированную воду. Автор решил узнать: из чего состоят газированные напитки и какое влияние оказывают они на организм человека.

  • Газированные напитки — тема, рассмотренная со всех сторон. Но разные источники дают разную информацию о данном продукте. Мы решили составить своё собственное мнение и поделиться им с остальными. Нами были проведены ряд экспериментов и опрос 228 учащихся. Можно сказать, что умеренное употребление газировки здоровым человеком не может привести к серьёзным последствиям. Но при некоторых заболеваниях (гастрит, фенилкетонурия, аллергия, ожирение и т. д.) газировка может усугубить положение.

  • Последние годы популярность газированных напитков резко возросла. Многие люди пьют их ежедневно, надеясь получить заряд бодрости. Специалисты всерьез обеспокоены состоянием здоровья у постоянных потребителей газировки. Газированные напитки крайне популярны среди детей, подростков, молодежи. Мы предположили, что если больше узнаем о влиянии газированных напитков на наш организм, то сможем для себя сделать правильный выбор: пить газировку или не пить? В работе приводятся интересные сведения о газированных напитках, их пользе и вреде. Изучен состав газированных напитков. Организован конкурс “Рецепты полезных напитков”, приведены рецепты приготовления полезных напитков в домашних условиях.

Исследовательская работа «Газированные напитки и здоровье человека»

    Муниципальное бюджетное образовательное учреждение

    «Средняя общеобразовательная школа № 4» г. Черногорска

    ИССЛЕДОВАТЕЛЬСКАЯ РАБОТА

    Тема: Газированные напитки и здоровье человека

    Автор:

    Земцева Лариса Алексеевна

    ученица 7б класса

    МБОУ «СОШ № 4» г. Черногорска

    Руководитель:

    Манина Ольга Борисовна

    учитель химии

    г. Черногорск 2015г

    Содержание

     

    Введение

    3

    Глава1.

    Газированные напитки

    4

    1.1

    Влияние газированных напитков на здоровье

    5

    1. 2

    Что привлекает в газированных напитках

    6

    Глава 2

       

    2.1

    Социологический опрос

    6

    2.2

    Интервьюирование

    8

    Глава 3

    Химический анализ газированных напитков

     

    3.1

    Анализ газированных напитков по этикетке

    9

    3.2

    Химический анализ

     

    3. 2.1

    Определение наличия красителей в составе газированных напитков

    9

    3.2.2.

    Определение наличия углекислого газа в газированных напитках

    10

    3.2.3.

    Определение кислотности газированных напитков

    11

    3.2.4.

    Определение влияния красителей газированных напитков

    яичную скорлупу

    12

    3.2.5.

    Определение влияния кислотной среды газированных напитков на известняк

    13

    3. 2.6.

      Определение влияния кислотной среды газированных напитков на жиры

    14

     

    Заключение

    15

     

    Библиографический список

    16

     

    Приложение

    17

     

    Введение

    Лимонад имеет благородное французское происхождение (от limonade, что означает «прохладительный напиток») и обязан своим появлением ошибке придворного виночерпия короля Людовика I, который, преподнося монарху бокал с вином, перепутал бочонки с вином и соком.

    По дороге к королевскому столу, обнаружив свою ошибку, виночерпий добавил в сок минеральную воду и, мысленно прощаясь с жизнью, подал новый напиток королю. Напиток пришелся его величеству по вкусу, и с тех пор его стали именовать «королевским лимонадом». [4]

    Актуальность Современный человек живет совсем не так, как жили наши деды и прадеды. Ритм жизни изменился. Мы все куда-то спешим, в школу, на работу. Все заняты, на приготовление домашней пищи не хватает времени, и поэтому пища, которую мы едим, тоже изменилась. Мы чаще стали есть еду быстрого приготовления. Быстро, вкусно, красиво. В последние годы возросла популярность и газированных напитков. Реклама продуктов питания и популярных газированных напитков также влияет на наш выбор в их пользу. Мне, как и моим друзьям, нравятся газировки, их сладкий вкус, приятный аромат, разнообразные цвета, яркие этикетки. Из-за этого я часто спорю с бабушкой, которая считает, что употребление этих напитков наносит вред моему здоровью. Мне захотелось разобраться в этом вопросе и я решила опытным путем узнать, кто из нас прав.

    Цель работы: исследовать состав не которых газированных напитков и их возможное влияние на здоровье человека.

    Задачи:

    Изучить информацию о составе и свойствах газированных напитков в интернете и в научно-популярной литературе.

    Изучить состав газированных напитков по этикетке и опытным путем установить наличие в них вредных веществ.

    Провести анкетирование среди учащихся и предложить рекомендации по употреблению газированных напитков.

      Методы исследования:

      1.поиск информации в Интернете и в специальной литературе,

      2. интервьюирование,

      3. практическая работа по изучению составных компонентов газированных напитков

      Объект исследования: газированная вода серии «Лимонад» различных производителей

      Предмет исследования: состав газированных напитков .

      Практическая значимость: изучив состав газированных напитков серии «Лимонад» можно будет установить, как они влияют на здоровье и дать рекомендации для учащихся и родителей.

      Сроки эксперимента: октябрь 2014 г.- март 2015г.

      Гипотеза: в состав газированных напитков могут входить различные вещества, которые могут отрицательно влиять на здоровье человека, нарушать микрофлору кишечника, вызывать заболевания желудка, разрушать эмаль зубов.


       

      Глава 1. Газированные напитки

      1.1. Химический состав газированных напитков

      Углекислый газ. Хорошо растворим в воде. Используется в качестве консерванта. На упаковке продукта он обозначается Е 290. Сам по себе он безвреден. Но его присутствие в воде возбуждает желудочную секрецию, повышает кислотность желудочного сока и провоцирует метеоризм – обильное выделение газов.

      Сахар. Содержится почти во всех газированных водах, в очень больших количествах. От 3,5 до 6 кусочков сахара на стакан. Утоляя жажду на несколько минут, такая очень сладкая вода заставляет человека пить гораздо больше, чем нужно. Поэтому такой водой напиться невозможно. И еще, сахар, содержащийся в воде может разрушать зубы.

      Аспартам. Подсластитель Е-951 – аспартам — генетически модифицированный нейротоксин, применяется как искусственный заменитель сахара. Аспартам примерно в 200 раз слаще сахара, но по сравнению с ним не содержит углеводов и калорий. Некоторые исследователи отмечают химическую нестабильность аспартама. По их словам, после нескольких недель в жарком климате или при нагреве до 300С основное количество аспартама в газированной воде распадается на формальдегид, метанол, фенилаланин и другие вещества. Ученые заявили, что аспартам может вызывать рак почек и периферических нервов. Безусловным признаком наличия аспартама является предупреждение: «Содержит фенилаланин» или если на упаковке упоминается фенилкетонурия – врожденное нарушение обмена фенилаланина в организме, приводящее к умственной отсталости. [2]

      Бензоат натрия. Консервант Е-211 бензоат натрия, бензойную кислоту Е-210 и бензоат калия Е-212 вводят в напитки в качестве бактерицидного и противогрибкового средств, что позволяет увеличить срок хранения пищевых продуктов в несколько раз. Продукты, содержащие бензоаты натрия и кальция, не рекомендуется употреблять астматикам и людям, чувствительным к аспирину. В сочетании с витамином С он выделяет бензол, который является канцерогеном.

      Лимонная кислота Е-330– добавляется чаще всего в газированные напитки, приводит к раздражению слизистой оболочки желудка, это может привести к развитию гастрита.

      Ортофосфорная кислота Е-338 способствует вымыванию кальция из костей, недостаток кальция может стать причиной развития остеопороза. . Если напиток прошел все уровни сертификации, то, скорее всего уровень содержания кислоты не превышает допустимого и не представляет опасности.

      Кофеин. Он относиться к мягким стимуляторам нервной системы. Дети, потребляющие много кофеина, более беспокойны, плохо засыпают, часто страдают от головных болей. У них может нарушаться способность концентрировать внимание. Кофеин вызывает зависимость.

      Красители используют с тем, чтобы вид напитка был более красив и вызывал желание его купить и выпить. Красители, используемые в напитках, бывают натуральными и искусственными. Наиболее распространенным из натуральных красителей является сахарный колер E-150, то есть жженый сахар. Искусственные красители – это химические вещества с определенными, далеко не полезными свойствами. С особой осторожностью нужно относиться к тем красителям, которые содержат азот (Е-102, Е-110, Е-123, Е-124, Е-133, Е-151).

      Ароматизаторы. Это то самое, что заставляет нас поверить в то, что мы пьем что-то апельсиновое, яблочное, вишневое, грушевое. В большинстве своем ароматизаторы являются искусственными химическими веществами, хотя выпускаются напитки и на растительном сырье.

      Итак, вся ценность газированного напитка, который выпускается под десятками торговых марок, заключается в воде и углекислом газе, а вся привлекательность – в ароматизаторе и красителе. [1]

      1.2. Влияние компонентов газированных напитков на здоровье.

      Наиболее серьезными последствиями регулярного и частого употребления газированных напитков являются заболевания органов пищеварения; ожирение, сахарный диабет и кариес; мочекислый диатез и мочекаменная болезнь; аллергия. Дошкольникам и детям, страдающим любым видом гастритов, гастродуоденитом, имеющим предрасположенность к сахарному диабету или мочекаменной болезни, употребление газированных напитков абсолютно противопоказано. Категорически нельзя пить газировку натощак. Лучше заменить ее молочными продуктами, натуральными соками. Сахар и другие химические вещества, входящие в их состав, «обманывают» мозг, доставляя ему удовольствие, лишенное пользы. Лишний сахар сжигает дополнительное количество витаминов группы В и приводит к ожирению и диабету. Но не это главное, ведь сладких продуктов много. Сладкие шипучки содержат лимонную, яблочную или ортофосфорную кислоту, которая повреждает слизистую оболочку желудочно-кишечного тракта, а также постепенно растворяет эмаль зубов, вымывая из нее кальций. Такие же процессы происходят в костях. Поэтому длительное регулярное употребление сладких газированных напитков может стимулировать развитие остеопороза. Большинство газированных напитков, к сожалению, жажду не утоляет, а, наоборот, возбуждает. Это связано с тем, что все они содержат либо очень большое количество сахара (от 10 до 15 г на 100 мл), либо его заменителей (аспартам, цикламат, сахарин). И сахар, и пищевые добавки — подсластители оставляют приторное послевкусие, которое приходится запивать снова и снова. Если ребенок часто пьет газировку, значительно повышается нагрузка на поджелудочную железу, что впоследствии может привести к такому заболеванию, как сахарный диабет. Кроме сладких добавок во многие шипучие напитки входит кофеин (около 10 мг на 100 мл) и хинин, а также лимонная кислота (Е 330) и ортофосфорная кислота (Е 338). Соли фосфора, содержащиеся в газировке, образуют нерастворимые и совершенно неусвояемые соединения с кальцием, которые быстро выводятся из организма. Это неблагоприятно сказывается на формировании костной ткани ребенка. Недостаток кальция может проявляться также повышенной возбудимостью, бессонницей, раздражительностью, болезненностью десен, замедлением роста. Во всех газированных напитках обязательно присутствуют консерванты, бензоат натрия (Е 211) или сорбит калия (Е 202), а также красители и ароматизаторы. Все эти вещества, а также сами газы, оказывают неблагоприятное воздействие на слизистую оболочку всего пищеварительного тракта. Содержащиеся в окрашенных сладких газированных напитках красители, консерванты, ароматизаторы и прочие добавки также негативно влияют на здоровье ребенка. Помимо аллергических реакций, они могут приводить к так называемому «синдрому гиперактивности и пониженного внимания». Детям с таким синдромом труднее учиться. Таким образом, понятно, что газированные напитки, если их очень часто употреблять, могут оказывать негативное воздействие на здоровье. Поэтому небольшие меры предосторожности не помешают. [ 3]

       

      Глава 2. Что привлекает в газированных напитках.

      2.1. Социологический опрос среди учащихся

      по выяснению информированности о газированных напитках. В опросе принимали участие учащиеся классов 3а, 6 а,7б, 8б(70 человек) Были предложены следующие вопросы и варианты ответов:

      1. Употребляешь ли ты сладкие газированные напитки?

      а) да б) нет

      2.Если да, то как часто?

      а) каждый день б) раз в неделю в) очень редко

      3Какие газированные напитки ты пьешь чаще всего?

      4.Газированные напитки ты употребляешь потому, что:

      а) вкусно

      б) хочется пить

      в) показывают рекламу

      г) другое

      5. Знаешь ли ты, что газированные напитки могут причинить вред твоему здоровью?

      а) да  б) нет в) затрудняюсь ответить

      6. Смущает ли тебя цвет газированного напитка?

      а) да б) нет в) затрудняюсь ответить

       

      Результаты опроса:

      Большинство учащихся (92%), участвующих в опросе любят газированные напитки, 47% пьют её каждый день.

      53% опрошенных учащихся, знают об опасности употребления газированных напитков от родителей, учителей, из средств массовой информации, но не придают этой информации большого значения и поэтому употребляют газированные напитки.

      наибольшее предпочтение отдают лимонаду (32%). На выбор напитка оказывают влияние реклама (60%). Многих( 55 %) не смущает яркий цвет напитка, а только привлекает.

      2.2. Интервьюирование

      В беседе с продавцом магазина « Татьянин дом», Людмилой Ивановной я узнала, что в магазине большой ассортимент газированных напитков. Наибольшим спросом пользуется лимонад разных производителей, но чаще покупают лимонад «НАпитки МИнусинска»

       

      Глава 3. Химический анализ газированных напитков

      3.1 Анализ газированных напитков по этикетке

      Прежде чем понять, вредны ли газированные напитки, выясним, что за вещества в них содержатся. Я взяла этикетки наиболее популярного напитка среди опрошенных учащихся «Лимонад» Для чистоты эксперимента были взяты 5 образцов серии «Лимонад» разных производителей.(Фото № 1). В ходе анализа этикеток газированных напитков получили следующие данные (Приложение №1 таблица №1)

      Оказалось, что в состав напитков входят: углекислый газ, лимонная и ортофосфорная кислоты, искусственные вкусовые добавки, ароматизаторы, красители, которые могут являться причиной серьезных заболеваний.

      Фото № 1 Образцы газированных напитков.

      3.2.Химический анализ

      3.2.1. Определение наличия красителей в газированных напитках .

      Материалы для исследования:

      Газированные напитки (по 50 мл) Уголь активированный (по 0,5 г)

      Время исследования: 30 минут

      Ход работы: в химические стаканы налила по 50 мл исследуемого газированного напитка и добавила в каждый по 0,5 г активированного угля, тщательно перемешала. оставила на 30 минут, взбалтывала содержимое стаканчика через каждые 5 минут(фото №3). После этого отфильтровала уголь. По интенсивности окраски визуально определила степень адсорбции (фото №4)

      Фото № 2 Определение красителей в образцах

      Результат: В ходе эксперимента мы получили следующие данные в таблице №2

      Таблица №2

      Определение наличия красителей в газированных напитках

      Название напитка

      Время

      Результат

      Лимонад

      30 минут

      Полная адсорбция

      Лимонад «Напитки Минусинска»

      30 минут

      Полная адсорбция

      Лимонад «Диво»

      30 минут

      Полная адсорбция

      Лимонад

      30 минут

      Полная адсорбция

      Лимонад «Аян»

      30 минут

      Полная адсорбция

      Вывод: Таким образом, можно доказать, что в состав исследуемых напитков входят красители. Красители, входящие в состав газированных напитков, являются искусственными, так как хорошо адсорбируются в отличие от натуральных компонентов. Данные красители могут изменять окраску зубов.

      Фото № 3 Результат адсорбции

      3.2.2. Определение в газированных напитках углекислого газа СО2»

      Материалы для исследования:

      Газированные напитки

      Известковая вода

      Ход работы: С помощью мерного цилиндра налила в пробирки по 10 мл исследуемого напитка, закрыла пробкой с газоотводной трубкой и укрепила в штативе В другие пробирки налила известковую воду Са(ОН)2 и погрузила в нее конец газоотводной трубки, осторожно нагрела(фото№4 ). Наблюдала за изменениями (фото№5)

      Результат: Известковая вода помутнела в каждом из предложенных образцов (фото № 6

      Фото№4 Нагрев

      фото №5  Выделение углекислого газа

      Фото № 6 Результат эксперимента  

      Вывод: Значит в каждом исследуемом напитке присутствует угольная кислота, которая разлагается с выделением СО2, присутствие которого доказали помутнением Са(ОН)2. Присутствие большого количества углекислого газа может вызывать в организме метеоризм и расстройство кишечного тракта.

       

      «Определение кислотности газированных напитков ( рН раствора)

      Материалы для исследования:

      Газированные напитки

      Универсальная индикаторная бумага

      Ход работы: Банки с напитками открыла непосредственно перед опытом, налила в стаканчики по 10 мл, затем во все образцы добавила индикаторную бумагу и наблюдала за ее окрашиванием.(фото №7)

      Фото № 7 Определение кислотности газированных напитков

      Результат: Во всех исследуемых образцах универсальный индикатор стал розового цвета, отмечена повышенная кислотность(Таблица № 3).

      Таблица №3

      Таблица №3 Определение кислотности газированных напитков

      Напиток

      рН

      Среда раствора

       

      Лимонад

      4

      Кислая

      Лимонад «Напитки Минусинска»

      4

      Кислая

      Лимонад «Диво»

      5

      Кислая

      Лимонад

      3

      Кислая

      Лимонад «Аян»

      4

      Кислая

      Вывод: Изменение окраски индикатора подтверждает то, что во всех образцах присутствуют в качестве добавок кислоты. Значит, это позволяет предположить, что данные напитки, имея высокую кислотность своих растворов, могут пагубно влиять на желудочно-кишечный тракт человека.

      3.2.4. Влияние красителей, входящих в состав газированных напитков, на яичную скорлупу.

      Материалы для исследования:

      Газированные напитки

      Яичная скорлупа

      Время исследования: 30 минут

      Ход работы:

      а) В стаканчики с образцами газированных напитков поместила яичную скорлупу и оставила на 30 минут. Наблюдала за изменением окраски скорлупы и ее разрушением.( фото№ 8). Данные представлены в таблице №4

      Фото № 8 Обнаружение красителей в газированных напитках

      Таблица №4

      Влияние красителей, входящих в состав газированных напитков, на яичную скорлупу

      Напиток

      Окрашивание скорлупы

      Лимонад «С новым годом»

      Скорлупа окрасилась незначительно

      Лимонад «Напитки Минусинска»

      Скорлупа окрасилась по краям

      Лимонад «Диво»

      Скорлупа окрасилась более интенсивно

      Лимонад

      Скорлупа окрасилась незначительно

      Лимонад «Аян»

      Скорлупа окрасилась незначительно

      Яичная скорлупа окрашивается в растворах уже через 30 минут.

      Вывод: Изменение окраски яичной скорлупы подтверждает присутствие в исследуемых напитках красителей. Окрашивание скорлупы показывает, что зубы также могут окрашиваться при употреблении этих напитков.

       

      Влияние кислой среды растворов газированных напитков на известняк

      Материалы для исследования:

      Газированные напитки

      Известняк

      Ход работы: В стаканчики с образцами напитков поместить кусочки СаСО3. ( фото № 9 )

      Фото № 9 Влияние растворов газированных напитков на известняк

      Результат: наблюдается выделение газа и растворение карбоната кальция.

      Вывод: Полученные результаты подтверждают присутствие в составе исследуемых напитков кислот, которые могут разрушающе действовать на эмаль зубов и костную систему организма.

      3.2.6. «Влияние кислой среды газированных напитков на жиры.

      Материал для исследования:

      Газированные напитки

      Животный жир

      Ход работы:

      В стаканчики с образцами напитков поместить по небольшому кусочку свиного сала и оставить при комнатной температуре на 2 суток. ( фото 10 ) (таблица №5)

      Фото №10 Влияние газированных напитков на жиры.

      Таблица №5

      Влияние кислой среды газированных напитков на жиры

      Напитки

      Результат

      Лимонад

      Окрашивание слабое

      Лимонад «Напитки Минусинска»

      Окрашивание слабое

      Лимонад «Диво»

      Окрашивание сильное

      Лимонад

      Окрашивание слабое

      Лимонад «Аян»

      Окрашивание слабое

      Вывод: Вещества, содержащиеся в напитке Лимонад «Диво», разрушающе действуют на органические вещества, в частности на жиры, следовательно, также могут оказывать вредное воздействие и на организм человека, если употреблять этот напиток

       

      Заключение

      Итак, изучив состав и некоторые свойства газированных напитков, и проанализировав результаты социологического опроса, можно сделать следующие выводы:

      учащиеся при выборе газированных напитков ориентируются на органолептические свойства (вкус, аромат, цвет), стоимость и меньше всего на содержание этикетки.

      все исследуемые напитки содержат большое количество углекислого газа;

      все исследуемые напитки обладают повышенной кислотностью растворов;

      все исследуемые напитки содержат искусственные красители

      ( особенно Лимонад «Диво») и ароматизаторы;

      Предлагаемые производителями напитки за счет содержания в них вредных добавок, могут являться причиной серьезных заболеваний, поэтому прежде чем употреблять напиток, следует обратить внимание на состав.

      Цель работы достигнута. Моя гипотеза получила подтверждение.

       

      Рекомендации по выбору безопасных напитков:

      1. Необходимо внимательно читать этикетку.

      2. Лучше выбирать напитки неярких естественных цветов – больше шансов на применение естественного красителя.

      3. Напитки, содержащие сахар, безусловно предпочтительнее напитков на подсластителях. Особенно не рекомендуется употребление подсластителей при беременности, повышенном артериальном давлении, фенилкетонурии.

      4. Напитки с подсластителями не рекомендуется хранить без холодильника и уж тем более нагревать.

      5. Ни в коем случае не следует употреблять напитки с истекшим сроком годности.

       

      Перспективный план работы

      С выводами по результатам исследовательской работы я планирую ознакомить учащихся школы. Я думаю, что они в дальнейшем будут более внимательны к тому, что употребляют в качестве напитков. Я считаю, что моя работа будет интересна не только учащимся, но и их родителям, потому, что бережное отношение к своему здоровью необходимо формировать, начиная именно с детского возраста. Тогда забота о собственном здоровье в дальнейшем станет естественной формой поведения. А иначе мы все по-прежнему будем употреблять не то, что необходимо организму, а то, что нам предлагают наиболее успешные рекламодатели.

      Планирую в дальнейшем изучение энергетических напитков.

      Библиографический список

      Ресурсы интернета:

      1. http://ufa-filter.ru/a51298-gazirovannye-napitki-vred.html

      2.http://ecomagazin.com.ua/article/healthy_eating/28.html

      3.http://pohydey.ucoz.ru/news/pravda_o_polze_i_vrede_gazirovannykh_napitkovhttp://www.sekrety-o-ede.ru/news/2019.html

      4. http://eda73.ru/articles/detail.php?

      Приложение №1

      Таблица №1

      Анализ газированных напитков по этикетке

      Параметры сравнения

      Образец №1

      Лимонад

      Образец №2

      Лимонад

      НАпитки МИнусинска

      Образец №3

      Лимонад «Диво»

      Образец №4

      Лимонад»Ледяная жемчужина»

      Образец №5

      Лимонад

      Предприятие изготовитель

      Бочкарёвский пивоваренный завод

      ООО» Минусинский пивоваренный завод»

      ООО» Томское пиво»

      ОАО»Нарзан»

      ОАО «АЯН»

      Адрес предприятия изготовителя

      Алтайский край, Целинский район, с. Бочкари. Ул Молодёжная 1а.

      Красноярский край. Минусинск. Ул. Ленина 38.

      Г. Томск

      Россия, Ставропольский край, г. Кисловодск, ул. Кирова.43.

      Г. Абакан, ул. Советская 207.

      Состав

      Вода, сахар, регулятор кислотности пищевая лимонная кислота, ароматизаторы, краситель сахарный колер, консервант бензоат натрия.

      Вода, сахар, ароматизатор,идентичный натуральному»»Композиция для купажа напитка «Лимонад»,

      кислота лимонная, сахарный колер, подсластитель «Свит 100», консервант натрия бензоат.

      Вода. Сахар, углекислота, регулятор кислотности -лимонная кислота, натуральные и идентичные натуральным ароматизаторы, консервант натрия бензоат.

      Вода. Сахар,

      Сок концентрированный яблочный, регулятор кислотности -лимонная кислота,натуральный ароматизатор «Лимон, натуральный краситель карамель, антиокислительаскорбиновая кислота, консервант натрия бензоат

      Вода, сахар,идентичный натуральному ароматизатор композиция «Лимонад», регулятор кислотности кислота лимонная пищевая, натуральный краситель сахарный колер

      Пищевая ценность (в 100г продукта):

      Углеводы10, 5г/см3

      Углеводы – 7.

      углеводы10.2г

      Углеводы 10,3г.

      Углеводы 10,2г

      Энергетическая ценность (в100г продукта)

      180/42кДж/ ккал

      71,3 ккал

      160 кДж/39,0 ккал

      41,2 ккал

      170 кДж/39 ккал

      Срок хранения

      90 суток

      90 суток

      180 суток

      12 месяцев.

      35 суток

      Дополнительные сведения

      ГОСТ 28188-89

      ГОСТ 28188-89

         

      ГОСТ 28188-89

      Масса

      1. 5 л

      1.5л

      1.5

      0,5

      0,5

      Чем вред газированной воды. Полезна ли минеральная газированная вода для здоровья человека

      Многие знают, что практически 70 процентов человеческого организма состоит из воды. Но каждый поддерживает этот водный баланс исключительно по-своему. Кто-то предпочитает каждый день выпивать несколько чашек какао, кофе или чая, а кому-то интересней поглощать прохладное пиво, сок или газированную воду.

      Однако стоит отметить, что от качества ежедневно потребляемой воды зависит не только хорошая работа отдельных органов, но и состояние всего организма.

      Принято считать, что самым разрушающим напитком является сладкая газированная вода, которую очень любят периодически выпивать не только взрослые люди, но и совсем маленькие дети. Чем же вредны газированные напитки, почему о них так много отрицательных отзывов?

      Четыре причины, почему не стоит пить газированную воду


      Причина первая – быстрый набор веса. Наверняка многие не раз видели телевизионную рекламу, где стройные девушки описывают замечательный и превосходный вкус шипучей воды. Но это всего лишь рекламный ход, который завлекает потенциальных потребителей. Ведь на самом деле газировка очень сильно и достаточно быстро влияет на стройность человека. А происходит это по той причине, что производители добавляют в свою продукцию огромное количество сахара.

      Для того чтобы осмыслить масштабность такой добавки, необходимо всего лишь представить себе небольшую бутылочку с водой (0,3 литра) и мысленно всыпать в нее шестнадцать ложек чистого сахара. Стоит отметить, что это количество на порядок превышает дневную норму человека.

      Причина вторая – огромный риск для возникновения диабета. Во время разового приема газированной воды поджелудочная железа моментально выделяет инсулин, и сахар тут же попадает в кровь. При таких частых стрессовых ситуациях в организме человека полностью нарушается обмен веществ, возникает резистентность к инсулину, и в итоге у него начинает развиваться сахарный диабет.

      Причина третья – наличие химических добавок. Для того чтобы наконец-то понять, чем вредны газированные напитки, достаточно лишь провести опыт и продержать в этой жидкости органические предметы, которые по истечении некоторого времени начнут полностью разрушаться.

      Как известно, практически все сладкие газировки содержат в себе так называемые соли сернистой кислоты, провоцирующие головные боли, заболевания щитовидки, печени, а также вызывающие рак легочных тканей. Кроме этого, данный напиток включает в свой состав такие дополнительные компоненты, как бензоат натрия, фосфорную кислоту, аспартам и красители. Данные элементы с легкостью могут вызвать существенные проблемы с зубами и костями, опухоль мозга, эпилепсию, бронхиальную астму и множество аллергических реакций.

      Причина четвертая – повышенная концентрация кофеина. Всем известно, что газированные напитки достаточно сильно повышают физическую активность человека. Для этого в них добавляют не только много сахара, но и огромное количество кофеина. После употребления такого напитка, в организме тут же повышается кровяное давление, зрачки значительно расширяются, а уровень гормона допамина начинает зашкаливать. Все эти факторы способствуют тому, что в дальнейшем у человека развивается гипертония, повышается уровень холестерина, появляются проблемы с сосудами и сердцем, а также бессонница.

      Стоит также отметить, что газированные напитки бывают не только сладкие, но и насыщенные минералами. Как правило, подобная вода продается исключительно для лечения и профилактики органов пищеварения. Хотя использовать такую минералку желательно без дополнительного газирования, так как это может повлиять на развитие хронических заболеваний желудка и кишечника, а также поспособствовать частому и мучительному метеоризму.

      Вы любите гулять на свежем воздухе?

      Это так круто, иногда прогуляться и подышать свежим воздухом.

      Часто гуляя, мы видим людей разных возрастов с бутылочками сладких газированных напитков или просто соков.

      Это и любители побегать, и погулять просто, и мамы с колясками.

      И хотя вред сладких газированных напитков уже давно известен, люди все еще думают, что это хорошая замена простой воды. Или, как думают спортсмены, хороший источник глюкозы и углеводов, если она цветная и сладкая …

      Многие все еще не совсем знакомы с полным списком побочных эффектов и разрушений, которые могут нанести в наших организмах эти напитки.

      Мы здесь, чтобы изменить Ваше мнение.

      Нет, мы не в коем случае не хотим Вас запугать, мы хотим Вам помочь… У каждого своя жизнь и каждый воспринимает информацию по своему.

      В самом деле, если регулярно употреблять эти газированные напитки и соки, Вы можете наткнуться на полный набор самых нежелательных заболеваний в вашей жизни — большинство из которых являются следствием ранней смерти.

      Это не должно удивлять, если я скажу, что сахар является основным ингредиентом этих вредных напитков. Именно поэтому и поднята сегодня вся эта шумиха …

      Давайте попробуем разобраться в этой теме …

      Вред сладких газированных напитков на организм человека

      1. Газированные напитки приводят к ожирению внутренних органов

      Если вы потребляете избыток сахара в виде сладких напитков, есть высокая вероятность того, что это приведет к лишнему жиру на вашем теле.

      Это не говорит о появлении жира, что собирает на бедрах, ягодицах и боках (в виде подкожного жира), хотя и это может быть.

      Это говорит о появлении висцерального жира. Это вид жира, который скапливается вокруг жизненно важных органов, таких как печень, почки, кишечник и желудок, и связан с сахарным диабетом 2 типа и другими воспалительными заболеваниями.

      Все продукты защиты от старения на рынке предполагают, что люди не хотят стареть даже естественно, то есть сохранить молодое тело как можно дольше, не так ли? Кажется любой согласится с этим мнением.

      Но, продолжая пить сладкие газированные напитки этот процесс мы можем только ускорить.

      В состав привычных для нас сладких газированных напитков входит большое количество глюкозы и фруктозы.

      Когда напиток попадает в организм человека, поджелудочная железа активизируется в связи с большим поступлением сахара, начинает вырабатывать инсулин в больших количествах, а данный процесс приводит к скачку уровня сахара в крови.

      Что происходит в нашем организме после того, как он получил очередную дозу газировки? Давайте остановимся на этом подробнее.

      1. Вы выпили напиток. Через 20 минут после этого в крови значительно повышается уровень сахара, в результате чего вырабатывается много инсулина. Печень в свою очередь реагирует на вышеперечисленные процессы, превращая большое количество сахара в жир.
      2. Через 40 минут после того, как вы выпили напиток, полностью всасывается в кровь содержащийся в нем кофеин. По этой причине расширяются зрачки, повышается артериальное давление, печень начинает выбрасывать в кровь сахар.
      3. Через 45 минут после принятия напитка, в кровь выбрасывается допамин, гормон, стимулирующий в мозге центр удовольствия.
      4. Уже через час уровень сахара в крови резко падает, а это вызывает желание опять употребить газировку.

      Если пить сладкие напитки регулярно, уровень инсулина будет постоянно повышаться, это приведет к резистентности к инсулину , нарушении уровня , а это в свою очередь может вызвать множество заболеваний от диабета до рака. Кроме того, регулярное употребление газировки способствует формированию ожирения.

      4. Газированная вода приводит к болезням сердца

      Болезни сердца, также известны как сердечно-сосудистые заболевания или заболевания сердца и кровеносных сосудов. Эти болезни является убийцами номер один практически во всем мире.

      Кажется любой из Вас желает жить дольше не заглядывая в аптеки, не так ли?..

      Как уже упоминалось выше, потребление газированных напитков может привести диабету.

      В одной из наших статей, мы писали о вреде сахара для здоровья. А так как газированные напитки переполнены им, то действие их близко к действию сахара на наш организм.

      Сладкие напитки могут увеличить риск развития болезни Альцгеймера! …

      Заменитель сахара аспартам (E-951) — компонент, входящий в состав некоторых продуктов и газированных напитков, возможно, наиболее спорный из всех веществ. Его изготовители и государственные органы утверждают, что он безопасен, но ряд учёных и некоторые факты подтверждают, что это не совсем так.

      Что характерно: исследование в защиту или против аспартама, похоже, тесно увязано с тем, кто это исследование оплачивал.

      Интересный факт в том, что 100 % исследований, финансированных промышленностью, пришли к выводу, что аспартам безопасен. В то время как 92 % независимо финансируемых исследований и отчётов определили, что аспартам является потенциальным источником вредных эффектов.

      Если Вы поклонник кока-колы, пепси, или любого другого напитка, Вы должны это услышать.

      Кстати, Вы любите своих детей?

      А вспомните тогда сейчас, сколько газированных напитков Вы ставите на стол вместе с большим количеством других, не самых здоровых, сладостей.

      Сахар вызывает высвобождение гормона в головном мозге, который заставляет нас чувствовать себя хорошо. Наверное, Вы знаете какого-нибудь сладкоежку, так? Знайте, что он практически наркоман …

      Но как пишет журнал Woman , данные исследований по-настоящему пугают: ученые все чаще сравнивают любителей сахара с наркоманами, предостерегая — сладости не только дарят мимолетное удовольствие, но и вызывают привыкание, в конечном счете обращая Ваше здоровье в руины.

      Это именно тоже самое, как привыкание к кокаину!

      10. Газированные напитки уничтожат ваши зубы


      Наверное, Вам уже известно, что ортофосфорная кислота, которая содержится в сладких газированных напитках, мешает усвоению кальция и может привести к остеопорозу — это кошмар для ваших зубов, а не только для костей.

      Но меня недавно поразило еще одно открытие.

      По данным сети клиник Москвы Startsmile , китайские ученые выяснили, что газированные напитки, даже не содержащие сахара, вызывают стоматологические заболевания. Все заверения, что диетическая газировка не портит эмаль, – всего лишь рекламный трюк.

      Доктор Чу Чун-хун, заместитель профессора семейной стоматологии из Гонконгского университета, и его коллеги недавно провели исследование среди учащихся младших классов и обнаружили, что зубы большинства из них подвержены эрозии, а также другим серьезным стоматологическим заболеваниям.

      Среди шестисот школьников в возрасте двенадцати лет почти у 75% были обнаружены зачатки эрозии. У каждого пятого ребенка нашли кариозные повреждения, половина из которых были не пролечены. Также для исследователей стало открытием то, что девочки больше подвержены кариесу, чем мальчики.

      По словам специалистов, эрозия и кариес у школьников образовались из-за постоянного употребления продуктов с высоким содержанием кислоты. Родители детей подтвердили догадку ученых, сообщив, что примерно 20% детей довольно часто употребляют газировку и фруктовые соки.

      Наверное это должно стать Вам и Вашим детям примером или уроком — пить газировку вредно!

      11. Газированные напитки приводят к бесплодию


      Итак вы узнали об 11, как показалось, самых страшных фактах о вреде газированных напитков.

      А теперь я предлагаю вам отойти от вашей привычки пить эти вредные напитки и снизить риск негативных побочных эффектов.

      Вот несколько советов…

      Изменить свою привычку. Возможно Вы любитель прогуляться во время работы до ближайшего автомата с этими напитками или забегаловки, где их продают? Если это так, измените свой маршрут. Даже не смотрите на него, чтобы избежать искушения и минуйте свои регулярные точки покупки.

      Замените свой любимый напиток. Попробуйте заменить газировку на другой напиток, который не содержит сахара или искусственных подсластителей. Например, попробуйте травяной чай (мята, мелиса и другие травы), воду с полезнейшим соком () или стакан домашнего молока, чтобы утолить свою жажду.

      Знайте свою цель. Назначьте день, когда вы не будете пить эти напитки. Поставьте себе цель: , набрать мышечную массу, излечиться от болезней и другие.

      Ну и в добавок…

      Вот рецепты

      Полезных детокс-напитков, соков и смузи, которые помогут вам избавиться от этой дурной привычки покупать и пить эти вредные, сладкие, газированные напитки:

      Вывод

      Кока-кола, Пепси и другие известные производители постоянно хотят улучшить качество своих напитков. Они работают в этом направлении уже давно.

      Но, но все равно ученые каждый год находят доказательства их вредности.

      Если статья была вам интересной, пожалуйста, поделитесь ею с другими!

      Знаете ли в ы еще какие-либо негативные последствия или способы отойти от этой плохой привычки? Поделитесь своим опытом, оставив комментарий ниже!

      Ежедневное употребление жидкости необходимо для человека, как воздух и еда. Но употреблять обычную воду никто не хочет и заменяет ее чаем, кофе, соками, компотами и газированной водой. И если простая чистая воды восполняет нехватку жидкости, то лимонад, наоборот, может нанести существенный вред здоровью и вызвать необратимые реакции.

      О том, какой вред газированных напитков на организм человека , сказано уже немало, диетологи и сторонники здорового образа жизни повсеместно напоминают о влиянии газированных лимонадов, приводят примеры последствий, но люди как употребляли ее, так и продолжают пить вместо обычной воды. Сладкая вода с газом стала излюбленным напитком всех поколений, а колючие пузырьки углекислого газа в ней еще никого не оставили равнодушными. При этом часто можно увидеть, как молодые мамы дают ее даже детям, не задумываясь о составе газировки. Что же приносит газированная вода: пользу или вред? Можно ли давать ее детям? И в каких количествах лимонад можно употреблять взрослым?

      Состав всех газированных лимонадов, представленных сегодня в наших супермаркетах и магазинах, примерно одинаковый, и основной их компонент – вода. При добавлении в воду только углекислого газа получается напиток, который хорошо утоляет жажду, освежает и при этом он вкуснее простой воды.

      Важно! В норме содержание углекислого газа в таком напитке воде не должно превышать 10 г на 1 л.

      Углекислый газ в составе минеральной воды нужен для того, чтобы сохранить ее свойства и придать ей стойкость к бактериям. При этом углекислый газ считается наименее вредным консервантом. Но к лимонадам производители в целях экономической выгоды добавляют различные компоненты, которые не утоляют жажду и не восполняют нехватку жидкости в организме, а только усиливают желание попить.

      К ним относятся:

      • сахар или подсластители;
      • консерванты и пищевые кислоты, которые продлевают срок годности товара;
      • красители, усилители вкуса и ароматизаторы;
      • иногда кофеин.

      В совокупности эти ингредиенты стимулируют вкусовые ощущения и вызывают ложное ощущение утоления жажды. Но наиболее опасным в сладких напитках и лимонаде считается то, что их компоненты повышают выработку в мозгу нейронов удовольствия, как у наркоманов и алкоголиков. А это может спровоцировать развитие привыкания к такой воде. Чтобы нейтрализовать негативное воздействие лимонада, необходимо выпить много чистой не газированной и не минеральной воды.

      Чем же опасны компоненты газированной воды?

      Рассмотрим подробнее, какие основные ингредиенты лимонадов и сладкой воды с газом и как они воздействуют на нас, и определим, в чем вред лимонада для здоровья человека.

      Сахар

      Сахар – это легкоусвояемый углевод, опасность которого для здоровья заключается в его количестве – 1 стакан сладкого лимонада содержит до 5 столовых ложек сахара! А если учесть, что во время жары можно выпить не один литр такой жидкости, то в итоге получается серьезная цифра. Конечно, кто-то может сказать, что сахар – это же глюкоза, которая повышает умственную деятельность, работоспособность и является источником энергии, не понимая, что он быстро превращается в жир и оседает на боках, бедрах и животе.

      Обратите внимание: К тому же сахар вызывает кариес, заболевания органов сердечно-сосудистой системы и даже развитие атеросклероза. А большое количество глюкозы в крови приводит к повышенной выработке гормона инсулин, который ответственный за ее переработку, к нарушению функциональности поджелудочной железы и провоцирует развитие сахарного диабета и ожирения.

      Сегодня многие производители в стремлении снизить количество глюкозы в своей продукции перешли на производство лимонадов без сахара и используют при этом сахарозаменители – синтетические вещества, которые тоже не безобидны для здоровья.

      Сахарозаменители:

      • способствуют образованию камней в почках;
      • негативно влияют на зрение;
      • могут вызывать аллергию в различных ее проявлениях: от зуда до отека Квинке.

      Но общее свойство всех сахарозаменителей – это то, что они являются канцерогенами и могут вызвать развитие раковых заболеваний.

      Кислоты и консерванты

      При производстве лимонадов и сладких напитков принято использовать лимонную и ортофосфорную кислоты (Е330 и Е338 соответственно), которые выступают в качестве консервантов и усилителей вкуса, помогая производителям воссоздавать вкусы, идентичные натуральным. Но Е338 в сладком напитке после употребления вымывает кальций, что вызывает нарушения в здоровье и развитие даже у молодых людей остеопороза. А при регулярном поступлении лимонной кислоты Е330 растворяется эмаль зубов, что приводит к развитию кариеса. Кроме того она вызывает гастрит, мочекаменную болезнь и почечные колики.

      Внимание! Самым опасным осложнением из-за приема лимонада в больших количествах считается разрушение кальция, что приводит к хрупкости костей и их длительному срастанию. Порой недостача кальция приводит к инвалидности.

      Для длительного срока годности напитка и сохранения вкуса лимонада используется бензоат натрия (Е211), который превращается в токсичный бензол. Этот элемент приводит к мутациям в клетках и увеличивает риск возникновения онкологического заболевания.

      Кофеин

      Данное вещество содержится в энергетических напитках. Кофеин придает энергию, повышает работоспособность человека, делая его активным и бодрым. Но подвох в том, что бодрость быстро пропадает, а на ее месте появляется раздражение, апатия, заторможенность, сонливость и быстрая утомляемость. Очередная порция способна исправить ситуацию, но ненадолго. И как результат, употребление кофеиносодержащего напитка вызывает не только непоправимый урон для здоровья человека, но и стойкое привыкание, и превращается в зависимость.

      Углекислый газ

      Без углекислого газа газировка или лимонад не будут таковыми. Именно за шипение и острые пузырьки газа, которые бьют в нос и пощипывают язык, так и любят газированные напитки и дети, и взрослые. Сам по себе газ безвреден, но опасен для желудка и всего желудочно-кишечного тракта. Углекислота, которая содержится в газе, высвобождается во время химической реакции с водой и раздражает слизистую оболочку органов ЖКТ, что приводит к обострениям язвенных болезней, энтеритов и гастритов.

      Каковы последствия употребления газировки?

      Сладкие напитки и лимонад с углекислым газом и прочими добавками – это продукты синтетического происхождения, которые не несут никакой пищевой ценности для здоровья. Основной вред, что наносит лимонад с газом, заключен в действии углекислоты и сахара, присутствующих в составе этого напитка.

      Они могут вызвать:

      • повышенное газообразование, отрыжку и болезненное вздутие живота;
      • нарушение работы эндокринной системы;
      • повышение производства инсулина;
      • развитие сахарного диабета;
      • нарушения в работе печени;
      • обезвоживание организма.

      Поэтому чаще всего любители сладкой воды страдают от избыточного веса или даже ожирения, имеют проблемы со здоровьем и психические нарушения. Это связано с тем, что поступление в организм большого количества «быстрых» углеводов приводит к тому, что они оседают в виде жира.

      А калории, которые входят в состав сладкой воды с газом, не оказывают никакого влияния на чувство голода – оно даже после большого объема выпитой газировки остается тем же. Поэтому человек начинает потреблять гораздо больше пищи с высокой энергетической ценностью, чем это необходимо его организму.

      Помните! Сладкие газированные напитки не способны утолить жажду, а только вызывают ее и усиливают, и в результате человек выпивает большее ее количество. Поэтому все калории и углеводы, содержащиеся в такой воде, со временем откладываются на талии и бедрах.

      Противопоказания к газировке

      Несмотря на все предостережения диетологов о негативном воздействии лимонадов на здоровье, большинство людей все же продолжают пить сладкие напитки с газом, причем в неограниченных количествах.

      Но есть такие группы людей, которым они абсолютно противопоказаны. Это:

      • страдающие хроническими заболеваниями пищеварительной системы;
      • дети до 3-х лет;
      • беременные и кормящие женщины;
      • люди с ожирением и диабетом;
      • худеющие;
      • аллергики и астматики;
      • страдающие от гормональных нарушений.

      Особенно противопоказан лимонад тем, у кого часто случаются гингивиты, стоматиты и другие «зубные» болезни. Но если вы не относитесь ни к одной из этих групп людей, кому противопоказано употребление сладкого лимонада с газом, это не значит, что вы можете регулярно ее пить. Ведь даже незначительные реакции организма, такие как метеоризм, вздутие живота, изжога, частая отрыжка и бурление, свидетельствуют о негативном его воздействии и становятся поводом задуматься: так ли не безопасна эта сладкая вода для моего здоровья? Определить заранее, какая будет реакция организма на употребление газированных напитков, невозможно. Она зависит от общего состояния организма, наличия хронических патологий и наследственной предрасположенности.

      А есть ли польза?

      Сколько бы не делали докладов и сколько бы не приводили примеров о вреде лимонадов с газом, такая вода может быть даже полезной. Все зависит от содержимого бутылки. Так, если в состав сладкой газированной воды входят натуральные компоненты или экстракты лекарственных трав, то такой напиток будет оказывать только положительное влияние на организм. Например, «Дюшес» и «Тархун», в составе которых имеется эстрагон – эффективное натуральное средство, которое оказывает сосудосуживающее действие и улучшает работу органов пищеварительной системы. В состав газированных вод «Саяны» и «Байкал» входит экстракт левзея – растения, которое известно своим свойством тонизировать организм и снимать усталость, повышать мышечную активность и нормализовать работу нервной системы. Такие воды можно пить даже при сахарном диабете.

      После того как мы определили, какая польза и вред сладкой газировки, давайте разберемся, как уменьшить ее вред на организм, не ограничивать себя и иногда баловать сладкой газировкой без вреда для здоровья.

      Для этого достаточно:

      • позволять не больше 0,5 литра газировки в день и не чаще раза в неделю;
      • выбирать газировку в стеклянной таре, а не в алюминиевых банках или пластике;
      • пить напиток через соломинку или предварительно выпустив газ;
      • перейти на простую воду, компоты, морсы или натуральный квас.

      Говоря о том, какой вред наносят газированные напитки нашему организму, нельзя забывать, что они, как и любой другой синтетический продукт, при регулярном и чрезмерном употреблении могут повлиять на общее самочувствие человека и заметно снизить его иммунитет. Однозначного ответа на вопрос, приносит газированная вода организму вред или пользу, не существует. Но при выборе такого напитка следует обращать внимание на его происхождение: природное или синтетическое, на количество сахара в нем и срок годности. И, главное, не покупать ежедневно газировку и не употреблять в качестве основного источника питья. Тогда существенного вреда от сладких газированных напитков не будет.

      Полки магазинов буквально изобилуют всевозможными напитками, в частности газированными. Они привлекают внимание не только своими разноцветными бутылками и яркими этикетками, но и разнообразием вкусов. Основными потребителями газировки являются дети, особенно в жаркое время года. Такие напитки на первый взгляд вкусные и сладкие, их хочется пить ещё и ещё. Однако газировка очень вредна и имеет целое множество противопоказаний, особенно для организма детей. О том, какой негативный эффект производят такие напитки, написано немало работ. Диетологи и врачи в один голос твердят о необходимости исключить их из рациона как бесполезный и крайне вредный продукт.

      Наверняка многие слышали, что, к примеру, «Кола» или «Спрайт» отлично удаляют ржавчину и известковый налет. А некоторые даже самостоятельно проводили подобные эксперименты дома или использовали такую воду вместо бытовой химии. Поэтому стоит разобраться, чем вредны газированные напитки для организма, и задуматься перед тем, как самому их пить или предлагать своему ребёнку.

      Состав газировки

      Чтобы понять пользу того или иного продукта, нужно просто прочитать этикетку и посмотреть состав. Как правило, газировка содержит ароматизатор, вкусовые добавки, консерванты, красители, углекислый газ и, собственно, воду. Существует очень небольшой процент напитков, в составе которых находятся натуральные ингредиенты. Они отличаются по цене, зато и польза для человека в них определённо есть. Основной вред газированных напитков заключается в содержащемся в них количестве сахара. В 2-х л такой воды его около 40 столовых ложек. Зачастую, особенно в жаркую погоду, получается выпить и не одну бутылку такой воды. Можно только представить, сколько лишних калорий попадает в организм человека только за счёт газировки! Кроме того, благодаря своему насыщенному вкусу она ещё больше провоцирует жажду.

      Производители пытаются решить эту проблему с помощью сахарозаменителей:

      • сахарина;
      • сорбидола;
      • ксилита;
      • аспартама и прочих.

      Однако это отнюдь не решает проблему вредности газированных напитков, а в некоторых случаях только усугубляет её. Заменители приводят к развитию всевозможных серьёзных заболеваний.

      Также в состав газированных напитков входит кислота (яблочная, ортофосфорная или лимонная), которая является консервантом и дополняет вкус. В некоторых случаях в них добавляют и кофеин.

      Различные вкусы и цвета обеспечивают напиткам всевозможные красители и ароматизаторы. Не стоит рассчитывать, что они сделаны из натуральных продуктов, фруктов и ягод. Обычно это добавки химического происхождения, а, соответственно, никакой пользы для человека они не несут.

      Вред напитков

      Газировка крайне вредна как детям, так и взрослым. Это объясняется целым рядом различных факторов. Из-за большого содержания сахара она провоцирует усиленную выработку инсулина, что в свою очередь значительно увеличивает вероятность возникновения диабета даже у ребёнка. Кроме того, постоянное употребление газировки способствует повышению веса и развитию ожирения. Людям, предрасположенным к таким заболеваниям, категорически нельзя пить подобные напитки. Некоторые дабы уменьшить калорийность и количество поступающего в организм сахара, отдают предпочтение газировке с заменителями, однако это тоже не совсем безопасно. Подобные вещества, несмотря на все заверения производителей, отнюдь не являются полезными и безвредными. Они приводят к появлению камней в почках, потере зрения, а также являются канцерогенами и при постоянном поступлении в организм приводят к возникновению и развитию онкозаболеваний.

      Также в совокупности с кислотами сахар негативно влияет на зубную эмаль, разрушая её и приводя к появлению кариеса. Кроме этого, напиток провоцирует быстрое вымывание из организма кальция, что приводит к хрупкости костей и частым переломам. Особенно это опасно для детей, которым он необходим для развития опорно-двигательного аппарата. Нехватка способна привести к серьёзным нарушениям и патологиям. Также это небезопасно для людей преклонного возраста, у которых со временем усвояемость затрудняется, а газировка ещё и провоцирует его вымывание.

      Ароматизаторы и красители, как химические вещества, накапливаясь при систематическом поступлении в человеческий организм и вступая в реакцию с другими ингредиентами напитка, могут превращаться в токсины. Кофеин, который добавляют в различные виды газировки, провоцирует привыкание. Если сначала он вызывает прилив бодрости, то со временем его избыток приводит к раздражительности, агрессии и быстрой утомляемости. Особенно это заметно на детях, которые, употребляя такие напитки постоянно, начинают страдать от бессонницы и напряжения психики. Кроме всего прочего, попадая в организм, разные вещества, которые содержатся в газировке, могут вызвать аллергические реакции.

      Углекислый газ сам по себе не вреден, он работает в качестве консерванта. Однако, попадая в организм человека, у которого есть какие-либо нарушения в ЖКТ, он может нанести вред. Газированные напитки категорически нельзя тем людям, у кого диагностированы гастрит, язвенная болезнь, проблемы с кишечником, метеоризм и т. п. Да и для полностью здорового человека употребление такой воды чревато нарушением в пищеварении.

      Польза газированной воды

      Как ни странно, но у газировки есть и польза. Это больше касается именно воды, а не напитков с огромным количеством сахара и красителями. Существует множество её лечебных видов, которые назначаются при всевозможных заболеваниях. Такая вода не только оказывает целебное действие на организм при употреблении во внутрь. С ней также часто принимают ванны, благотворно влияющие на кожу. После данных процедур тело омолаживается, насыщается кислородом и полезными веществами, а также улучшается цвет и рельеф кожи. Такие ванны оказывают общий укрепляющий и расслабляющий эффект на организм, снимая нервное напряжение и борясь с бессонницей.

      Правообладатель иллюстрации Getty

      Часто можно услышать предупреждения о вреде чрезмерного употребления простой газированной воды — якобы она оказывает негативное воздействие на желудок, кости и зубы. Так ли это на самом деле? – решила разобраться корреспондент .

      Всем известно, что постоянное потребление сладких газированных напитков вредно для здоровья — сочетание высокого содержания сахара с повышенной кислотностью оказывает отрицательное влияние на организм.

      Если оставить на ночь монетку в стакане с колой, наутро она окажется чистой и блестящей. Причиной тому содержащаяся в напитке фосфорная кислота, которая растворяет налет окиси, покрывающий монету.

      Так что полезнее пить простую воду. Но у обычной воды нет ярко выраженного вкуса, поэтому многие для разнообразия периодически пьют газированную.

      Однако существует мнение, что простая газированная вода тоже вредна. Так ли это на самом деле?

      Начнем с желудка. Газированной воду делает добавление двуокиси углерода (углекислоты) под давлением. Фактически вода превращается в раствор углекислоты.

      Если выпить стакан такой воды залпом, то в некоторых случаях за этим могут последовать приступ икоты или несварение.

      Ну а если пить медленнее и размереннее? Неужели и тогда простая газированная вода негативно воздействует на желудок?

      Правообладатель иллюстрации Getty Image caption Есть мнение, что любой газированный напиток — даже простая газированная вода — может нанести вред здоровью

      Оказывается, как раз наоборот. В рамках одного рандомизированного двойного слепого исследования, проведенного в начале 2000 гг., пациентов, страдающих диспепсией или запорами, попросили в течение 15 дней пить простую воду.

      Одна группа пила газированную, другая — негазированную. Затем участников обследовали.

      Выяснилось, что у пивших газированную воду состояние улучшилось, а у контрольной группы — осталось без изменений.

      Потребление простой газированной воды в больших количествах может привести к вспучиванию, однако японские исследователи пришли к заключению, что у этого побочного эффекта имеется и положительная сторона.

      В проведенном недавно эксперименте группа женщин ничего не ела с вечера, а наутро им давали медленно выпить стакан либо негазированной, либо газированной воды.

      Обнаружилось, что при выпивании всего 250 мл воды в желудке образуется 900 мл газа. Неудивительно, что женщины испытывали чувство сытости, хотя на самом деле ничего не ели.

      При этом дискомфорта участницы эксперимента не чувствовали. Поэтому простую газированную воду теперь рекомендуют в качестве средства от переедания.

      Вредно для костей?

      При обезвоживании, вызванном расстройством желудка, сильной рвотой или банальным похмельем, некоторые люди дают газированной воде постоять перед употреблением, чтобы из нее вышел газ.

      Однако ученые, опробовавшие этот метод на группе детей с острым гастроэнтеритом, не обнаружили доказательств тому, что он действен.

      Кроме того, выяснилось, что, по сравнению с регидрирующими растворами, предназначенными для восполнения содержания солей и сахара в организме, обычная газированная вода с вышедшим из нее газом содержит гораздо меньше необходимых организму натрия и калия.

      Ну хорошо, если даже газированная вода не вредит желудку, то, возможно, она делает кости более хрупкими?

      Правообладатель иллюстрации Getty Image caption Не исключено, что фосфорная кислота каким-то образом блокирует впитывание кальция костной тканью

      Научных данных, однозначно подтверждающих это утверждение, не имеется.

      Согласно результатам канадского исследования, опубликованным в 2001 г., у подростков, потребляющих сладкие газированные напитки (не обычную воду) в больших количествах, действительно наблюдается пониженное содержание кальция в костных тканях, но исследователи не до конца уверены, являются ли причиной сами напитки, или тот факт, что подростки, пьющие их постоянно, при этом не пьют молоко.

      В 1948 г. в американском штате Массачусетс началось так называемое Фрамингемское исследование сердца — за большой группой жителей городка Фрамингема (в нескольких поколениях — исследование продолжается до сих пор) в течение многих лет велось медицинское наблюдение с целью выявить факторы риска, приводящие к развитию сердечных заболеваний.

      Теперь же потомки некоторых из этих испытуемых принимают участие в Фрамингемском исследовании остеопороза, проводимом бостонским Университетом Тафтса.

      В рамках этого исследования свыше 2500 участников каждые четыре года проходят всестороннее обследование. В числе целей обследования 2006 г. было изучение связи между плотностью костной ткани и потреблением газированных напитков.

      Ученые проанализировали различные виды напитков, которые регулярно пьют испытуемые.

      Они пришли к выводу, что у женщин (но не у мужчин), пьющих колу три раза в неделю, средняя плотность минералов в костях таза ниже, чем у тех, кто не употребляет колу так часто.

      Правообладатель иллюстрации Getty Image caption Разрушающий эффект сладких газированных напитков на зубную эмаль проявляется с течением времени

      Влияния потребления иных видов газированных напитков на состав костной ткани выявлено не было. Авторы исследования выдвинули гипотезу, согласно которой причиной снижения плотности минералов могут являться кофеин и фосфорная кислота (ни того, ни другого простая газированная вода не содержит), механизм действия которых на кости еще не до конца понят.

      Не исключено, что фосфорная кислота каким-то образом блокирует впитывание кальция костной тканью, но как именно это происходит, никто пока не знает.

      Спустя 10 лет после объявления об этом открытии все еще продолжаются споры о том, в какой мере рацион человека может влиять на состояние его костей.

      Так что, по всей вероятности, никакого негативного влияния на кости и желудок простая газированная вода не оказывает. А на зубы?

      Казалось бы, любая кислота, пусть даже в слабой концентрации, должна разрушать зубную эмаль. Однако это необязательно так.

      Влияние простой газированной воды на зубы очень мало изучено, но данных по другим газированным напиткам собрано уже предостаточно.

      В 2007 г. Барри Оуэнс из стоматологического колледжа Теннессийского университета в Мемфисе провел сравнительное исследование разных видов газированных напитков.

      Выяснилось, что наибольшей кислотностью отличаются напитки, основанные на коле. За ними следуют диетические колы, а замыкают список кофейные напитки.

      Кумулятивный эффект

      Оуэнс подчеркивает, что здесь важен не изначальный кислотно-щелочной баланс напитка, а то, насколько он сохраняет кислотность в присутствии других веществ, поскольку в реальности во рту присутствует слюна, а также другие продукты питания, которые могут повлиять на уровень кислотности.

      Способность раствора сохранять кислотно-щелочной баланс связана с его так называемой буферной емкостью.

      Если пить через соломинку, напиток сразу попадает в заднюю часть рта, и его воздействие на зубы оказывается минимальным

      Наибольшей буферной емкостью обладают колы (это значит, что у них и наибольшая кислотность), далее следуют их диетические версии, затем фруктовые газированные напитки, фруктовые соки и, наконец, кофе.

      Иными словами, некоторые из газированных напитков действительно могут причинить вред зубной эмали.

      Пунам Джайн из стоматологической школы университета Южного Иллинойса поместила осколки зубной эмали в сосуды с различными газированными напитками на 6, 24 и 48 часов и обнаружила, что эмаль действительно начинает разрушаться.

      Можно придраться к чистоте этого эксперимента, ведь в реальной жизни никто не держит напиток во рту так долго.

      Но если зубы подвергаются воздействию напитков в течение многих лет, пусть каждый глоток и занимает всего несколько секунд, последствия могут оказаться такими же.

      Передние зубы молодого человека частично разрушились после того, как он четыре года подряд выпивал каждый день по поллитра колы, а затем — в течение еще трех лет — по полтора литра в день, плюс некоторое количество фруктового сока.

      Правообладатель иллюстрации Getty Image caption Исследователи выяснили, что кислотность газированной воды составляет всего 1% от кислотности сахаросодержащих газированных напитков

      Впрочем, многое зависит от того, как именно пить. Данный пациент, помимо того, что нерегулярно чистил зубы, еще и «задерживал каждую порцию напитка во рту на несколько секунд, наслаждаясь его вкусом, прежде чем проглотить».

      Шведские исследователи сравнили пять разных способов употребления напитков — залпом, медленными глотками и через соломинку. Выяснилось, что чем дольше напиток задерживается во рту, тем более существенно увеличивается кислотность среды в ротовой полости.

      А вот если пить через соломинку, напиток сразу попадает в заднюю часть рта, и его воздействие на зубы оказывается минимальным.

      Так как же насчет простой газированной воды?

      Катриона Браун из Бирмингемского университета провела эксперимент, поместив удаленные человеческие зубы без признаков кариеса на 30 минут в сосуды с разными видами ароматизированной газированной воды.

      Каждый зуб был предварительно покрыт лаком, за исключением небольшого участка диаметром с полсантиметра.

      Обнаружилось, что напитки оказывали на зубы не меньшее, а в некоторых случаях и большее, разрушительное воздействие, чем апельсиновый сок, который, как уже установлено, размягчает зубную эмаль.

      Способность простой газированной воды к разрушению зубов в 100 раз ниже, чем у некоторых других видов газированных напитков

      Наиболее кислотными оказались газированные воды со вкусом лимона, лайма и грейпфрута — вероятно, потому, что в качестве ароматизатора в них используется лимонная кислота.

      Таким образом, ароматизированные газированные воды вовсе не так же безвредны для зубов, как обычная вода. Можно ли сказать то же самое о неароматизированной простой газированной воде?

      Исследований в этой области очень мало, однако в 2001 г. сотрудники Бирмингемского университета изучили семь различных марок простой газированной воды, поместив в них удаленные человеческие зубы.

      Выяснилось, что у этих напитков кислотно-щелочной баланс составляет 5-6 (то есть они менее кислотны, чем некоторые виды кол, у которых кислотно-щелочной баланс может достигать значения 2,5).

      Для сравнения, баланс простой негазированной воды составляет 7 единиц, то есть равен балансу нейтральной среды. Иными словами, как и подозревали ученые, простые газированные воды являются слабыми кислотными растворами.

      Однако их способность к разрушению зубов в 100 раз ниже, чем у некоторых других видов газированных напитков.

      Разумеется, среда ротовой полости отличается от среды лабораторной мензурки, но пока доказательств тому, что простая газированная вода вредна для зубов, не так много.

      Так что если вам поднадоела простая негазированная вода, можно разнообразить меню простой газированной. Ну а чтобы минимизировать риск для зубов, можно пить ее через соломинку.

      Отказ от ответственности

      Все сведения, содержащиеся в этой статье, предназначены только для общей информации и не должны рассматриваться в качестве замены медицинских советов вашего лечащего врача или любого другого профессионала из сферы здравоохранения. Би-би-си не несет ответственности и не может быть привлечена к таковой за содержание внешних интернет-сайтов, упомянутых здесь. Она также не призывает к использованию каких-либо коммерческих продуктов или услуг, упоминаемых или рекомендуемых на любом из этих сайтов. Всегда обращайтесь в вашему лечащему врачу, если у вас возникают какие бы то ни было опасения по поводу вашего здоровья.

      Читайте также…

      Охлаждение с карбонизацией | Глобальный инновационный центр Suntory

      Раскрытие мощной способности газирования охлаждать и освежать

      Большая часть родниковой воды в Европе представляет собой жесткую воду, содержащую углекислоту, поэтому люди предпочитают пить газированную воду во время еды. В последнее время более заботящиеся о своем здоровье японцы также обращаются к газированной воде. Несмотря на то, что были проведены некоторые исследования того, как газированная вода помогает облегчить проблемы с пищеварением и другие желудочно-кишечные симптомы, лишь немногие исследования были посвящены изменениям, которые газированная вода вызывает в нашем организме.Мы изучили физиологические эффекты употребления газированной воды и обнаружили, что она может эффективно регулировать температуру тела.

      Употребление газированной воды вызывает немедленное и интенсивное ощущение во рту. В нашем исследовании изучалось влияние газированной воды на организм — как в первый момент, так и после проглатывания. В частности, мы измеряли температуру барабанной перепонки (внутренняя температура тела), температуру пальцев ног (температура кожи на конечностях) и частоту сердечных сокращений (функция вегетативной нервной системы), чтобы отслеживать физиологические изменения на обоих этапах приема.

      Экспериментальный метод

      Мы провели эксперимент на 13 женщинах одинакового возраста, роста и физического состояния. Используя газированную воду и негазированную воду без угольной кислоты, хранящиеся при температуре 15 ℃, мы сравнили результаты при четырех условиях, показанных справа, и проверили, были ли они результатом сенсорной стимуляции или эффектом фактического проглатывания воды.

      Измерение реакции организма (включая температуру)

      В ходе эксперимента мы измеряли температуру тела и частоту сердечных сокращений испытуемых в состоянии покоя в течение 20 минут, а затем давали им выпить 150 мл воды за 5 минут.Затем в течение 40 минут измеряли температуру тела и частоту сердечных сокращений, за это время снимали электрогастрограмму. Мы собирали данные о субъективных симптомах с 10-минутными интервалами до и после употребления воды.

      Мы использовали сложный термодатчик для измерения внутренней температуры (барабанная перепонка) и температуры конечностей (пальцев), а затем взяли средние значения, чтобы сравнить четыре состояния у тринадцати испытуемых. Мы обнаружили, что газированная вода оказывает значительное влияние на снижение температуры конечностей по сравнению со стоячей водой.Что еще более важно, эффекты были очевидны в ту минуту, когда газировка попала в рот. Измерения частоты сердечных сокращений, проведенные для изучения функции вегетативной нервной системы, также показали временное увеличение только при стимуляции ртом — увеличение, которое было значительным по сравнению с тремя другими условиями. Эти результаты свидетельствуют о том, что стимуляция рта газированной водой подает сигналы в мозг и вегетативную нервную систему, эффективно снижая температуру конечностей и увеличивая частоту сердечных сокращений.

      Как холодная газированная вода, так и холодная негазированная вода снижают температуру тела при проглатывании.Однако мы обнаружили, что сенсорная стимуляция, вызванная газированной водой во рту, вызывает дополнительные эффекты, снижающие температуру тела. Таким образом, употребление газированной воды в дополнение к ношению более прохладной одежды может помочь облегчить дискомфорт в жаркие летние месяцы, что является отличной новостью для усилий по энергосбережению в офисе!

      Благодаря нашему тщательному изучению изменений в человеческом организме и другим новаторским исследованиям, Suntory смогла предоставить клиентам напитки, предлагающие разнообразные варианты по выгодной цене для поддержки лучшей повседневной жизни. Наше недавнее исследование показало, что простая стимуляция рта с помощью газирования имеет физиологический эффект регулирования температуры тела, что делает питье газированной воды мощной и эффективной стратегией охлаждения тела и делает повседневную жизнь более приятной. Исследования Suntory возвращаются к основам и задают фундаментальные вопросы о том, какие напитки влияют на нас и как. Раскрытие скрытых функций и механизмов, решающих эти загадки, позволяет нам постоянно предлагать новые инновационные напитки, которые делают жизнь более приятной и удовлетворяющей для всех.

      5 причин, почему газированные напитки вредны для вас!

      Газированные напитки бескомпромиссно существуют уже много лет, и миллионы людей, таких как вы и я, время от времени выпивают стакан или два, особенно во время вкусной еды.

      Мы бы солгали, если бы сказали, что газированные напитки не щекочут наши вкусовые рецепторы… потому что на самом деле это так!

      Но важно помнить, что всякий раз, когда мы идем покупать безалкогольные напитки, каждый глоток, который мы кладем в рот, оказывает опасное воздействие на наш организм.

      Содержание

      Хуже всего то, что мы все это знаем, но продолжаем наслаждаться.

      Доступные в различных цветах, ароматах, вкусах и газированных напитках (безалкогольные напитки, как их обычно называют), с добавлением сахара и различных других вредных ингредиентов, включая химикаты и консерванты.

      Газированные напитки на самом деле считаются «пустыми калориями», и их следует избегать в любых ситуациях.

      Вот 5 причин, почему вы должны прекратить пить газированные напитки прямо сейчас!

      1.Безалкогольные напитки делают вас толстыми

      Общеизвестно, что безалкогольные напитки полностью лишены каких-либо питательных веществ. На самом деле, они перегружены калориями, кукурузным сиропом с высоким содержанием фруктозы и способствуют нездоровому режиму потребления калорий.

      Помимо пустых калорий, исследования показывают, что кукурузный сироп с высоким содержанием фруктозы, содержащийся в безалкогольных напитках, на самом деле вызывает выработку гормона голода, который заставляет вас потреблять больше пищи, чем необходимо вашему организму.

      Кроме того, напитки с кукурузным сиропом с высоким содержанием фруктозы приводят к артриту у людей.Таким образом, вместо того, чтобы покупать бутылку газированного напитка, мотивируйте себя выбирать здоровые напитки, богатые необходимыми питательными веществами, такими как кальций и магний, такие как стакан молока или стакан свежевыжатого сока.

      2. Безалкогольные напитки могут вызвать у вас диабет

      Употребление чрезмерно подслащенных напитков приводит к тому, что организм накапливает избыточную энергию в виде жира, и, таким образом, употребление слишком большого количества безалкогольных напитков может сыграть свою роль в избыточном весе или даже ожирении.

      Исследования показали, что избыточный вес или ожирение являются фактором риска развития диабета 2 типа и других заболеваний.

      Поскольку газированные напитки содержат много сахара, вот как высокое потребление сахара может привести к диабету: более высокие концентрации глюкозы в крови из-за большого количества быстроперевариваемых углеводов означают большую потребность в инсулине, гормоне, вырабатываемом поджелудочной железой для регуляции этого состояния крови. сахара.

      Более высокая потребность в инсулине в долгосрочной перспективе приводит к «истощению поджелудочной железы, что может привести к непереносимости глюкозы».Диеты с высоким гликемическим индексом могут напрямую повышать резистентность к инсулину.

      3. Потребление газированных напитков влияет на здоровье полости рта

      Хотите верьте, хотите нет, но употребление газированных напитков также может иметь пагубные последствия для здоровья полости рта, потенциально приводя к кариесу и даже к видимому разрушению зубов. Когда вы пьете газировку, содержащиеся в ней сахара взаимодействуют с бактериями во рту, образуя кислоту. Эта кислота атакует ваши зубы.

      Как обычные газированные напитки, так и газированные напитки без сахара также содержат свои собственные кислоты, которые также разрушают зубы.С каждым глотком газировки вы запускаете повреждающую реакцию, которая длится около 20 минут. Если вы целый день потягиваете газированные напитки, ваши зубы постоянно подвергаются атаке. Есть два основных стоматологических последствия употребления соды – эрозия и кариес.

      Эрозия:

      Эрозия начинается, когда кислоты, содержащиеся в безалкогольных напитках, сталкиваются с зубной эмалью, которая является самым внешним защитным слоем зубов. Их действие заключается в снижении твердости поверхности эмали.

      Полости:

      С другой стороны, безалкогольные напитки

      также могут воздействовать на следующий слой, дентин и даже композитные пломбы.Это повреждение зубной эмали может вызвать кариес. Полости или кариес со временем развиваются у людей, которые регулярно пьют безалкогольные напитки. Добавьте к этому плохую гигиену полости рта, и зубы могут сильно повредиться.

      4. Безалкогольные напитки содержат фосфорную кислоту

      Фосфорная кислота препятствует естественному усвоению кальция организмом. Недостаток кальция может привести к размягчению костей, остеопорозу и кариесу. Он также портит желудочную кислоту, блокируя усвоение питательных веществ и замедляя пищеварение.

      5. Чрезмерное употребление газированных напитков может привести к обезвоживанию организма

      Употребление газированных напитков может привести к обезвоживанию из-за высокого содержания в них сахара, натрия и кофеина. Многие люди пьют газировку во время еды вместо воды и отказываются от нее, чтобы получить необходимую суточную норму воды.

      Диетические безалкогольные напитки не являются здоровой альтернативой – лучше их избегать

      Если вы пытаетесь контролировать уровень сахара в крови или контролировать свой вес, вы можете выбрать диетическую газировку. Диетические газированные напитки с низким содержанием калорий и сахара являются хорошей альтернативой сладким напиткам.

      К сожалению, хотя в них нет настоящего сахара, в них много искусственных подсластителей и других вредных для здоровья добавок. Диетическая газировка содержит аспартам вместо сахара, и на самом деле она может быть более вредной для вашего организма.

      Отчеты показывают, что аспартам может быть связан с судорогами, опухолями головного мозга, рассеянным склерозом, диабетом, эмоциональными расстройствами, а также другими проблемами со здоровьем.

      Попробуйте это вместо этого!

       Вместо диетической газировки есть несколько отличных вариантов, которые вы можете выбрать.Настоянная вода является отличной альтернативой.

      В воду можно добавлять фрукты (особенно ягоды), огурцы, лимон и травы (например, базилик и мяту). Газированная вода также является хорошим вариантом, если она не имеет искусственных ароматизаторов или подсластителей.

      • Молоко также является приемлемым выбором.
      • Черный кофе/зеленый чай — еще один хороший выбор.
      • Стакан свежевыжатого сока намного лучше банки газировки.

       

      Интересные факты о безалкогольных напитках

      • Безалкогольные напитки называются безалкогольными, потому что в них нет алкоголя.
      • Первые ароматизированные газированные напитки появились в Европе во второй половине XVII века. Они были наиболее популярны во Франции.
      • Безалкогольные напитки часто различаются по размеру упаковки, типу контейнера, производителю, вкусу, ингредиентам и температуре подачи.
      • Наиболее популярными типами безалкогольных напитков являются ароматизированная вода, газированная вода, сладкий чай со льдом, компоты, газированные безалкогольные напитки, диетические безалкогольные напитки, фруктовый пунш, сельтерские напитки и ликеры.
      • Безалкогольные напитки можно назвать по-разному.Самыми популярными из них являются газированные напитки, газированные напитки, кока-кола, газированные напитки, газированные напитки и газированные напитки.
      • Ежегодно в более чем 200 странах продается более 34 миллиардов галлонов безалкогольных напитков.
      • Сладкие напитки являются одной из основных причин увеличения количества бактерий во рту. Это может привести к значительному разрушению зубов.
      • Процесс газирования воды (насыщение воды углекислым газом) был изобретен англичанином Джозефом Пристли в 1767 году.
      • Средний напиток из колы содержит 38 калорий на 100 граммов.
      • На долю США приходится 25% мирового рынка безалкогольных напитков.
      • Подслащенные напитки содержат большое количество килоджоулей, что может привести к увеличению веса и ожирению.

      Часто задаваемые вопросы

      1. Как газированные напитки влияют на организм?

      Ответ. Газированные напитки широко известны тем, что повышают уровень кислотности в нашем организме, а также создают риск потери кальция и магния из костей из-за изменения уровня pH.

      Также высокое содержание сахара в газированных напитках приводит к увеличению веса и даже ожирению, не говоря уже о угрозе диабета.

      2. Вредна ли газированная вода?

      Ответ. Исследования утверждают, что употребление газированной воды высасывает из организма кальций, подвергая вас большему риску остеопороза. Это также может привести к разрушению зубной эмали, раздражению желудка и даже раку.

      3. Полезно ли пить газированную воду?

      Ans. Газированная вода без сахара имеет слабое содержание кислот, что, в свою очередь, наносит гораздо меньший вред зубам. Известно, что газированные безалкогольные напитки как минимум в 100 раз более вредны для здоровья зубов, чем газированная вода.

      Хотите направить свою жизнь на здоровый образ жизни? Возможные стенды с вами в вашем путешествии. Поговорите с нашим экспертом, потенциальным диетологом сегодня. Первая консультация у нас. Нажмите здесь, чтобы воспользоваться.

      Газированные напитки и экскреция кальция с мочой | Американский журнал клинического питания

      РЕЗЮМЕ

      Справочная информация: В обсервационных исследованиях потребление газированных напитков было связано с повышенным риском переломов.Обычное объяснение заключается в том, что один или несколько компонентов напитка увеличивают содержание кальция в моче.

      Цель: Мы оценили кратковременное влияние газированных напитков различного состава на экскрецию кальция с мочой.

      Дизайн: Для исследования женщин в возрасте 20–40 лет, которые обычно потребляли ≥680 мл газированных напитков в день, был использован неполный случайный блок-план. Были протестированы четыре газированных напитка: 2 с кофеином и 2 без кофеина. Два из них содержали фосфорную кислоту в качестве подкислителя, а два содержали лимонную кислоту.Исследование включало один нейтральный контроль (вода) и один положительный контроль (обезжиренное или шоколадное молоко). Размер порции составлял 567 мл для газированных напитков и воды и 340 мл для молока. Напитки употреблялись с легким завтраком после ночного голодания; никакие другие продукты не принимались до полного сбора мочи. pH, титруемая и общая кислотность, натрий, креатинин и кальций измерялись в 2-часовой (утренней) пробе мочи натощак и 5-часовой после приема напитка.

      Результаты: По сравнению с водой содержание кальция в моче значительно повышалось только при употреблении молока и 2 напитков, содержащих кофеин.Избыточная кальциурия составляла ≈0,25 ммоль, примерно такая же, как сообщалось ранее для одного кофеина. Фосфорная кислота без кофеина не вызывала избыточной кальциурии; он также не увеличивал кальциурию кофеина.

      Выводы: Избыточная кальциурия, связанная с потреблением газированных напитков, ограничивается напитками с кофеином. Подкисляющий тип не оказывает острого действия. Поскольку известно, что эффект кофеина компенсируется снижением кальциурии в конце дня, мы пришли к выводу, что чистое влияние компонентов газированных напитков на экономию кальция незначительно.Скелетные эффекты потребления газированных напитков, вероятно, связаны в первую очередь с вытеснением молока.

      ВВЕДЕНИЕ

      В нескольких обсервационных исследованиях потребление газированных напитков было связано со снижением костной массы или повышенным риском переломов как в более позднем возрасте (1), так и у детей и подростков (2–4). В большинстве отчетов кола была более тесно связана, чем другие газированные напитки. Несколько исследователей предположили, что фактором или факторами, ответственными за эту связь, может быть увеличение потребления фосфора или чистая кислотная нагрузка тех напитков, в которых фосфорная кислота используется в качестве подкислителя, или кофеин тех напитков, которые содержат кофеин. Совсем недавно фруктоза, содержащаяся в напитках с натуральными подсластителями, была названа возможной причиной снижения баланса кальция (5). Действие большинства этих факторов обычно связывают с повышенной потерей кальция с мочой. Было показано, что по отдельности фосфор и кофеин оказывают незначительное суммарное влияние или не оказывают его вообще (6–11), но сохраняется беспокойство по поводу кислотной нагрузки (12). Комбинация всех трех факторов, присутствующая во многих сортах колы, напрямую не тестировалась.

      Этот вопрос особенно важен сегодня, потому что потребление кальция в Северной Америке далеко не соответствует текущим рекомендациям.Потребление газированных напитков на душу населения резко возросло, и в настоящее время газированные напитки являются предпочтительным напитком женщин в возрасте 20–40 лет (13). Вмешательство в экономию кальция у людей с уже низким потреблением кальция может только усугубить нехватку кальция. Ранее этот вопрос изучался в экспериментальном плане только один раз, и то только для одной колы (9). Соответственно, а также из-за широкого интереса диетологов и диетологов к возможным эффектам газированных напитков, мы предприняли настоящее исследование.Мы исследовали острое влияние на потерю кальция с мочой потребления газированных напитков различного состава взрослыми женщинами, которые регулярно употребляли такие напитки.

      ПРЕДМЕТЫ И МЕТОДЫ

      Протокол

      Были протестированы четыре различных газированных напитка, вода использовалась в качестве отрицательного контроля, а 2 вида молока (белое и шоколадное) использовались в качестве положительного контроля, в результате чего общее количество протестированных напитков достигло 7. Показаны напитки, их состав и соответствующие характеристики. в таблице 1.Два напитка (Coke and Coke-Free; The Coca-Cola Company, Атланта) содержали фосфорную кислоту в качестве подкислителя, а 2 (Mountain Dew; The Pepsi Cola Company, Purchase, NY; и Sprite; The Coca-Cola Company) использовали лимонная кислота. Два из них содержали кофеин (Coke и Mountain Dew), а два — нет (Coke-Free и Sprite). Изучаемые бренды были выбраны потому, что содержание в них предположительно вредных веществ приближалось к верхней границе их категорий.

      ТАБЛИЦА 1

      Состав и характеристики напитка 1

      Напиток . Подкислитель . Фосфор . Кальций . Кофеин . Сахара . Нет данных 2 . рН . Чистая кислота 3 . 90 218
      ммоль ммоль мг г мэкв мэкв H +
      кофеином колы Фосфорная кислота 2.7 0 77,5 67,5 4,2 2,54 4,94
      Кофеин свободной колы Фосфорная кислота 2,5 0 0 62,5 2,2 2,94 4,53
      кофеином noncola Лимонная кислота 0,04 0 91,7 76,7 1,5 3,27 0
      Кофеин свободной noncola Лимонная кислота 0 0 0 65. 0 2.1 2.1 3.37 0 9 0
      NAT 9.0 11.2 0 16.0 90 7.5
      Шоколадное молоко, Lite 4 4 Na 10.7 11.7 11.6 0 16.2 8.7
      Нам . Подкислитель . Фосфор . Кальций . Кофеин . Сахара . Нет данных 2 . рН . Чистая кислота 3 . 90 218 ммоль ммоль мг г мэкв мэкв H + кофеином колы Фосфорная кислота 2. 7 0 77,5 67,5 4,2 2,54 4,94 Кофеин свободной колы Фосфорная кислота 2,5 0 0 62,5 2,2 2,94 4,53 кофеином noncola Лимонная кислота 0,04 0 91,7 76,7 1,5 3,27 0 Кофеин свободной noncola Лимонная кислота 0 0 0 65.0 2.1 2.1 3.37 0 9 0 NAT 9.0 11.2 0 16.0 90 7.5 — — Шоколадное молоко, Lite 4 Н.А. 10,7 11,6 0 16,2 8,7 — — Таблица 1

      напитки состав и характеристики 1

      напиток . Подкислитель . Фосфор . Кальций . Кофеин . Сахара . Нет данных 2 . рН . Чистая кислота 3 . 90 218
      ммоль ммоль мг г мэкв мэкв H +
      кофеином колы Фосфорная кислота 2.7 0 77,5 67,5 4,2 2,54 4,94
      Кофеин свободной колы Фосфорная кислота 2,5 0 0 62,5 2,2 2,94 4,53
      кофеином noncola Лимонная кислота 0,04 0 91,7 76,7 1,5 3,27 0
      Кофеин свободной noncola Лимонная кислота 0 0 0 65. 0 2.1 2.1 3.37 0 9 0
      NAT 9.0 11.2 0 16.0 90 7.5
      Шоколадное молоко, Lite 4 4 Na 10.7 11.7 11.6 0 16.2 8.7
      Нам . Подкислитель . Фосфор . Кальций . Кофеин . Сахара . Нет данных 2 . рН . Чистая кислота 3 . 90 218 ммоль ммоль мг г мэкв мэкв H + кофеином колы Фосфорная кислота 2. 7 0 77,5 67,5 4,2 2,54 4,94 Кофеин свободной колы Фосфорная кислота 2,5 0 0 62,5 2,2 2,94 4,53 кофеином noncola Лимонная кислота 0,04 0 91,7 76,7 1,5 3,27 0 Кофеин свободной noncola Лимонная кислота 0 0 0 65.0 2.1 2.1 3.37 0 9 0 NAT 9.0 11.2 0 16.0 90 7.5 — — Шоколадное молоко, Lite 4 4 4 NA 10.7 11.6 11.6 0 16.2 8. 7 — — — —

      Неполная случайная конструкция блока была установлена ​​так, что 5 напитков были проверены на каждом женщина: вода, оба напитка на основе колы, один из видов молока и один из двух напитков, содержащих лимонную кислоту.В каждом субъекте последовательность напитков была рандомизирована с использованием функции случайных чисел EXCEL (Microsoft, Redmond, WA).

      Последовательность тестов у каждой женщины была организована в виде 1-недельного цикла, так что весь набор из 5 тестов был выполнен у большинства испытуемых в течение одного календарного месяца. Субъекты сообщали исследовательскому подразделению о голодании утром после мочеиспускания дома, отмечая время. Они оставались в отделении натощак до тех пор, пока не был собран второй образец через 2 часа. Затем им давали завтрак, состоящий из исследуемого напитка и 2 кусочков специально испеченного белого хлеба с низким содержанием кальция, поджаренного в итальянском стиле, с маслом. Порция молока составляла 340 мл (12 унций), а порция газированных напитков — 567 мл (20 унций). Разница в объеме жидкости между молоком и другими напитками была компенсирована за счет того, что испытуемые выпили дополнительно 227 мл деионизированной воды. Различия в потреблении углеводов между напитками были компенсированы путем предоставления испытуемым необходимого количества желейных бобов (состоящих в основном из сахарозы и кукурузного сиропа), чтобы уравнять общее потребление сахара для всех тестовых приемов пищи (1.всего 256 МДж). Вся моча была собрана в течение следующих 5 часов, в течение которых испытуемые выпили дополнительно 567 мл деионизированной воды; никакая дальнейшая пища не потреблялась до тех пор, пока не был завершен 5-часовой сбор мочи.

      Были набраны женщины, которые ежедневно потребляли не менее двух банок газированных напитков емкостью 340 мл (12 унций). Общий размер выборки составил 32 человека. Две женщины досрочно выбыли из исследования, и их данные не включены в настоящий отчет. Все испытуемые были проинструктированы поддерживать свое обычное потребление кальция на протяжении всего исследования и воздерживаться от продуктов с высоким содержанием натрия в течение 2 дней перед каждым тестом.Средний (±SD) возраст испытуемых составлял 31,4 ± 5,6 года, а их средний индекс массы тела (в кг/м 2 ) равнялся 25,2 ± 3,75. Обычное потребление испытуемыми газированных напитков в анамнезе колебалось от двух до семи порций по 340 мл (12 унций) в день (x̄: 3,16). Двадцать семь из 30 испытуемых обычно потребляли преимущественно колу, а трое употребляли преимущественно напитки, содержащие лимонную кислоту. Медиана потребления кальция, определенная с помощью опросника частоты приема пищи, модифицированного из опросника Block о частоте приема пищи (14), составила 19.6 ммоль/сут (межквартильный диапазон: 15,8–30,4 ммоль/сут).

      Аналитические методы

      Образцы мочи были проанализированы на кальций, креатинин, натрий, титруемую кислотность и общую кислотность. Кола была проанализирована на кислотность, натрий и фосфор. Кальций определяли атомно-абсорбционным методом, а натрий — пламенно-эмиссионной спектрофотометрией (Perkin Elmer AA Analyst, Norwalk, CT), креатинин — методом автоанализатора, основанным на реакции Яффе (15), а титруемую и общую кислотность — методом Чана (16). .(Этот метод приравнивает общую кислотность к титруемой кислотности плюс ион аммония, за вычетом угольной кислоты.) Фосфор анализировали методом автоанализатора, основанным на Фиске и Субба Роу (17). рН измеряли с использованием рН-метра Fisher Accumet (модель 915; Fisher Scientific, Сент-Луис). Содержание кофеина в напитках было получено из базы данных The Food Processor (ESHA, Salem, OR).

      Статистические методы

      Данные анализировались различными способами, в зависимости от априорных гипотез, т. е. некоторые с помощью дисперсионного анализа, тестирования на обработку и порядок, а некоторые с помощью простых парных t тестов. Когда данные не были нормально распределены, сводная описательная статистика представляла собой медиану и межквартильный размах. Различия были проверены против нулевой гипотезы нуля. В дополнение к исходным данным были рассчитаны различные производные переменные, главным образом ориентированные на оценку избытка кальция в моче (Ca u ) после употребления напитков. Увеличение, вызванное употреблением газированных напитков, было ненамного больше, чем изменения, наблюдаемые при употреблении одной воды, или обычные ежедневные колебания кальциурии.(Внутрисубъектный CV для содержания кальция в 2-часовых образцах натощак составил 10,9%, для отношения кальция к креатинину – 9,1%). оценка избыточной кальциурии. Полученные данные анализировали статистически, как описано выше. Четыре метода, основанные на содержании аналита в 5-часовой пробе мочи после тестового завтрака, если не указано иное, были следующими:

      \[\mathrm{Excess\ Ca_{u}1\ =\ Ca_{u} \ (bev)\ {\mbox{—}}\ Ca_{u}\ (вода)}\]

      1

      \[\mathrm{Excess\ Ca_{u}2\ =\ Ca/креатинин\ (bev) \ {\mbox{—}}\ Ca/креатинин\ (вода)}\]

      2

      \[\mathrm{Избыток\ Ca_{u}3\ =\ Ca\ (5\ h)\ {\mbox{ —}}\ [Ca/креатинин\ (натощак)\ {\times}\ креатинин\ (5\ ч)]}\]

      3

      \[\mathrm{Избыток\ Ca_{u}4\ =\ Избыток\ Ca_{u}3\ (bev)\ {\mbox{—}}\ избыток\ Ca_{u}3\ (вода)}\]

      4 где bev — напиток. Первый метод представляет собой простое превышение данного напитка по отношению к водной муке, разделенное во времени на ≥1 неделю; второй — такое же превышение с поправкой на креатинин; третий – превышение по сравнению с тем, что можно было бы предсказать для этой женщины, исходя из ее отношения кальция к креатинину натощак в то же утро; и четвертый такой же, как третий, за исключением того, что аналогично рассчитанный избыток воды вычитается из избытка напитка. Поскольку результаты для двух видов молока существенно не отличались, и поскольку молоко использовалось в эксперименте только в качестве положительного контроля (и его тип не имел отношения к вопросу исследования), мы объединили результаты для молока 30 испытуемых.

      РЕЗУЛЬТАТЫ

      Измеренные значения экскреции натрия и кальция с мочой в зависимости от потребляемых напитков показаны в таблице 2. За исключением молока и, в меньшей степени, двух напитков, содержащих кофеин, экскреция кальция с мочой была незначительной при любом из напитков. Соотношение содержания натрия в моче к креатинину в 5-часовом сборе было выше, чем при сборе натощак для всех напитков, кроме молока (которое, как можно было ожидать, повышало содержание натрия в моче, поскольку оно содержит некоторое количество натрия).Этот результат, вероятно, отражает натриевый диурез увеличения объема. Это увеличение отношения натрия к креатинину было незначительно больше для 2 напитков, содержащих кофеин, чем для продуктов без кофеина (которые существенно не отличались друг от друга), вероятно, отражая признанный мягкий натрий-мочегонный эффект кофеина. Натрий в моче (Na u ) показал ожидаемую связь с кальцием в моче (данные не показаны), при этом наклон Ca u относительно Na u составляет ≈8 мкмоль Ca/мэкв Na (0.8 ммоль Ca/100 мЭкв Na) в образцах натощак и ≈14 мкмоль Ca/100 мЭкв Na (≈1,4 ммоль Ca/100 мЭкв Na) в 5-часовых коллекциях после приема напитка.

      ТАБЛИЦА 2

      Экскреция натрия и кальция с мочой 1

      = 15)
      . Голодание . 5-часовой прием .
      Напитки . Na/креатинин 2 . Са/креатинин . Na/креатинин 2 . Са/креатинин . Ка . 90 218
      мг-экв / ммоль ммоль / ммоль мг-экв / ммоль ммоль / ммоль ммоль
      кофеином колы ( п = 30) 7.86 (5.61-13.2) 0.176 (0.130-0.232) 12.1 (8.73-17.3) 0.278 (0.235-0.391) 0.712 3 (0.522-0,959)
      Без кофеина COLA ( N = 30) 9.14 (5.58-12.2) 0.132 (0,078-0.223) 11.9 (8.73-14.7) 0.225 (0.150-0. 306) 0.523 (0.341-0.778)
      Кофеин без колы ( n = 15) 9,46 (7.00-13.7) 0.225 (0.136-0.236) 14.0 (10.2-20,6) 0.304 (0.228-0.447) 0.719 3 (0.566-0.934)
      Без кофеина безкола ( N = 15) 8.75 (6.36-13.8) 0.159 (0,089-0.216) 11.7 (9.46-15.1) 0.278 (0.199-0247) 0.549 (0.428-0243)
      Вода ( n = 30) 7,51 (5,55–10,3) 0.137 (0.103-0.238) 9.18 (7.76-19.1) 0.212 (0.147-0.317) 0.559 (0.261-0247 0.559 (0.261-0.714)
      Молоко ( N = 30) 8.44 (5.62-13.71) 0.171 (0.077-0.288) 18.9 (11.9-23.57) 0.456 (0.198-0.563) 0.996 (0.458-1.422)
      = 15)
      . Голодание . 5-часовой прием .
      Напитки . Na/креатинин 2 . Са/креатинин . Na/креатинин 2 . Са/креатинин . Ка . 90 218
      мг-экв / ммоль ммоль / ммоль мг-экв / ммоль ммоль / ммоль ммоль
      кофеином колы ( п = 30) 7.86 (5.61-13.2) 0.176 (0.130-0.232) 12.1 (8.73-17.3) 0.278 (0.235-0.391) 0.712 3 (0.522-0,959)
      Без кофеина COLA ( N = 30) 9.14 (5.58-12.2) 0.132 (0,078-0.223) 11.9 (8.73-14.7) 0.225 (0.150-0.306) 0.523 (0.341-0.778)
      Кофеин без колы ( n = 15) 9,46 (7. 00-13.7) 0.225 (0.136-0.236) 14.0 (10.2-20,6) 0.304 (0.228-0.447) 0.719 3 (0.566-0.934)
      Без кофеина безкола ( N = 15) 8.75 (6.36-13.8) 0.159 (0,089-0.216) 11.7 (9.46-15.1) 0.278 (0.199-0247) 0.549 (0.428-0243)
      Вода ( n = 30) 7,51 (5,55–10,3) 0.137 (0.103-0.238) 9.18 (7.76-19.1) 0.212 (0.147-0.317) 0.559 (0.261-0247 0.559 (0.261-0.714)
      Молоко ( N = 30) 8.44 (5.62-13.71) 0.171 (0.077-0.288) 18.9 (11.9-23.57) 0.456 (0.198-0.563) 0.996 (0,458-1.4247 0,996 (0.458-1.422)
      Таблица 2

      мочеиспускания и экскреция кальция 1

      = 15)
      . Голодание . 5-часовой прием .
      Напитки . Na/креатинин 2 . Са/креатинин . Na/креатинин 2 . Са/креатинин . Ка . 90 218
      мг-экв / ммоль ммоль / ммоль мг-экв / ммоль ммоль / ммоль ммоль
      кофеином колы ( п = 30) 7.86 (5.61-13.2) 0.176 (0.130-0.232) 12.1 (8.73-17.3) 0.278 (0.235-0.391) 0.712 3 (0.522-0,959)
      Без кофеина COLA ( N = 30) 9.14 (5.58-12.2) 0.132 (0,078-0.223) 11.9 (8.73-14.7) 0.225 (0.150-0.306) 0.523 (0.341-0.778)
      Кофеин без колы ( n = 15) 9,46 (7. 00-13.7) 0.225 (0.136-0.236) 14.0 (10.2-20,6) 0.304 (0.228-0.447) 0.719 3 (0.566-0.934)
      Без кофеина безкола ( N = 15) 8.75 (6.36-13.8) 0.159 (0,089-0.216) 11.7 (9.46-15.1) 0.278 (0.199-0247) 0.549 (0.428-0243)
      Вода ( n = 30) 7,51 (5,55–10,3) 0.137 (0.103-0.238) 9.18 (7.76-19.1) 0.212 (0.147-0.317) 0.559 (0.261-0247 0.559 (0.261-0.714)
      Молоко ( N = 30) 8.44 (5.62-13.71) 0.171 (0.077-0.288) 18.9 (11.9-23.57) 0.456 (0.198-0.563) 0.996 (0.458-1.422)
      = 15)
      . Голодание . 5-часовой прием .
      Напитки . Na/креатинин 2 . Са/креатинин . Na/креатинин 2 . Са/креатинин . Ка . 90 218
      мг-экв / ммоль ммоль / ммоль мг-экв / ммоль ммоль / ммоль ммоль
      кофеином колы ( п = 30) 7.86 (5.61-13.2) 0.176 (0.130-0.232) 12.1 (8.73-17.3) 0.278 (0.235-0.391) 0.712 3 (0.522-0,959)
      Без кофеина COLA ( N = 30) 9.14 (5.58-12.2) 0.132 (0,078-0.223) 11.9 (8.73-14.7) 0.225 (0.150-0.306) 0.523 (0.341-0.778)
      Кофеин без колы ( n = 15) 9,46 (7.00-13.7) 0.225 (0.136-0. 236) 14.0 (10.2-20,6) 0.304 (0.228-0.447) 0.719 3 (0.566-0.934)
      Без кофеина безкола ( N = 15) 8.75 (6.36-13.8) 0.159 (0,089-0.216) 11.7 (9.46-15.1) 0.278 (0.199-0247) 0.549 (0.428-0243)
      Вода ( n = 30) 7,51 (5,55–10,3) 0.137 (0.103-0.238) 9.18 (7.76-19.1) 0.212 (0.147-0.317) 0.559 (0.261-0247 0.559 (0.261-0.714)
      Молоко ( N = 30) 8.44 (5.62-13.71) 0,171 (0.077-0.288) 18.9 (11.9-23.57) 0.456 (0.198-0.563) 0,996 (0,458-1.4247 0,996 (0,458-1.422)

      Избыточное избыточное количество экскреции кальция, как рассчитано путем использования из 4 методов показаны в Таблице 3. Как и ожидалось, молоко дало весьма значительный прирост, составивший ≈0. 5 ммоль 3 из 4 методов. Это показывает, что используемый протокол и методы могут обнаруживать избыточную кальциурию. 2 напитка с кофеином также дали увеличение, значимое для всех 4 методов. Однако величина избытка была относительно небольшой [т.е. в диапазоне 0,110–0,346 ммоль (4–14 мг)] в течение 5-часового периода после приема внутрь. Напитки без кофеина, напротив, давали гораздо меньшее увеличение, которое было едва значительным (и не так для некоторых методов). Приведенные выше оценки избыточной кальциурии значительно отличались от нуля.

      ТАБЛИЦА 3

      Избыточное выделение кальция с мочой 1

      7 0,264 ± 0,061
      2 2
      8
      7 0,263 ± 0,088
      4 4 48
      Напиток . Превышение 1 . Превышение 2 . Превышение 3 . Превышение 4 .
      Кофеина COLA ( N = 30) 0. 110 ± 0,024 2 2 0.265 ± 0,047 2 0,152 ± 0,043 3
      Кофеин свободной колы ( п = 30) 0,102 ± 0,058 0,066 ± 0,032 4 0.128 ± 0.097 0.014 ± 0.093
      Кофеина некола ( N = 15) 0,125 ± 0,037 3 8 0.346 ± 0,063 2 0,254 ± 0,059 2
      Кофеин свободной noncola ( п = 15) 0,156 ± 0,073 0,090 ± 0,033 4 0.279 ± 0.053 2 2 2
      8
      0.137 ± 0,054 4 4 4
      Молоко ( N = 30) 0,514 ± 0,081 2 2 0,238 ± 0. 037 2 2 0.541 ± 0,082 2 2
      8
      0,427 ± 0,076 2 2
      8
      7 Молоко (
      N = 30)
      Напитки напитков . Превышение 1 . Превышение 2 . Превышение 3 . Превышение 4 .
      Кола с кофеином ( n = 30) 0,264 ± 0.061 2 0,110 ± 0,024 2 0,265 ± 0,047 2 0,152 ± 0,043 3
      Кофеин свободной колы ( п = 30 ) 0.102 ± 0,058 0,066 ± 0,032 4

      2
      8
      0,128 ± 0,097 0,014 ± 0,093 0,014 ± 0,093
      Кофеина некола ( N = 15) 0.263 ± 0,088 4 0,125 ± 0,037 3 0,346 ± 0,063 2 0,254 ± 0,059 2
      Кофеин свободной noncola ( п = 15) 0. 156 ± 0,073 0,090 ± 0,033 4

      2
      8
      0,279 ± 0,053 2 2
      8

      2
      8
      0.137 ± 0,054 4 4
      8
      0.514 ± 0,081 2 0,238 ± 0,037 2 0,541 ± 0,082 2 0,427 ± 0,076 2
      Таблица 3

      Превышение экскреции кальция 1

      = 30)
      7 0,156 ± 0,073
      Напитки . Превышение 1 . Превышение 2 . Превышение 3 . Превышение 4 .
      кофеином колы ( п = 30) 0,264 ± 0,061 2 0,110 ± 0,024 2 0,265 ± 0,047 2 0,152 ± 0,043 3 3 3
      Кола кофеина ( N = 30) 0,102 ± 0,058 0,066 ± 0,032 4 4 0. 128 ± 0,097 0,014 ± 0,093
      кофеином noncola ( п = 15) 0,263 ± 0,088 4 0,125 ± 0,037 3 0,346 ± 0,063 2
      8
      0.254 ± 0,059 2 2

      2
      Некола без кофеина ( N = 15) 0,090 ± 0,033 4 0.279 ± 0,053 2 0,137 ± 0,054 4
      Молоко ( п = 30) 0,514 ± 0,081 2 0,238 ± 0,037 2 0.541 ± 0.082 2 2
      8
      0,427 ± 0,076 2
      Напитки напитков . Превышение 1 . Превышение 2 . Превышение 3 . Превышение 4 .
      кофеином колы ( п = 30) 0,264 ± 0,061 2 0,110 ± 0,024 2 0,265 ± 0,047 2 0,152 ± 0,043 3  
      Кола без кофеина ( n = 30)  0.102 ± 0,058 0,066 ± 0,032 4 0,128 ± 0,097 0,014 ± 0,093
      кофеином noncola ( п = 15) 0,263 ± 0,088 4 0,125 ± 0.037 3 3
      8
      0.346 ± 0,063 2
      8
      8

      2
      8
      0.254 ± 0,059 2 2
      Без кофеина без кафе ( N = 15) 0.156 ± 0,073 0,090 ± 0,033 4 0,279 ± 0,053 2 0,137 ± 0,054 4
      Молоко ( п = 30) 0,514 ± 0,081 2 2 0. 238 ± 0,037 2 2
      8
      0.541 ± 0,082 2 2
      8
      0,427 ± 0,076 2 2

      Целью настоящего исследования было также для сравнения напитки друг с другом, чтобы оценить влияние их различных композиций.Вариабельность ответа между женщинами была такой же общей величины, как и значения избыточной кальциурии, и по ANOVA не было никаких существенных различий между газированными напитками. Однако в постфактум-анализе, сравнивающем совокупность 2 напитков с кофеином с совокупностью 2 напитков без кофеина, повышение уровня кальция в моче было больше для продуктов, содержащих кофеин ( P <0,05). В пределах типа подкислителя эффекты напитков существенно не отличались друг от друга.

      Данные об экскреции кислоты с мочой показаны в Таблице 4. Как и ожидалось, 2 колы, содержащие фосфорную кислоту, произвели мочу с наибольшим выделением кислоты; даже в этом случае общая экскреция кислоты в течение 5-часового периода после приема внутрь составила всего 2,59 мэкв для колы с кофеином и 1,95 мэкв для колы без кофеина, что составляет менее половины проглоченной кислотной нагрузки. Среднее чистое выделение кислоты с молоком составило -0,08 ± 4,33 мЭкв, что отражает щелочную характеристику золы молочных продуктов при метаболизме.

      MEQ
      7 5.89 ± 0.55
      . Голодание . 5-часовой прием .
      Напитки . рН . рН . ТА . НХ 4 . НАЭ .
      MEQ MEQ Meq

      6
      COAFEOINE COLA ( N = 30) 5.68 ± 0.39 6.01 ± 0,33 2,50248 2,56 ± 2.35 0,042 ± 0,093 2,59 ± 2.40
      Кола без кофеина ( N = 30) 5.83 ± 0,46 6.10 ± 0,36 1,93 ± 2,28 0,024 ± 0,047 1,95 ± 2,30
      кофеином noncola ( п = 15) 5,77 ± 0,46 6,05 ± 0,47 1,22 ± 2,76 0,013 ± 0,0097 1. 24 ± 2.77
      Без кофеина безкола ( N = 15) 6.16 ± 0,46 0,899 ± 3.12 0,015 ± 0,025 0,91 ± 3.12
      Вода ( N = 30) = 30) 5.73 ± 0.48 6.19 ± 0,43 0.831 ± 3.22 0,011 ± 0,011 0.011 0,84 ± 3.22
      Молоко ( N = 30) 5.81 ± 0,56 6 .29 ± 0,46 -0,127 ± 4,30 0,043 ± 0,047 -0,08 ± 4,33
      7 5.89 ± 0.55
      93 ± 0,48
      6 . Голодание . 5-часовой прием .
      Напитки . рН . рН . ТА . НХ 4 . НАЭ .90 218
      мэкв мг-экв мэкв
      кофеином колы ( п = 30) 5,68 ± 0,39 6,01 ± 0,33 2. 56 ± 2.35 0,042 ± 0,093 2,59 ± 2.40 2,59 ± 2.40
      Кола без кофеина ( N = 30) 5,83 ± 0,46 6,10 ± 0,36 1.93 ± 2,28 0,024 ± 0,047 1,95 ± 2,30
      кофеином noncola ( п = 15) 5,77 ± 0,46 6,05 ± 0,47 1,22 ± 2,76 0,013 ± 0,0097 1,24 ± 2.77
      Без кофеина без кофеина ( N = 15) 6.16 ± 0,46 0,899 ± 3.12 0,015 ± 0,025 0,91 ± 3.12
      Вода ( N = 30) 5.73 ± 0,48 6.19 ± 0,43 0,831 ± 3.22 0,011 ± 0,011 0,84 ± 3,22
      Молоко ( N = 30) 5,81 ± 0,56 6,29 ± 0,46 -0,127 ± 4,30 0,043 ± 0,047 -0,08 ± 4,33
      = 30)
      . Голодание . 5-часовой прием .
      Напитки . рН . рН . ТА . НХ 4 . НАЭ . +
      мэкв мг-экв мэкв
      кофеином колы ( п = 30) 5,68 ± 0,39 6,01 ± 0,33 2.56 ± 2,35 0,042 ± 0,093 2,59 ± 2,40
      Кофеин свободной колы ( п = 30) 5,83 ± 0,46 6,10 ± 0,36 1,93 ± 2,28 0,024 ± 0,047 1.95 ± 2.30
      Кофеина некола ( N = 15) 5.77 ± 0,46 6.05 ± 0,47 1,22 ± 2,76 0,013 ± 0,0097 1,24 ± 2,77
      Без кофеина безкола n = 15) 5. 89 ± 0.55 6.16 ± 0,46 0.899 ± 3.12 0,015 ± 0,025 0,91 ± 3.12
      Вода ( N = 30) 5.73 ± 0,48 6,19 ± 0,43 0,831 ± 3,22 0.011 ± 0,011 0,84 ± 3.22
      Молоко ( N = 30) 5.81 ± 0,56 6,29 ± 0,46 -0,127 ± 4.30 0,043 ± 0,047 -0,08 ± 4,33
      MEQ
      7 5.89 ± 0.55
      . Голодание . 5-часовой прием .
      Напитки . рН . рН . ТА . НХ 4 . НАЭ .
      MEQ MEQ Meq

      6
      COAFEOINE COLA ( N = 30) 5. 68 ± 0.39 6.01 ± 0,33 2,50248 2,56 ± 2.35 0,042 ± 0,093 2,59 ± 2.40
      Кола без кофеина ( N = 30) 5.83 ± 0,46 6.10 ± 0,36 1,93 ± 2,28 0,024 ± 0,047 1,95 ± 2,30
      кофеином noncola ( п = 15) 5,77 ± 0,46 6,05 ± 0,47 1,22 ± 2,76 0,013 ± 0,0097 1.24 ± 2.77
      Без кофеина безкола ( N = 15) 6.16 ± 0,46 0,899 ± 3.12 0,015 ± 0,025 0,91 ± 3.12
      Вода ( N = 30) = 30) 5.73 ± 0.48 6.19 ± 0,43 0.831 ± 3.22 0,011 ± 0,011 0.011 0,84 ± 3.22
      Молоко ( N = 30) 5.81 ± 0,56 6 .29 ± 0,46 -0,127 ± 4,30 0,043 ± 0,047 -0,08 ± 4,33

      ОБСУЖДЕНИЕ

      Наиболее очевидным в этих данных является незначительное повышение содержания кальция в моче после приема газированных напитков. Скорее всего, это означает как то, что газированные напитки в целом мало влияют на экономию кальция, так и, соответственно, небольшие изменения в составе напитка. Однако даже небольшая избыточная экскреция, если она накапливается и не компенсируется дополнительным всасыванием кальция, неизбежно приведет к потере костной массы.Следовательно, кажется целесообразным попытаться выделить отдельные вклады различных компонентов этих напитков.

      За исключением молока, самые большие различия (и единственные существенные различия между напитками) были обнаружены для 2 напитков, содержащих кофеин. Средняя величина избыточной кальциурии для напитков, содержащих кофеин, наиболее прямо выраженная избытками Ca u 1, 3 или 4, колебалась от 0,15 до 0,35 ммоль (6–14 мг). Massey и коллеги (18–20) в различных исследованиях сообщали об избыточной кальциурии в диапазоне 0.05 до 0,22 ммоль (2–9 мг) на 100 мг кофеина, т. е. несколько ниже найденных нами значений. Тем не менее, Мэсси и др. не вводили количество сахара, содержащегося в наших напитках, и их периоды сбора были значительно короче, чем у нас. С учетом этих различий в протоколах кажется, что наши значения избыточной кальциурии примерно сопоставимы с их. Если это так, то добавленные переменные кислоты и фосфора, по-видимому, сами по себе не произвели заметного эффекта.Этот вывод подтверждается нашим открытием, что безкофеиновая кола, содержащая фосфорную кислоту, не вызывала значительного избытка кальция при использовании 3 из 4 методов (и ни при одном из них, когда анализ был скорректирован для множественных сравнений).

      В то же время необходимо отметить, что кальцийурический эффект кофеина двухфазный. Massey et al. ранее показали компенсаторное снижение ночной кальциурии у потребителей кофеина (11) и отсутствие чистого влияния на 24-часовую экскрецию (10). Точно так же Barger-Lux и коллеги (21) не обнаружили влияния кофеина на содержание кальция в моче за 24 часа при дозах кофеина, в 5–6 раз превышающих дозы, использованные в этом исследовании.Smith и коллеги (9) не продемонстрировали чистого влияния 1,4 л диетической колы ни на содержание кальция в сыворотке, ни на содержание кальция в моче за 24 часа. Следовательно, та часть наблюдаемой избыточной кальциурии, которая может быть связана с кофеином, вероятно, может быть отклонена как не влияющая на экономию кальция.

      Проблема, однако, несколько сложнее, поскольку газированные напитки содержат несколько других веществ, которые, как известно, влияют на кальций в моче; даже их объем может оказывать некоторое влияние. Сахара повышают содержание кальция в моче (5, 22–24), как и натрий (25).Напротив, фосфор снижает содержание кальция в моче (26). Эффекты всех трех в этом исследовании можно оценить, изучив данные для водной муки. С этой едой испытуемые потребляли полный объем и нагрузку сахара, энергетически эквивалентного количеству испытуемых напитков, но не кислоты, фосфора или кофеина. Средняя избыточная экскреция натрия, рассчитанная по увеличению отношения натрия к креатинину (т. е. аналог Ca и , избыток 3), составила 2,4 мэкв. Этот натрийурез, в свою очередь, будет отвечать за вымывание ≈0.019–0,024 ммоль кальция (≈1 мг). Фактическая избыточная экскреция кальция составила ≈0,11 ммоль (4,5 мг). Разница (3,5 мг) может быть связана с сахаром. Как Lemann et al (22), так и Linderman et al (23) описали избыточную кальциурию при пероральной нагрузке глюкозой той величины, которую мы использовали, в размере 0,2–0,3 ммоль (8–13 мг), т. е. несколько больше, чем то, что мы наблюдали при водная мука в наших темах. Следовательно, кажется вероятным, что избыточная кальциурия, которую мы наблюдали при употреблении воды, была полностью обусловлена ​​этой комбинацией увеличения объема (при диурезе натрия) и сахара.Известно, что эффекты обоих факторов, как и кофеина, компенсируются снижением экскреции в конце дня (20, 21). Следовательно, нельзя ожидать, что даже относительно небольшой эффект, наблюдаемый в наших исследованиях, будет способствовать повышенной 24-часовой кальциурии.

      Напротив, опубликованные данные (26, 27) и обширные неопубликованные наблюдения в нашей лаборатории позволяют предположить, что небольшое количество фосфора снижает содержание Ca u примерно на 0,09 ммоль (3,6 мг). Было показано, что этот хорошо зарекомендовавший себя гипокальциурический эффект фосфора связан с увеличением потери кальция пищеварительным соком (28), что не измерялось в этом исследовании.На самом деле это единственный чистый эффект, который, судя по нашим данным, может быть правдоподобно связан с колой.

      Неспособность обнаружить значительный эффект кислотной нагрузки была в некоторой степени неожиданной. Возможно, этого не должно было быть. Организм обычно вырабатывает 50–100 мэкв неуглеродных протонов в день при метаболизме съеденной пищи (29), а нагрузка в 4,5–5,0 мэкв, вызванная колой в нашем исследовании, значительно меньше, чем эндогенно произведенная даже при умеренном потреблении пищи. — белковый завтрак. Даже семь единиц колы по 340 мл (12 унций) в день (максимум, потребляемый любым из наших испытуемых) вызовут кислотную нагрузку всего ≈21 мэкв.

      Тем не менее, кола была вовлечена, по крайней мере, в некоторые обсервационные исследования (2, 4), возможно, потому, что, если они оказывают прямое вредное воздействие, они действуют другими средствами, а не увеличением потери кальция с мочой. Если бы это было так, наше исследование не обнаружило бы этот эффект. Однако представляется более вероятным, что известность колы в обсервационных исследованиях объясняется ее известностью на рынке. Как показали примеры участников нашего исследования, потребление колы значительно превышает потребление всех других газированных напитков вместе взятых.Если газированные напитки действуют главным образом за счет вытеснения более питательных напитков из рациона, то в большинстве опубликованных обсервационных исследований может оказаться недостаточно данных, чтобы найти значимые связи с другими напитками, что придает коле ложное значение.

      Небольшой интерес может представлять повышение содержания кальция в моче в нашем исследовании при приеме молочной муки. Нагрузка кальцием в этом приеме пищи составляла ≈11,25 ммоль (450 мг), и ожидается, что доля абсорбции при такой нагрузке для женщин этого возраста будет ≈0.25 (30), что означает, что абсорбировалось ≈2,8 ммоль (112 мг). При избытке кальция в моче, составляющем ≈0,5 ммоль, молочная мука привела бы к задержке ≈2,3 ммоль кальция. Повышение содержания кальция в моче с молоком, таким образом, также является отражением всасывания, а ни в коем случае не отрицательным эффектом; его относительная малость, вероятно, также является отражением способности этих женщин с обычно низким потреблением кальция сохранять кальций (в виде костей), когда это позволяет диета.

      С точки зрения методологии, метод 2 для оценки избытка кальция в моче (включая поправки как на креатинин, так и на водную муку) дал наименьшую абсолютную вариабельность от человека к человеку и, следовательно, может быть более чувствительным подходом для исследований такого рода.Тем не менее, каждый из 4 методов предоставил немного отличающуюся информацию, и совокупность ≥2 подходов может быть более полезной. Конечно, можно быть более уверенным в эффекте, обнаруженном всеми четырьмя методами.

      Отсутствие в этом исследовании кальцийурических эффектов газированных напитков помимо тех, которые, как известно, компенсируются снижением экскреции в конце дня, а также тот факт, что наши испытуемые привыкли к газированным напиткам, приводит нас к выводу, что основное значение для здоровья костей газированных напитков заключается не в том, что эти напитки содержат, а в том, чего в них нет: питательных веществ, необходимых для здоровья костей. До тех пор, пока не будут получены доказательства других механизмов действия, наиболее экономным объяснением связи потребления газированных напитков с плохим состоянием костей будет вытеснение молока.

      ССЫЛКИ

      1

      Wyshak

      G

      ,

      FRISCH

      RE

      ,

      ALBRIGHT

      TE

      ,

      TE

      ,

      ALBRIGHT

      NL

      ,

      SCHIFF

      I

      ,

      WITSCHI

      J

      .

      Потребление безалкогольных газированных напитков и переломы костей у женщин, бывших спортсменок колледжей

      .

      J Orthop Res

      1989

      ;

      7

      :

      91

      91

      9

      .2

      Petridou

      E

      ,

      Karpathios

      T

      ,

      DessyPris

      N

      ,

      SIMOU

      E

      ,

      Trochopoulos

      D

      .

      Роль молочных продуктов и безалкогольных напитков в развитии переломов костей у детей школьного возраста

      .

      Scand J Soc Med

      1997

      ;

      25

      :

      119

      25

      . 3

      Вышак

      Г

      ,

      Фриш

      РЭ

      .

      Газированные напитки, диетический кальций, диетическое соотношение кальция/фосфора и переломы костей у девочек и мальчиков

      .

      J Adolesc Health

      1994

      ;

      15

      :

      210

      5

      .4

      Вышак

      Г

      .

      Девочки-подростки, употребление газированных напитков и переломы костей

      .

      Arch Pediatr Adolesc Med

      2000

      ;

      154

      :

      610

      3

      .5

      Милн

      ДБ

      ,

      Нильсен

      ФХ

      .

      Взаимодействие между пищевой фруктозой и магнием отрицательно влияет на макроминеральный гомеостаз у мужчин

      .

      J Am Coll Nutr

      2000

      ;

      19

      :

      31

      7

      .6

      Spencer

      H

      ,

      H

      ,

      Menczel

      J

      ,

      Lewin

      I

      ,

      Samachson

      J

      .

      Влияние высокого потребления фосфора на метаболизм кальция и фосфора у человека

      .

      Дж Нутр

      1965

      ;

      86

      :

      125

      125

      32

      . 7

      Spencer

      H

      ,

      Kramer

      L

      ,

      Оз

      D

      ,

      Norris

      C

      .

      Влияние фосфора на усвоение кальция и баланс кальция у человека

      .

      Дж Нутр

      1978

      ;

      108

      :

      447

      57

      .8

      Barger-Lux

      MJ

      ,

      Heaney

      RP

      .

      Еще раз о кофеине и кальциевой экономике

      .

      Osteoporos Int

      1995

      ;

      5

      :

      97

      102

      102

      .9

      Smith

      S

      ,

      Swain

      J

      ,

      Brown

      EM

      , et al.

      Предварительный отчет о кратковременном влиянии потребления газированных напитков на метаболизм кальция у здоровых женщин

      .

      Arch Intern Med

      1989

      ;

      149

      :

      2517

      9

      .10

      Wise

      KJ

      ,

      Bergman

      EA

      ,

      Sherrard

      DJ

      ,

      Massey

      LK

      .

      Взаимодействие между пищевым кальцием и потреблением кофеина на метаболизм кальция у людей с гипертонией

      .

      Am J Hypertens

      1996

      ;

      9

      :

      223

      9

      .11

      Кынаст-Галес

      SA

      ,

      Massey

      LK

      .

      Влияние кофеина на циркадную экскрецию кальция и магния с мочой

      .

      J Am Coll Nutr

      1994

      ;

      13

      :

      467

      72

      .12

      Барзель

      США

      .

      Скелет как ионообменная система: роль кислотно-щелочного дисбаланса в генезе остеопороза

      .

      J Bone Miner Res

      1995

      ;

      10

      :

      1431

      6

      .13

      Министерство сельского хозяйства США

      .

      Третий отчет о мониторинге питания в США.VOL 2.

      Вашингтон, DC

      :

      Правительственная полиграфическая информация

      ,

      1995

      .14

      Cummings

      ,

      блок

      G

      ,

      MCHENRY

      K

      ,

      Baron

      RB

      .

      Оценка двух методов частоты приема пищи для измерения потребления кальция с пищей

      .

      Am J Epidemiol

      1987

      ;

      126

      :

      796

      796

      802

      . 15

      Уорд

      P

      ,

      EWEN

      M

      ,

      Pomeroy

      JA

      ,

      Leung

      FY

      .

      Кинетическое определение креатинина мочи с помощью анализатора Gemsaec

      .

      Клин Биохим

      1976

      ;

      9

      :

      225

      7

      .16

      Чан

      JCM

      .

      Быстрое определение титруемой в моче кислоты и аммония и оценка замораживания как метода сохранения

      .

      Клин Биохим

      1972

      ;

      5

      :

      94

      8

      .17

      Fiske

      CH

      ,

      Subba Row

      Y

      .

      Колориметрическое определение фосфора

      .

      J Biol Chem

      1925

      ;

      66

      :

      375

      375

      400

      .18

      400

      .18

      Bergman

      EA

      ,

      MASSEY

      LK

      ,

      WISE

      KJ

      ,

      SHERRARD

      DJ

      .

      Влияние перорального приема кофеина на почечную регуляцию кальция и магния у взрослых женщин

      .

      Life Sci

      1990

      ;

      47

      :

      557

      64

      . 19

      Massey

      LK

      ,

      Hollingbery

      PW

      .

      Острое воздействие кофеина и сахарозы на экскрецию минералов с мочой у здоровых подростков

      .

      Нутр Рез

      1988

      ;

      8

      :

      1005

      12

      .20

      Massey

      LK

      ,

      Wise

      KJ

      .

      Влияние кофеина на экскрецию с мочой кальция, магния, натрия и калия у здоровых молодых женщин

      .

      Нутр Рез

      1984

      ;

      4

      :

      43

      50

      .21

      50

      .21

      Barger-Lux

      MJ

      ,

      Haney

      RP

      ,

      Stegman

      MR

      .

      Влияние умеренного потребления кофеина на экономию кальция у женщин в пременопаузе

      .

      Am J Clin Nutr

      1990

      ;

      52

      :

      722

      5

      .22

      Леманн

      J

      Jr,

      Пиринг

      WR

      ,

      E 05 05 04 05 E 05 04

      Lennon

      Возможная роль кальциурии, вызванной углеводами, в образовании камней в почках из оксалата кальция

      .

      N Engl J Med

      1969

      ;

      280

      :

      280

      :

      232

      7

      .23

      Linderman

      RD

      ,

      RD

      ,

      ADLER

      S

      ,

      Yiengst

      MJ

      ,

      Beard

      ES

      .

      Влияние различных нутриентов на выделение с мочой двухвалентных катионов

      .

      J Lab Clin Med

      1967

      ;

      70

      :

      236

      45

      .24

      Thom

      JA

      ,

      Morris

      JE

      ,

      Bishop

      A

      ,

      Blacklock

      NJ

      .

      Влияние рафинированных углеводов на экскрецию кальция с мочой

      .

      Бр Ж Урол

      1978

      ;

      50

      :

      459

      64

      .25

      64

      .25

      Nordin

      BEC

      ,

      ,

      AG

      ,

      MORRIS

      HA

      ,

      HOROWITZ

      M

      .

      Характер и значение взаимосвязи между содержанием натрия и кальция в моче у женщин

      .

      Дж Нутр

      1993

      ;

      123

      :

      1615

      22

      .26

      Хини

      RP

      ,

      Recker

      RP

      .

      Добавки кальция: анионные эффекты

      .

      Шахтер костей

      1987

      ;

      2

      :

      433

      9

      .27

      Хини

      RP

      ,

      Recker

      RR

      0 9 05 05

      Saville

      Менопаузальные изменения показателей баланса кальция

      .

      J Lab Clin Med

      1978

      ;

      92

      :

      953

      63

      .28

      Хини

      RP

      ,

      Recker

      RR

      .

      Детерминанты эндогенного фекального кальция у здоровых женщин

      .

      J Bone Miner Res

      1994

      ;

      9

      :

      1621

      7

      .29

      Роза

      BD

      .

      Клиническая физиология кислотно-основных и электролитных нарушений.

      3-е изд.

      Нью-Йорк

      :

      McGraw-Hill

      ,

      1977

      .30

      .30

      Haney

      RP

      ,

      Weaver

      см

      ,

      FITZSIMMONS

      мл

      .

      Влияние кальциевой нагрузки на абсорбционную фракцию

      .

      J Bone Miner Res

      1990

      ;

      5

      :

      1135

      8

      .

      © 2001 Американское общество клинического питания

      Газированные безалкогольные напитки вызывают окислительный стресс и изменяют экспрессию определенных генов в мозге крыс Wistar

      Введение

      Высокий уровень потребления газированных безалкогольных напитков Саудовская Аравия, особенно у лиц среднего возраста в возрасте от 35–50 лет.Влияние этих продуктов на здоровье неясно, хотя эпидемиологические исследования предполагают их связи с ожирением, заболеваниями почек, печени и остеопороз (1,2). Они состоят преимущественно из воды но также обычно содержат фосфорную кислоту, кофеин, сахар и химические вещества в виде красителей, ароматизаторов, консервантов и подсластители. Скорость потребления этих напитков особенно высокий в богатых странах (1).

      Большинство людей рассматривают газированные напитки употребление алкоголя как довольно безобидное (1).Однако существует ряд серьезных проблемы со здоровьем, связанные с регулярным употреблением газированных безалкогольные напитки, например, предыдущие рецензируемые исследования сообщили о 25 отдельных вредных последствиях, включая остеопороз и болезни почек и печени (2,3). Газированные безалкогольные напитки содержат несколько соединений, в том числе кофеин; который является наиболее широко потребляемым поведенчески активным вещества во всем мире. Почти весь кофеин поступает из диетических источников. (4). Острый и хронический кофеин потребление, по-видимому, имеет лишь незначительные негативные последствия для здоровья (5).По этой причине и потому что немногие потребители кофеина сообщают о потере контроля над своим кофеином прием, государственные регулирующие органы не налагают ограничений на его использование. В большинстве газированных напитков содержится кофеин. намеренно добавлен, чтобы вызвать привыкание. Однако кофеин в газированные напитки усваиваются легче, чем другие негазированные напитки. Большинство газированных безалкогольных напитков также содержат фосфорную кислоту, кофеин, сахар или аспартам или сахарин, карамельный краситель, углекислый газ и алюминий.Каждый из доказано негативное влияние на человека здоровье (5).

      Известно, что кофеин вызывает привыкание. способность стимулировать умственную активность, преодолевать усталость и повысить выносливость. Кофеин блокирует аденозин. (нейротрансмиттерные) рецепторы в центральной нервной системе, а аденозин вообще проявляет угнетающее действие на головной мозг, сердце и почки. Результирующая стимуляция сопровождается сужение мозговых артерий, учащенное сердцебиение, высокая кровяное давление и чрезмерное выделение мочи.Случаи смертельные исходы и судороги, связанные с употреблением кофеина, ранее выявлено (4,5) из-за сочетания избыточного кофеина приема пищи и сердечно-сосудистых заболеваний. Более того, в ряде исследований сообщили о более слабой компенсаторной реакции после употребления калорийные жидкости (6,7). Предыдущие исследования изучали влияние потребления энергии на гистологию и активность мозга (6–9). Это Сообщалось, что сода оказывала неблагоприятное воздействие на мозжечок, в то время как недиетическая газировка оказывала вредное воздействие (10).

      На Ближнем Востоке, особенно в Саудовской Аравии, для людей характерно употребление газированных безалкогольных напитков 3 раза в день с каждым приемом пищи. Поэтому настоящее исследование было проведено изучить влияние хронического употребления трех распространенных напитков в Саудовской Аравии (Cola, Pepsi и 7-UP) на окислительный стресс, уровни антиоксидантов, маркеры агрессии и гистопатология мозга, чтобы обрисовать в общих чертах их потенциальное влияние на мозг Wistar крысы. Кроме того, влияние безалкогольных напитков на экспрессию и активность определенных генов, связанных с тревогой, насилием и/или агрессия, такие как моноаминоксидаза (МАО) и дофамин D2 рецепторы (DD2R).

      Материалы и методы
      Химикаты и наборы

      Этидия бромид, агароза, гематоксилин Майера и эозин (H&E) и трис-борат-ЭДТА (TBE) были приобретены у Sigma-Aldrich (Сент-Луис, Миссури, США). Крысы-альбиносы Wistar были приобретено в Центре научных исследований короля Фахда, король Университет Абдель-Азиза (Джидда, Саудовская Аравия). Серологические наборы для каталазы, малонового диальдегида (МДА), глутатионредуктазы (ГР) и глутатионпероксидазы (GPx) были приобретены у компании Bio-diagnostic. Ко., (Гиза, Египет). Кола (Атланта, Джорджия, Пепси (ПепсиКо, Покупка, Нью-Йорк, США) и 7-UP (Dr Pepper Snapple Group, Inc., Плано, Техас, США) были использованы. Лестница ДНК длиной 100 п.н. была приобретена у MBI, Fermentas, Термо Фишер Сайентифик. Inc. (Уолтем, Массачусетс, США). Циазол для РНК праймеры для экстракции и oligo dT были приобретены у Qiagen, Inc., (Валенсия, Калифорния, США).

      Животные, экспериментальный дизайн и выборка

      Все процедуры с животными были одобрены Этическим комитетом. Офис комитета Таифского университета (Таиф, Саудовская Аравия).Сорок Для исследования использовали крыс-самцов линии Вистар (возраст 3 месяца, масса 200–280 г). эта учеба. Для акклиматизации животных обрабатывали ежедневно и находиться под наблюдением в течение 1 недели до начала эксперимент. Животных содержали при 12-часовом цикле свет-темнота. имели свободный доступ к еде и воде. Животные были разделены на следующие 4 группы: Контрольная группа (CNT) без любое лечение; группа колы; Группа Pepsi и группа 7-UP. Группы 2–4 получили бесплатный доступ к еде и только газированным безалкогольным напиткам на 3 месяцев подряд.По истечении 3 месяцев все крысы были анестезировали ингаляцией диэтилового эфира и умерщвляли через обезглавливание. Кровь собирали в пробирки вакутейнера из ретроорбитальные венозные сплетения после анестезии. Мозг ткани из правого полушария были собраны для гена экспрессия и ткани левого полушария использовались для гистопатологические анализы. Сыворотку брали после крови центрифугирование в течение 10 мин при 4000×g. Для экспрессии генов При анализе ткани головного мозга выдерживали в реагенте QIAzol при -80°C в течение Экстракция РНК и 10% нейтральный забуференный формалин (NBF) при комнатной температуре. температура в течение 24 ч для гистопатологического и иммуногистохимического анализ.

      Химический анализ сыворотки

      Каталазу, GR, GP и MDA измеряли с использованием коммерческие наборы для спектрофотометрического анализа (Bio-Diagnostic Компания, Гиза, Египет). Уровни МАО и ацетилхолинэстеразы (АХЭ) были измерены с помощью коммерческого иммуноферментного анализа наборы, полученные от MyBioSource, Co. (Сан-Диего, Калифорния, США). Все процедуры проводились в соответствии с протоколом производителя. Уровни экспрессии мРНК глутатион-S-трансферазы (GST) и Транспортер 5-гидрокситриптамина (5-HTT) оценивали с помощью полимеразная цепная реакция с обратной транскрипцией (ОТ-ПЦР) анализ.

      Анализ экспрессии генов

      Суммарная РНК была выделена из ткани головного мозга. образцы, как описано ранее (11). Концентрация и чистота РНК были определяется спектрофотометрически после измерения оптической плотность при 260 и 280 нм с использованием спектрофотометра SmartSpec Plus (Био-Рад, Геркулес, Калифорния, США). Целостность РНК была подтверждена после прогонка в 1,5% денатурированном агарозном геле, окрашенном этидием бромид. Смесь 3 мкг тотальной РНК и 0,5 нг олиго-дТ праймер (Qiagen Inc., Валенсия, Калифорния, США) использовали для кДНК синтез в общем объеме 11 мкл стерилизованный диэтилпирокарбоната (DEPC) и инкубировали в биореакторе Bio-Rad. Термоциклер T100 (Bio-Rad) при 65°C в течение 10 мин для денатурации. Затем 2 мкл 10X RT-буфера, 2 мкл 10 мМ dNTP и 100 единиц обратной транскриптазы вируса мышиного лейкоза Молони (СибЭнзим. Ак, Новосибирск, Россия) и доводили до общий объем 20 мкл с водой DEPC. Затем смесь была реинкубировали в термоциклере при 37°С в течение 1 ч, затем при 90°С в течение 10 мин для инактивации фермента.Для полуколичественной ОТ-ПЦР анализа, специфические праймеры для исследуемых генов (таблица I) были сконструированы с использованием Oligo-4 компьютерная программа (версия 7; Molecular Biology Insights, Колорадо) Спрингс, Колорадо, США) и синтезированы Macrogen (Macrogen Inc., Гасадонг, Корея). ПЦР проводили в конечном объеме 25 мкл, состоящий из 1 мкл кДНК, 1 мкл 10 пМ каждый праймер (прямой и обратный) и 12,5 мкл мастер ПЦР микс (Promega Corporation, Мэдисон, Висконсин, США), объем был составлен до 25/мкл с использованием стерилизованной деионизированной воды.ПЦР была проведена с использованием термоциклера Bio-Rad T100 со следующим циклом последовательность: 94°C в течение 5 мин для одного цикла, затем 27–31 цикл (Таблица I), каждый из которых состоял денатурации при 94°С в течение 1 мин, отжига при специфических температура, соответствующая каждому праймеру (таблица I), и удлинение при 72°C в течение 1 мин. с дополнительным окончательным удлинением при 72°С в течение 7 мин. Как ссылка, экспрессия глицеральдегид-3-фосфатдегидрогеназы (GAPDH) исследовали мРНК (табл. Я). Продукты ПЦР визуализировали в УФ-свете после электрофорез 1.5% агарозы (Bio Basic Int., Markham, ON, Канада) гель, окрашенный бромистым этидием в буфере ТВЕ. ПЦР продукты были подтверждены с использованием лестницы ДНК длиной 100 п.н. и были впоследствии сфотографировано с использованием гелевой документации InGenius 3.0. система (Syngene, Фредерик, Мэриленд, США). Интенсивность полос были количественно определены денситометрически с использованием версии программного обеспечения Image J 1.47 (http://imagej.en.softonic.com/).

      Таблица I

      Условия полимеразной цепной реакции последовательность праймеров исследуемых генов.

      Таблица I

      Условия полимеразной цепной реакции последовательность праймеров исследуемых генов.

      Gene Размер продукта (bp) Отжиг Направление Последовательность (5′-3′)
      GST 570 55 Вперед GCTGGAGTGGAGTTTGAAGAA
      Реверс GTCCTGACCACGTCAACATAG
      GPx 406 57 Вперед AAGGTGCTGCTCATTGAGAATG
      Реверс CGTCTGGACCTACCAGGAACTT
      MAOA 492 60 Вперед ATGGATGAAATGGGAAAAGAGAT
      Реверс ТААТТГГТТТЦТЦАГГТГГАА
      АЧЭ 785 55 Вперед GACTGCCTTTATCTTAATGTG
      Реверс CGGCTGATGAGAGATTCATTG
      DD2R 488 55 Вперед CCTGAGGACATGAAACTCTGC
      Реверс TAGAGGACTGGTGGGATGTTG
      5-HTT 448 55 Вперед CTCTGGCTTCGTCATCTTCAC
      Реверс GCTGCAGAACTGAGTGATTCC
      GAPDH 309 52 Вперед AGATCCACAACGGATACATT
      Реверс TCCCCTCAAGATTGTCAGCAA
      Гистопатология головного мозга

      Мозг был удален после вдыхания диэтилового эфира крыс умерщвляли и фиксировали в течение ночи в 10% NBF. решение.Фиксированные ткани мозга обрабатывали рутинно, промывали и консервированный в 70% этаноле, обезвоженный в восходящих сортах этанола раствор, очищенный в ксилоле, залитый парафином, спрессованный и нарезать на секции по 5 мкм. Впоследствии секции были помещают поверх предметных стекол. Слайды были окрашены по Майеру. ГЭ (12). Слайды тканей были визуализировали с помощью микроскопа Wolfe S9–0982 (Carolina Biological Supply Co., Берлингтон, Северная Каролина, США), а фотографии были сделаны с помощью Цифровой фотоаппарат Canon Power-Shot SX500 IS (Canon, Токио, Япония).

      Статистический анализ

      Результаты представлены как среднее ± стандартная ошибка среднего. Данные были проанализированы с использованием дисперсионного анализа и метода Фишера. апостериорные описательные тесты с использованием программного обеспечения SPSS версии 11.5 (SPSS, Inc., Чикаго, Иллинойс, США). Регрессионный анализ был выполнен с использованием тот же софт. Считалось, что P<0,05 указывает на статистически значимая разница.

      Результаты
      Эффект газированного безалкогольного напитка потребление в течение 3 месяцев на сывороточные уровни MDA, GR, GPx и каталаза у крыс Wistar

      Потребление колы, пепси и 7-UP за 3 месяца показали значительное повышение уровня МДА (рис.1А; P<0,05) с наибольшим увеличение у крыс из группы пепси. Параллельно уровни антиоксидантов GR, GPx и каталазы у крыс были снижены значимо во всех группах принимали газированные безалкогольные напитки по сравнению с контролем. Примечательно, что наибольшие изменения произошли наблюдается у крыс из группы пепси (рис. 1Б-Г).

      Эффект газированного безалкогольного напитка потребления в течение 3 месяцев на экспрессию мРНК GST и GPx в ткани головного мозга крыс линии Вистар

      Как показано на рис.2, потребление газированных безалкогольных напитков в течение 3 месяцев снизило Экспрессия мРНК GST и GPx. Уровни экспрессии были значительно снизился на 50 и 40% в группах колы и пепси для GST и GPx соответственно (P<0,05). Хотя до сих пор значительно снижается по сравнению с контролем (P<0,05), крысы в ​​группе 7-UP демонстрировали повышенный уровень GST и GPx по сравнению с группами Cola и Pepsi.

      Эффект газированного безалкогольного напитка потребления в течение 3 мес на сывороточные уровни МАО-А и АХЭ в Крысы Вистар

      Далее изменения уровней МАО-А и АХЭ (рис.3) прошли обследование. Кола, Пепси и Потребление 7-UP в течение 3 месяцев привело к значительному снижению Уровни МАО и АХЭ (P<0,05). Крысы в ​​группе Pepsi выставлены наибольшее снижение уровней МАО-А и АХЭ по сравнению с остальные группы.

      Эффект газированного безалкогольного напитка потребления в течение 3 месяцев на экспрессию мРНК МАО-А и АХЭ в ткани головного мозга крыс линии Вистар

      На рис. 4 показано, что в соответствии с изменениями МАО-А и АХЭ в сыворотке, мРНК экспрессия МАО-А и АХЭ была значительно снижена в тканей головного мозга крыс, которым вводили газированные безалкогольные напитки (Р<0. 05). Крысы в ​​группе колы продемонстрировали наибольшее снижение в экспрессии МАО-А и АХЭ, за которыми следуют пепси и 7-UP, соответственно. Снижение не было выявлено как значительное отличается между группами Pepsi и 7-UP (рис. 4).

      Эффект газированного безалкогольного напитка потребление в течение 3 месяцев на экспрессию мРНК DD2R и 5-HTT в ткани головного мозга крыс линии Вистар

      Влияние потребления газированных безалкогольных напитков на экспрессия определенных генов, которые, как было показано, были исследованы связанные с агрессией.Как показано на фиг. 5А, экспрессия DD2R была снижена. значительно активировался у крыс при употреблении колы, пепси и 7-UP группы (р<0,05). Напротив, крысы в ​​этих группах демонстрировали значительное снижение экспрессии мРНК 5-HTT (фиг. 5B; P<0,05). Кроме того, крысы в группы колы и 7-UP продемонстрировали значительное снижение экспрессия 5-НТТ по сравнению с крысами в группе пепси (Р<0,05).

      Эффект газированного безалкогольного напитка расход на 3 месяца на гистопатологию головного мозга

      Хотя изменения, вызванные газированными безалкогольными напитками наблюдались на биохимическом и молекулярном уровнях, гистопатологический анализ показал нормальную архитектуру мозга у всех группы (рис. 6). Серое вещество крыс казались нормальными с его хорошо организованным регулярным расположены шесть слоев и различные по размеру и форме нервные клетки. То нормальная картина белого вещества образована гомогенно окрашенные нервные волокна, идущие вниз по коре, также были идентифицировано.

      Обсуждение

      Результаты текущего исследования подтвердили, что хронический потребление газированных безалкогольных напитков вызывает окислительный стресс и изменения экспрессии антиоксидантов в мозге крыс Wistar.Более того, потребление безалкогольных напитков снижало уровни в сыворотке крови и Экспрессия мРНК МАО и АХЭ в головном мозге. Примечательно, что это было также продемонстрировали, что уровни DD2R были снижены, а уровни экспрессии 5-HTT повышались в головном мозге, в то время как гистопатология головного мозга осталась неизменной.

      Окислительный стресс связан с этиопатогенез ряда хронических заболеваний и имеет ключевое роль в процессе старения (13). Одним из последствий неконтролируемого оксидативного стресса (дисбаланс между уровнями прооксидантов и антиоксидантов в пользу прооксиданты) — повреждение клеток, тканей и органов окислительными повреждать. Давно известно, что высокий уровень свободного радикалы или активные формы кислорода (АФК) могут напрямую повредить липиды. Основными источниками продукции эндогенных АФК являются митохондрии, плазматическая мембрана, эндоплазматический ретикулум и пероксисомы (14). АФК производится различными механизмами, в том числе ферментативными. реакции и/или самоокисление некоторых соединений, таких как катехоламины и гидрохинон. В этом исследовании хронические газированные потребление безалкогольных напитков вызвало окислительный стресс в мозге, поскольку на что указывает повышение уровня МДА в дополнение к снижению в экспрессии антиоксидантов, GR, GPx и каталазы.

      Газированные безалкогольные напитки содержат кофеин и фосфорная кислота. Кофеин вызывает выброс адреналина и сопровождающееся повышением уровня сахара в крови для производства необходимого энергия. Кофеин достигает своего максимального уровня в крови в течение 1 часа после употребления. потребляется и остается в организме в течение 4–6 ч (4,5). Кофеин в безалкогольных напитках вызывает увеличение выделения кислоты в желудок, что может привести к расстройству желудка или изжоге. Кроме того, сообщалось, что хроническое воздействие кофеина различные компоненты энергетических и безалкогольных напитков могут привести к значительные изменения в сердечно-сосудистой системе и головном мозге активность (15,16).Результаты настоящего исследования продемонстрировали изменение МАО-А и АХЭ в сыворотке и мРНК. уровни. МАО имеет 2 изофермента, А и В. МАО-А у человека кодируется ген МАОА (17,18). преимущественно дезаминирует норадреналин, адреналин, серотонин и дофамин (все одинаково дезаминируется МАО-А и МАО-Б). Ингибирование обоих МАО-А и МАО-Б с использованием ингибитора МАО применяют при лечении клинических депрессия, эректильная дисфункция и тревога. МАО-А был показан быть повышенным у пациентов с депрессией (19), и связь была между низкоактивными формами гена МАО-А и аутизм (20).неблагополучный Ген МАО-А также коррелирует с повышенной агрессией. уровни у мышей (21,22), а также при повышенных уровнях агрессия у людей (23). То результаты настоящего исследования показали, что потребление газированные безалкогольные напитки снижали экспрессию гена МАО-А и связаны со сверхчувствительностью, так как снижение МАО-А коррелирует с агрессией и насилием, это может свидетельствовать о потреблении газированные безалкогольные напитки коррелируют с повышенной агрессией и насилия, но это требует дальнейшего расследования.

      Хорошо известно, что холинергические нейроны участвует в нескольких нервно-психических функциях, таких как обучение, память и сон. Ацетилхолин играет ключевую роль в модуляции эти функции (24). Центральный холинергический дефицит тесно связан с определенными нейродегенеративные заболевания, такие как болезнь Альцгеймера и Болезнь Паркинсона (25). Имеются данные об аутизме вследствие дисфункции холинергической системы. недавно сообщалось (26). АХЭ является специфическим холинергическим маркерным белком функционального состояния холинергических нейронов. Это ключ к поддержанию уровень ацетилхолина в холинергических нейронах (27), поскольку он отвечает за деградацию ацетилхолина в ацетат и холин в синаптической щели. Примечательно, что в сыворотке наблюдалось снижение АХЭ и АХЭ. В головном мозге наблюдалось снижение экспрессии мРНК. Она имеет Ранее предполагалось, что нарушение ацетилхолина может быть основная причина депрессии и/или агрессии (28).

      Допамин является нейротрансмиттером катехоламинов. и семейства фенетиламинов, которые играют ряд ролей в человеческий мозг и тело.Существует 5 изоформ дофамина. рецептор, дофаминовые D1–5 рецепторы. DD2R является наиболее распространенным рецептором в мозгу млекопитающих. Антагонисты DD2R использовались десятилетиями. для лечения агрессивного поведения у психотических пациентов (29). Кроме того, в доклиническом исследовании роль дофаминовых рецепторов D1, D2 и D3 в модуляции зарегистрирована агрессия (30). Несколько исследований показали, что мезокортиколимбическая дофаминовая система участвует в подготовка, исполнение и последствия агрессивных действий (31–33). Фармакологически индуцированный дофамин увеличение связано с усилением агрессивного поведения при определенные условия (32,33). Результаты настоящего исследования продемонстрировали, что уровни DD2R повышаются после хронического употребление газированных безалкогольных напитков. Вероятно, это было связано с повышение уровня дофамина в результате подавления Экспрессия МАО-А.

      Два основных фермента ответственны за катехоламины катаболизм в головном мозге: катехол-О-метилтрансфераза (КОМТ) и моноаминоксидаза А (МАО-А).Если агрессивное поведение усиливается катехоламинергической активности, затем снижается активность СОМТ и МАО-А должен косвенно повышать уровень агрессии (31,34).

      Было показано, что экспрессия

      5-HTT снижена. после хронического употребления газированных безалкогольных напитков. Количество Исследования показали, что повышенный уровень серотонина приводит к снижению агрессия у ряда видов (35), включая человека (36). Блокирует переносчик серотонина молекулы эффективны в уменьшении и предотвращении агрессивных поведения у людей и других животных, предположительно из-за повышенной уровни 5-НТ в мозге (35). Клинически блокирование 5-НТТ введением селективных ингибиторы обратного захвата серотонина (СИОЗС), уменьшающие агрессивные вспышки агрессивное поведение у психически больных (37–39). Кроме того, в моделях на животных острое и хроническое лечение с помощью СИОЗС могут дозозависимо снижать агрессивное поведение (40). Острое введение нескольких СИОЗС снижали агрессию в разных контекстах и ​​у разных видов, включая грызунов и нечеловеческих приматов (40,41). 5-HTT представляет собой тип белка-транспортера моноаминов, который транспортирует серотонина из синаптической щели в пресинаптический нейрон.Этот транспорт серотонина белком 5-НТТ прекращает действие серотонина и перерабатывает его зависимым от натрия образом. Этот Белок является мишенью для многих антидепрессантов, в том числе представители класса СИОЗС (42). А Полиморфизм длины повтора в промоторе этого гена был показано, что они влияют на скорость поглощения серотонина и могут играть роль при синдроме внезапной детской смерти, агрессивном поведении при болезни Альцгеймера пациентов с заболеваниями, посттравматическим стрессовым расстройством и склонность к депрессии у лиц, испытывающих эмоциональные травма (43). Это также было предположили, что изменения в уровнях экспрессии 5-HTT после употребление газированных безалкогольных напитков может быть предрасполагающим фактором для депрессии.

      Гистологическое исследование головного мозга показало, что мозг показал нормальную гистологию и распределение клеток после хронического употребления газированных безалкогольных напитков. Этот вывод также сообщалось в другом исследовании (10) для обычных безалкогольных напитков; Однако, Ранее было показано, что диетические безалкогольные напитки вызывают побочные эффекты. на мозжечке белых крыс (10).

      В заключении хронический срок безалкогольный газированный напиток потребление вызвало окислительный стресс и изменения в антиоксидантов и уровни экспрессии определенных генов, связанных с работой мозга. Таким образом, результаты настоящего исследования предположил, что употребление газированных безалкогольных напитков может вызвать побочные эффекты, поэтому эти напитки следует употреблять с осторожность.

      Благодарности

      Авторы благодарят Al-Saedan Research Кафедра генетических расстройств поведения, Таифский университет, Королевство Саудовской Аравии за финансовую поддержку.

      Ссылки

      1

      Adjene JO, Ezeoke JC и Nwose EU: Гистологические эффекты хронического употребления газированных напитков на почек взрослых крыс Wister. N Am J Med Sci. 2: 215–217. 2010. PubMed/NCBI

      .

      2

      Амато Д, Маравилья А, Гарсия-Контрерас Ф и Paniagua R: Безалкогольные напитки и здоровье. Rev Invest Clin. 49:387–395. 1997.

      3

      Амато Д., Маравилья А., Монтойя С., Гая О., Revilla C, Guerra R и Paniagua R: Острые эффекты безалкогольных напитков потребление на метаболизм кальция и фосфатов у неполовозрелых и взрослых особей крысы. Rev Invest Clin. 50:185–189. 1998. PubMed/NCBI

      .

      4

      Клаусон К.А., Шилдс К.М., МакКуин К.Е. и Persad N: Проблемы безопасности, связанные с имеющимися в продаже энергетические напитки. Ассоциация J Am Pharm (2003 г.). 48:е55–е67. 2008. Просмотр статьи : Академия Google

      5

      Iyadurai SJ и Chung SS: Новое начало судороги у взрослых: Возможная связь с потреблением популярные энергетические напитки.Эпилепсия Поведение. 10: 504–508. 2007. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      6

      DiMeglio DP и Mattes RD: Liquid против твердые углеводы: влияние на потребление пищи и массу тела. Международный J Obes Relat Metab Disord. 24: 794–800. 2000. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      7

      Mattes RD: Энергия жидкости – где проблема? J Am Diet Assoc. 106: 1956–1961.2006. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      8

      Фрэнк Г.К., Оберндорфер Т.А., Симмонс А.Н., Паулюс М.П., ​​Фадж Дж.Л., Ян Т.Т. и Кей У.Х.: Сахароза активирует человека вкусовые пути отличаются от искусственных подсластителей. Нейроизображение. 39: 1559–1569. 2008. Просмотр статьи: Google Scholar

      9

      Смитс П.А., де Грааф К., Стафлеу А., ван Ош MJ и ван дер Гронд Дж.: Функциональная магнитно-резонансная томография реакции гипоталамуса человека на сладкий вкус и калории.Ам Джей Клин Нутр. 82:1011–1016. 2005. PubMed/NCBI

      .

      10

      Элува М.А., Иньянгмме II, Акпантах АО, Ekanem TB, Ekong MB, Asuquo OR и Nwakanma AA: сравнительное исследование влияния диеты и газированных напитков на гистологию мозжечка взрослых самок белых крыс линии Вистар. Здоровье науч. 13: 541–545. 2013. PubMed/NCBI

      .

      11

      Солиман М.М., Абдо Нассан М. и Исмаил Т.А.: Иммуногистохимическое и молекулярное исследование защитного действия куркумин против печеночной токсичности, вызванной парацетамолом в Wistar крысы.BMC Комплемент Altern Med. 14:4572014. Просмотр статьи : Академия Google : PubMed/NCBI

      12

      Bancroft JD и Gamble M: ​​теория и применение гистологических методов. 6-е изд. Черчилль Ливингстон Эльзевир; Филадельфия: стр. 126–127. 2008

      13

      Чекони С, Борасо А, Карньони А и Феррари Р: Окислительный стресс при сердечно-сосудистых заболеваниях: миф или факт? Арка Биохим Биофиз.420:217–221. 2003. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      14

      Молдавский L и молдавский NI: бескислородный радикалы и окислительно-восстановительная биология органелл. Гистохим клеточной биологии. 122: 395–412. 2004. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      15

      Хиггинс Дж. П., Таттл Т. Д. и Хиггинс С. Л.: Энергетические напитки: содержание и безопасность. Мэйо Клин Proc. 85:1033–1041. 2010. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      16

      Усман А. и Джавайд А.: Гипертония в молодой мальчик: эффект энергетического напитка.Примечания BMC Res. 5:5

      2. Просмотр статьи : Академия Google : PubMed/NCBI

      17

      Hotamisligil GS и Breakefield XO: Человек Ген моноаминоксидазы А определяет уровни активности фермента. Ам Дж Хам Жене. 49:383–392. 1991. PubMed/NCBI

      .

      18

      Де Колибус Л. , Ли М., Бинда С., Люстиг А., Эдмондсон Д.Э. и Матеви А.: Трехмерная структура человека моноаминоксидаза А (МАО А): связь со структурами МАО крысы А и МАО человека Б.Proc Natl Acad Sci USA. 102:12684–12689. 2005. Просмотр статьи : Академия Google : PubMed/NCBI

      19

      Мейер Дж. Х., Гиноварт Н., Буваривала А., Саграти С., Хасси Д., Гарсия А., Янг Т., Пращак-Ридер Н., Уилсон А.А. и Хоул С.: Повышенный уровень моноаминоксидазы а в головном мозге: Объяснение дисбаланса моноаминов большой депрессии. Арх генерал психиатрия. 63:1209–1216. 2006. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      20

      Коэн И.Л., Лю Х., Льюис М.Е., Чадли А., Форстер-Гибсон К., Гонсалес М., Дженкинс Э.К., Браун В.Т. и Холден Дж.Дж.: Тяжесть аутизма связана с МАОА ребенка и матери генотипы.Клин Жене. 79:355–362. 2011. Просмотр статьи : Google Scholar

      21

      Скотт А. Л., Бортолато М., Чен К. и Ши Дж.К.: Новая моноаминоксидаза А нокаутирует мышей с человеческим спонтанная мутация. Нейроотчет. 19: 739–743. 2008. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      22

      Вишнивецкая Г.Б., Скринская Ю.А., Сейф И. и Попова Н.К. Влияние дефицита МАО А на различные виды агрессии и социальных исследований у мышей.Агрессивное поведение. 33:1–6. 2007. Посмотреть Статья : Google Scholar : PubMed/NCBI

      23

      Бруннер Х.Г., Нелен М., Брейкфилд Х.О., Роперс Х.Х. и ван Ост Б.А.: Аномальное поведение, связанное с точечная мутация в структурном гене моноаминоксидазы А. Наука. 262: 578–580. 1993. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      24

      Мохапель П., Леанза Г., Кокая М. и Линдвалл O: Ацетилхолин переднего мозга регулирует нейрогенез гиппокампа у взрослых. и обучение.Нейробиол Старение. 26:939–946. 2005. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      25

      Oda Y: Холинацетилтрансфераза: структура, распределение и патологические изменения в центральной нервная система. Патол Инт. 49:921–937. 1999. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      26

      Лам К.С., Аман М.Г. и Арнольд Л.Е.: Нейрохимические корреляты аутистического расстройства: обзор литература.Res Дев Disabil. 27:254–289. 2006. Просмотр статьи : Google Scholar

      27

      Экенштейн Ф. и Софронев М.В.: Идентификация центральных холинергических нейронов, содержащих оба холин-ацетилтрансферазы и ацетилхолинэстеразы и центральной нейроны, содержащие только ацетилхолинэстеразу. Дж. Нейроски. 3: 2286–2291. 1983. PubMed/NCBI

      .

      28

      Shytle RD, Silver AA, Lukas RJ, Newman MB, Шиэн Д.В. и Санберг П.Р.: Никотиновые ацетилхолиновые рецепторы как мишени для антидепрессантов.Мол Психиатрия. 7: 525–535. 2002. Просмотр статьи : Академия Google : PubMed/NCBI

      29

      Glazer WM и Dickson RA: Клозапин уменьшает насилие и постоянную агрессию при шизофрении. Джей Клин Психиатрия. 59 (Приложение 3): 8–14. 1998. PubMed/NCBI

      .

      30

      Мичек К.А., Ковингтон Е.Е. III, Никулина Е.М. Jr и Hammer RP: Агрессия и поражение: постоянные эффекты на самоуправление кокаином и экспрессия генов в пептидергических и аминергические мезокортиколимбические цепи.Neurosci Biobehav Rev. 27:787–802. 2004. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      31

      де Алмейда РМ, Феррари ПФ, Пармиджани С и Мичек К.А.: Эскалация агрессивного поведения: дофамин, серотонин и ГАМК. Евр Дж Фармакол. 526:51–64. 2005. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      32

      Ferrari PF, ван Erp AM, Tornatzky W и Мичек К.А.: Аккумбал допамина и серотонина в ожидании следующий агрессивный эпизод у крыс.Евр Джей Нейроски. 17: 371–378. 2003. Просмотр статьи : Академия Google : PubMed/NCBI

      33

      Ferrari PF, Palanza P, Parmigiani S, de Алмейда Р.М. и Мичек К.А.: Серотонин и агрессивное поведение в грызуны и нечеловеческие приматы: предрасположенность и пластичность. Евро J Фармакол. 526: 259–273. 2005. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      34

      Гогос Дж. А., Морган М., Луине В., Санта М., Огава С., Пфафф Д. и Карайоргу М.: Мыши с дефицитом катехол-О-метилтрансферазы проявляют половую активность. диморфные изменения уровня катехоламинов и поведения.Прок Натл Академия наук США. 95:9991–9996. 1998. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      35

      Кьявегатто С. и Нельсон Р.Дж.: Взаимодействие оксида азота и серотонина в агрессивном поведении. Хорм Бехав. 44:233–241. 2003. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      36

      Кокаро Э.Ф. и Кавусси Р.Дж.: Нейропсихофармакологические проблемы в биологической психиатрии.Клин хим. 40:319–327. 1994. PubMed/NCBI

      .

      37

      Баркан Т, Пелед А, Модаи И, Барак П, Вейцман А. и Рехави М.: Характеристики переносчика серотонина в лимфоциты и тромбоциты мужчин с агрессивной шизофренией по сравнению с неагрессивными больными шизофренией. Евро Нейропсихофармакол. 16: 572–579. 2006. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      38

      Blader JC: Фармакотерапия и исходы после выписки детей, поступивших в стационар по поводу агрессивного поведение.J Clin Psychopharmacol. 26:419–425. 2006. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      39

      Бонд ЭйДжей: лечение антидепрессантами и человеческая агрессия. Евр Дж Фармакол. 526: 218–225. 2005. Просмотр статьи: Google Scholar: PubMed/NCBI

      .

      40

      Каррильо М., Риччи Л.А., Копперсмит Г.А. и Меллони Р. Х. мл.: Эффект повышенного серотонинергического нейротрансмиссия при агрессии: критический метааналитический обзор доклинических исследований.Психофармакология (Берл). 205:349–368. 2009. Просмотр статьи: Google Scholar

      41

      Колдуэлл Э. Э. и Мичек К.А.: Долгосрочная перспектива поддержание циталопрама у мышей: избирательное снижение алкогольная агрессия. Психофармакология (Берл). 196: 407–416. 2008. Просмотр статьи: Google Scholar

      42

      Дойч А.Я. и Рот Р.Х.: Нейротрансмиттеры. Фундаментальная неврология. Сквайр Л., Берг С., Блум Ф., дю Лак С., Гош А. и Спитцер Н.: 3-е издание.Эльзевир/Академическая пресса; Амстердам: стр. 1432008

      43

      Холмс А., Мерфи Д.Л. и Кроули Дж.Н.: Снижение агрессии у мышей, лишенных переносчика серотонина. Психофармакология (Берл). 161: 160–167. 2002. Просмотр статьи: Google Scholar

      Опасные последствия регулярного употребления «диетических» безалкогольных напитков согласно научным данным

      Это автоматический машинный перевод статьи, опубликованной Business Insider, на другом языке. Машинные переводы могут генерировать ошибки или неточности; мы продолжим работу по улучшению этих переводов. Вы можете найти оригинальную версию здесь .

      Диетическая газировка — популярный продукт, который часто рассматривается, когда вы хотите потреблять меньше калорий и меньше сахара.

      Что может привести вас к ошибочному мнению, что они являются более здоровой альтернативой «обычным» версиям.

      Но правда в том, что научные данные неоднократно показывали, что диета газированные напитки не являются более здоровым выбором и могут даже не помочь с целью не прибавления в весе.

      Низкокалорийные безалкогольные напитки могут вызывать ожирение

      Диетические газированные напитки используют бескалорийные искусственные подсластители вместо сахара для достижения их сладкого вкуса.

      Так что неудивительно, что многие думают, что с меньшим количеством калорий и без сахара окажет меньшее влияние на фигуру.

      Но, согласно некоторым исследованиям, это может быть не такая прямая связь.

      Согласно исследованию 1454 участников (741 мужчина, 713 женщин) в течение 10 лет, употребление низкокалорийных подсластителей было связано с «более высоким относительным весом, большей талией и более высокой распространенностью и частотой абдоминального ожирения». .

      Аналогичные выводы были сделаны в исследовании, опубликованном в Американском журнале общественного здравоохранения , которое показало, что 1 из 5 избыточного веса и ожирения U.S. взрослые употребляют диетические напитки .

      лучший напиток для похудения — это  вода.

      Некоторые исследования показали серьезное воздействие этих продуктов на здоровье.

      Как он объясняет Healthline диетическая кола в основном представляет собой смесь газированной воды, натуральных или искусственных подсластителей, красителей, ароматизаторов и других пищевых добавок.

      Другими словами, по питательности они вам ничего не обеспечат.

      Но они также могут иметь негативные последствия для вашего организма.

      Употребление диетической газировки было связано с метаболическим синдромом и более высоким риском инсульта и деменции по сравнению с теми, кто регулярно пьет газированные безалкогольные напитки.

      В 2018 году исследование, представленное Американскому обществу, показало, что подсластители (такие как сахар , а также стевия или аспартам) могут привести к ожирению и диабету .

      Несколькими годами ранее, в 2015 году, другое исследование показало, что искусственно подслащенные напитки также могут быть связаны с увеличением диабет .

      Что «низкокалорийные» напитки делают с вашим мозгом и вашим телом

      Многие из этих напитков, такие как Diet Coke, содержат аспартам для подслащивания .Несколько спорное вещество, так как некоторые считают, что оно может нанести вред здоровью.

      Несколько регулирующих органов и организаций, связанных со здоровьем, высказались в пользу аспартама, в том числе Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA), Всемирная организация здравоохранения (ВОЗ) и Европейское управление по безопасности пищевых продуктов (EFSA).

      Именно в 2013 году исследование, проведенное Европейским агентством, пришло к выводу, что «аспартам и продукты его распада безопасны для населения в целом (включая младенцев, детей и беременных женщин).

      Известный как номер E (E 951) EFSA считает, что допустимая суточная доза (ADI) в размере 40 мг/кг массы тела в день «обеспечивает защиту для населения в целом, а воздействие аспартама на потребителей оценивается значительно ниже этого ADI. »

      Употребление одного сладкого напитка в день может увеличить риск сердечно-сосудистых заболеваний.В выводах говорилось, что его потребление может иметь вредные последствия для здоровья даже без превышения этого количества.

      «Аспартам и его метаболиты, потребляемые в количествах, значительно превышающих рекомендуемую безопасную дозу или в пределах рекомендуемых безопасных уровней, могут изменять баланс оксидантов/антиоксидантов , вызывать окислительный стресс и повреждать целостность клеточных мембран, потенциально влияя на различные клеток и тканей и вызывая нарушение регуляции клеточной функции, что в конечном итоге приводит к системному воспалению», — говорится в их выводах.

      В целом, большая часть этих данных основана на обсервационных исследованиях, поэтому, как указывает Healthline , , невозможно узнать, является ли потребление этих безалкогольных напитков непосредственной причиной или связано только с фактическим причина, порождающая эти проблемы.

      Но так как диетические газированные напитки не приносят ничего питательного вашему организму , лучше пить их только изредка.

      Как негазированные напитки способствуют укреплению здоровья

      В преддверии сезона гриппа трудно представить, что в 2020 году внимание к вопросам здоровья и болезней может сиять ярче, чем это уже было в 2020 году. От передового опыта личной гигиены до безопасного обслуживания гости в общественном питании, доступность вакцин и медицинской помощи, как правильно справляться с симптомами и выздоравливать, списки бесконечны. Один из принципов здоровья, к которому я твердо отношусь, — это увлажнение, особенно сейчас.

      Что такое негазированные напитки?

      По опыту мы знаем, что все большее число потребителей ищут варианты негазированных напитков, и до недавнего времени напитки в бутылках были лучшим способом предоставить такие варианты. Бутилированная вода, морсы и энергетические напитки все чаще продаются в ресторанах быстрого обслуживания и магазинах шаговой доступности. Если вы хотите расширить свои возможности, не упускайте из виду варианты напитков из фонтана, предлагая негазированные напитки.

      За последние годы разнообразие вариантов фонтанов выросло до такой степени, что теперь возможно и довольно легко иметь автомат для напитков из фонтана, который подает негазированные напитки.Многие магазины и рестораны пришли к выводу, что возможность предлагать гостям сочетание газированных и негазированных напитков является оптимальным для их имиджа и успеха в бизнесе.

      Еще десять лет назад чай со льдом, найденный в фонтанчиках, почти всегда был газированным, и единственным доступным негазированным вариантом была, скорее всего, вода. Сегодня вы можете наполнить свою фонтанную машину всем перечисленным и даже больше:

        • Несладкий и подслащенный чай
        • Лимонад
        • Фруктовый пунш
        • Спортивные напитки
        • Апельсиновый сок
        • Улучшенная вода
        • Газированная вода
        • Ароматизированная вода
        • Вкусовые шоты

      Этот широкий выбор негазированных напитков предлагает потребителям всех типов возможность наслаждаться более полезными напитками во время еды по разумной цене.И хотя стоимость для потребителя ниже, чем стоимость напитков в бутылках, прибыль для предприятий выше, чем если бы потребитель купил напиток в бутылках, что делает добавление этих вариантов фонтана для негазированных напитков выигрышным для всех вовлеченных сторон.

      Потребность в негазированных напитках

      Негазированные напитки в настоящее время переживают значительный рост с точки зрения доступности в фонтанных автоматах. Фактически, негазированные напитки в настоящее время являются самой быстрорастущей категорией напитков в фонтанах. Это не потому, что потребители специально ищут напитки без газирования, мы все по-прежнему любим нашу газировку. Основная причина такого ускоренного роста заключается в том, что все больше потребителей ищут более здоровые варианты, которые также вкусны и предлагают уникальный опыт.

      Потребители, которые ищут напитки с низким содержанием сахара, настоящим сахаром и более здоровыми напитками, просто начинают тяготеть к различным вариантам напитков, которые считаются более полезными для здоровья, включая чай, воду и фруктовые напитки. В то время как более высокие продажи этих типов напитков в фонтанных автоматах могут снизить продажи бутилированных версий этих типов напитков, владельцы магазинов и ресторанов, как правило, получают более высокую прибыль от продажи напитков из фонтанов.Варианты негазированных фонтанов отлично подходят для вашего бизнеса. Чем больше вариантов у вас есть, которые могут удовлетворить конкретные желания, тем лучше.

      Увлажнение играет ключевую роль в восстановлении

      Providence Health опубликовала статью под названием «Питание и гидратация имеют решающее значение для восстановления после COVID-19», в которой перечисляется важность питания и гидратации в восстановлении после вируса COVID-19. Он указал на ресурс Aspen со ссылкой на то, что только около 12% пострадавших от COVID-19 нуждаются в госпитализации, а остальные 88% — это люди, которые будут лечить болезнь и выздоравливать дома.

      «В случае инфекции организм должен интенсивно работать, чтобы вызвать иммунный ответ. Высокая температура — это способ иммунной системы ускорить обмен веществ, чтобы «сразиться с вирусом». к обезвоживанию и повышенной потребности в питательных веществах

      Даже если вы не испытываете ни жажды, ни голода, важно, чтобы вы продолжали есть и пить жидкости, чтобы поддерживать способность вашего организма бороться с вирусом и поддерживать иммунную функцию вашего организма.Белки и калории важны для защиты от потери мышечной массы во время борьбы с COVID-19, особенно если вы прикованы к постели или ведете малоподвижный образ жизни.

      Пищевые потребности:

      • Жидкость: около 3 литров жидкости в день
      • калорий: 2000 — 2500 калорий в день
      • Белок: 75–100 г в день

      Пейте жидкости каждый час:

      • Вы должны выпивать как минимум 2–4 унции жидкости каждые 15 минут. Оптимальными жидкостями для питья являются прозрачные жидкие напитки с калориями и белком, растворы для пероральной регидратации или спортивные напитки».

      Чтобы прочитать статью полностью, нажмите на ссылку.

      Переключение на негазированные фонтанчики

      Если в вашем бизнесе уже есть фонтанная машина, сменить предлагаемую вами продукцию довольно просто. Когда вы решите, какие варианты негазированных газированных напитков вы хотели бы предложить, просто поговорите со своим поставщиком, чтобы начать заказывать эти новые продукты.

      Если ваши нынешние фонтанные вкусы хорошо продаются, и вы не хотите вносить слишком много радикальных изменений в то, что вы предлагаете, ничего страшного. Многие заведения просто добавляют вторую меньшую фонтанную машину или «чайную башню», которая предлагает различные негазированные варианты, которые предпочитают некоторые из их потребителей и гостей. Другие предприятия предпочитают инвестировать в негазированные фонтаны и модернизировать их до более крупного фонтана, который может вместить больше вкусов, вместо того, чтобы удалять опции или добавлять второй автомат.

      Тот факт, что вы решили добавить негазированные напитки к вашему выбору напитков, не означает, что вам нужно уменьшить или прекратить предлагать газированные напитки — у вас, безусловно, останется большое количество потребителей, которые предпочитают эти варианты. Негазированные напитки — это просто вариант, популярность которого продолжает расти. Они растут достаточно быстро, поэтому предлагать их потребителям — это еще один новый способ дальнейшего расширения того, как ваш бизнес получает прибыль от газированных напитков.

      Примечание автора. Этот пост был первоначально опубликован в мае 2017 г. и дополнен самыми последними исследованиями и информацией.

      Причины и последствия употребления газированных напитков

      Цель нашего исследования — сосредоточиться на побочных эффектах газированных напитков, чтобы повысить осведомленность каждого потребителя, который хочет обезопасить свое будущее от опасностей, связанных с газированными напитками, обычно называемыми «безалкогольными напитками».

      Возникла потребность в исследованиях, так как это одна из забытых областей, поэтому дальнейшие исследования в этом отношении, несомненно, помогут в повышении осведомленности, просвещении масс и в разработке программ профилактики, укрепления и лечения здоровья в сообществе. .Поскольку знания наших людей, особенно студентов, о побочных эффектах употребления газированных напитков неудовлетворительны. Отношение студентов относительно лучше, но их практика не является ни профилактической, ни оздоровительной. Таким образом, существует потребность в «изменении поведения» у молодежи.

      Получите помощь в написании эссе по уходу

      Если вам нужна помощь в написании эссе по сестринскому делу, наша профессиональная служба написания эссе по сестринскому делу всегда готова помочь!

      Узнать больше

      Прежде чем обсуждать причины и последствия употребления газированных напитков, дайте нам знать, каково отношение.Отношение к чему-то очень важно для жизни человека, потому что облегчает общение между людьми. Это один из важных атрибутов человека, который передает его первое впечатление о других и характер его личности. Тип личности является одним из важнейших элементов в формировании жизни человека. Поэтому отношение к чему-либо очень важно определить с самого начала, чтобы на следующих этапах жизни человек мог учиться и формировать свое отношение соответствующим образом.

      Таким образом, чтобы изменить отношение людей к чему-либо, осознание является первым шагом и одним из эффективных инструментов, помогающих людям учиться и обучаться очень эффективно, предоставляя им знания, проливая свет и исследуя неисследованные вопросы, которые прямо или косвенно влияют на нашу жизнь. Одним из важных, но игнорируемых вопросов в нашей жизни является здоровье. Нам нравится сначала страдать от проблем и болезней, а затем искать решения; этот тип подхода называется пост-подходом.Мы, как нация, нуждаемся в предварительном подходе, особенно в области здравоохранения. Одно из великих высказываний определяет лучшее:

      «Профилактика лучше лечения».

      Газированные напитки — это напитки, содержащие двуокись углерода (бесцветный и безвкусный газ), за исключением алкоголя. Среди всех безалкогольных напитков кола является самой популярной. Ингредиентами такой колы являются подсластители и химические вещества, такие как угольная и фосфорная кислоты, лимонная кислота, которая вредит зубам и вызывает слабость костей.Кола содержит разумное количество кофеина. Кофеин является естественным мочегонным средством, поэтому он может усилить жажду и вызвать обезвоживание.

      Разнообразные безалкогольные напитки ежедневно потребляются большим процентом населения. Потребление безалкогольных напитков в наибольшем количестве наблюдается преимущественно у детей и подростков. В текущем исследовании база знаний студентов о вредном воздействии газированных напитков не является удовлетворительной. Уильям Фрейзер говорит:

      «Чтобы нейтрализовать стакан колы, требуется 32 стакана щелочной воды с высоким pH.”

      В 1840-х годах в газированную воду стали добавлять ароматизаторы. На рубеже 1900-х годов газированные напитки стали частью выбора напитков типичного западного потребителя. Первоначально газированные напитки считались полезными для здоровья или способом распространять полезные для здоровья продукты таким образом, чтобы их было приятно и удобно пить. Газированные напитки продавались как средства для пищеварения еще в 1950-х годах. Затем их стали рассматривать как нездоровую пищу, поскольку этот термин, по сути, стал означать «газированные напитки».

      Сейчас (2007 г.) часть индустрии газированных напитков пытается переименовать себя в энергетические напитки, а натуральные напитки, такие как вода, соки и различные чаи, были газированы. Вероятно, первым газированным напитком, который продавался в банках, был имбирный эль Cliquot Club в 1938 году. (практически edible.com)

      В медицинской и научной сфере существует постоянная обеспокоенность причинами и влиянием газированных напитков на здоровье потребителей, но, к сожалению, до сих пор их вредное воздействие не было широко изучено. Тем не менее, некоторые исследователи выявили вредное воздействие колы на здоровье, но они не могут повысить осведомленность потребителей, возможно, потому, что им не дают места для разоблачения.

      Согласно исследованию Гималайского института медицинских наук (H.I.M.S.), Дехрадун, около 92,10% студентов-медиков и 95,08% студентов-медиков когда-либо слышали о газированных напитках. Цель исследования состояла в том, чтобы оценить осведомленность, отношение и практику студентов в отношении газированных напитков.(Кишор, Аггарвал и Музаммил, октябрь-декабрь 2009 г.)

      В метаанализе 88 исследований была обнаружена четкая связь между потреблением безалкогольных напитков и увеличением массы тела. Также было обнаружено, что повышенное потребление безалкогольных напитков связано со снижением потребления кальция и повышенным риском возникновения многочисленных медицинских проблем, например, диабета. Таким образом, была обнаружена тесная связь между потреблением безалкогольных напитков и питанием и влиянием на здоровье. (Вартанян, Шварц и Браунелл, 2007 г.)

      В ряде обсервационных исследований и отчетов был сделан вывод о том, что газированные напитки связаны с риском снижения костной массы и учащения переломов.Исследователи выяснили, что, в частности, кола имеет сильную связь с другими газированными напитками, и причиной такого неблагоприятного эффекта является содержание фосфорной кислоты в газированных напитках. (Хини и Рафферти, 2001 г.)

      Исследование было проведено для изучения причины остеопороза, и исследование пришло к выводу, что потребление колы связано с низкой минеральной плотностью костей (МПКТ) у женщин. (Такер, Кёко, Цяо, Ханнан и Киль, 2006 г.)

      Однако взаимосвязь между потреблением молока и риском переломов костей и потреблением безалкогольных напитков при остеопорозе у женщин и детей оказалась обратно и прямо пропорциональной соответственно.Тем не менее, зная об этих отношениях, женщины и дети все еще склоняются к чрезмерному потреблению безалкогольных напитков, и это быстро показало снижение отношения к молоку. (Сквиррес, Салли)

      Чрезмерное потребление газированных напитков повышает склонность к остеопорозу, особенно у детей и женщин. Фосфорная кислота и лимонная кислота являются двумя основными кислотными компонентами, которые играют решающую роль в повышении склонности к переломам костей. Фосфорная кислота удаляет эти питательные минералы, из-за чего кости ослабевают, что в агрессивных условиях приводит к перелому костей.Опрос, проведенный среди большого числа женщин-спортсменок, употребляющих газированные напитки, с целью изучения воздействия газированных напитков. Они обнаружили, что кислое содержимое является основной причиной растворения кальция из костей. (Спенсер, Крамер и Осис, 1988 г.)

      Лиэнн Берч, исследователь из Университета штата Пенсильвания, обнаружила, что безалкогольные напитки часто вытесняют питательные напитки, такие как молоко и соки. каждый этап роста человеческого тела.

      Заметный рост детского ожирения в этом поколении должен серьезно восприниматься родителями этих детей. Не только проблемы с ожирением, но и различные проблемы являются следствием высокого потребления ими газированных напитков. Эти проблемы со здоровьем могут включать диабет, кариес, остеопороз и многие неврологические расстройства. Дети обычно употребляют газированные напитки как нездоровую пищу. У них есть способность перенимать отношение других к чему-либо, и если они испытывают удовольствие, они делают свое отношение привычкой.В основном молодые люди более склонны к таким напиткам только из-за их отношения к потреблению газированных напитков в удивительном количестве, не зная о связанном с этим риске. (Кишор, Аггарвал и Музаммил, октябрь-декабрь 2009 г.). В связи с этим исследование, проведенное группой исследователей из Гарварда, показало, что 14-летние дети, которые не пьют по привычке, реже страдают ожирением, чем те, кто употребляет безалкогольные напитки.

      Газированные напитки могут вызывать значительное долговременное растворение эмали и оказывают более агрессивное воздействие на эмаль, чем кофе или чай. (Фраунгофер и Роджерс, 2004 г.)

      Чрезмерное потребление безалкогольных напитков может вызвать сложные стоматологические последствия, включая эрозию зубов и кариес, оба состояния могут привести к вредному воздействию на твердые ткани зубов. (Чэн, Ян и Шао, 2009 г.)

      Мы обнаружили две причины растворения эмали. Общие причины, приводимые стоматологами, заключаются в том, что низкое значение pH, большое количество сахаров и различные присадки в газированных напитках приводят к растворению эмали. Употребление таких напитков влияет на эмаль, твердый тонкий кальцийсодержащий слой, покрывающий и защищающий коронку зуба.По этому поводу проводятся многочисленные опросы. У мальчика, обследованного по этому поводу в 2002 г., который употреблял более двух напитков в день, во время работы за компьютерным терминалом отмечался неконтролируемый кариес зубов.

      NursingAnswers.net может вам помочь!

      Наши специалисты по медсестринскому делу и здравоохранению готовы и ждут помощи в любом письменном проекте, который у вас может быть, от простых планов эссе до полных диссертаций по сестринскому делу.

      Посмотреть наши услуги

      Во-вторых, установлено, что безалкогольные напитки более вредны для эмали в основном в двух случаях: при приеме в одиночку и при постоянном глотании.Тем не менее, во время еды безалкогольные напитки не могут влиять так сильно, как когда их принимают в одиночестве. Во время еды наш рот выделяет слюну, в результате чего кислоты и сахар не задерживаются на зубной эмали, а сохраняются при питье в одиночку, это чаще происходит с напитками колы, чем с другими напитками, что приводит к началу кариеса.

      Распространенная проблема, связанная с употреблением большого количества безалкогольных напитков, при которых повышается уровень кислоты во всем организме. Все газированные напитки очень кислые на вкус; особенно темные кола, такие как кока-кола и пепси, гораздо более кислые.(Кишор, Аггарвал и Музаммил, октябрь-декабрь 2009 г.)

      В газете «Аль-Рияд» от 20 августа 2006 г. опубликована новостная статья, в которой утверждается, что согласно научным и медицинским исследованиям:

      «Употребление пепси и колы приводит к раку, потому что ключевой элемент взят из свиной колбасы. Небесная книга Коран, Библия и Тора запрещают есть свинину, так как это единственное животное, которое питается грязью, навозом и мочой, что делает ткани смертоносными и смертоносными, зараженными микробами и микробами.”

      Индийский университет провел тесты на влияние потребления пепси и кока-колы, которые доказали, что их употребление приводит к учащению пульса и снижению давления. Кости, хранящиеся в чашке пепси, размягчаются в течение недели, зная, что кости умершего остаются в могиле тридцать лет. Само исследование подтвердило, что кальций растворяется в пепси и он ослабляет мочевой пузырь, почки; убивают поджелудочную железу, приводят к диабету и заразным заболеваниям. (pegham.com)

      Было проведено исследование газированных напитков, и среди всех безалкогольных напитков были приняты во внимание кока-кола и пепси.Некоторые, но не все, газированные напитки были связаны с повышенным риском развития рака поджелудочной железы примерно на 50-80% при регулярном употреблении в количестве 1+ порции. Таким образом, исследование пришло к выводу, что между газированными напитками и риском развития рака поджелудочной железы обнаружена тесная связь. (Чан, Ван и Холли, 2009 г.)

      Согласно Министерству здравоохранения и благосостояния семьи (д-р Амбумани Рамадос) разъяснил шаги, которые предприняло правительство, из отчета ПКД за 2003 г. другие более поздние напитки.Индия была одной из первых стран в мире, установивших стандарты для газированных напитков. (Кишор, Аггарвал и Музаммил, октябрь-декабрь 2009 г.)

      Также в большинстве обсервационных исследований показано, что кока-кола тесно связана с повышенным риском переломов костей. Во многих западных странах потребление молока сокращается из-за увеличения потребления безалкогольных напитков и фруктовых соков, что приводит к нездоровому образу жизни, поскольку молоко и вода являются основными продуктами для повседневной жизни и должны потребляться ежедневно для правильного роста и здоровья.

      Одним из ключевых моментов, который мы все должны учитывать, является то, что следует избегать чрезмерного использования чего-либо, особенно когда что-то связано со здоровьем человека, как мы все знаем: «Здоровье — это богатство». Поэтому осознание — это первый шаг к пониманию разницы между правильным и неправильным, хорошим и плохим, вредным и полезным.

      Подростки и дети не думают о долгосрочной перспективе, это обязанность взрослых людей или людей, которые обладают знаниями по этому забытому вопросу, должны просвещать массы об этом, чтобы наше молодое поколение могло знать и понимать вредное воздействие газированных напитков напитки и могут изменить свое отношение к таким напиткам.Они могут сократить потребление газированных напитков с колой или полностью перейти на питательные напитки, такие как молоко и соки. Однако, если потребители не изменят свое отношение к потреблению безалкогольных напитков, это может привести к увеличению проблем со здоровьем, таких как ожирение и остеопороз, и в то время, когда они столкнутся с этими проблемами со здоровьем, изменить отношение или сделать выбор в пользу здоровых напитков будет слишком поздно. помочь.

      Полезные напитки обычно заменяют газированными напитками.При большом потреблении газированных напитков вы сокращаете потребление фруктовых соков, молока и даже воды и лишаете себя необходимых витаминов и минералов, которые являются ключевыми ингредиентами для здоровой жизни. Здоровые люди всегда придерживаются мнения, что они выбирают здоровые продукты, и существует так много доступных здоровых альтернатив, таких как вода, чай и фруктовые соки. Вода является лучшей альтернативой, поскольку она утоляет жажду и служит лучшим напитком из всех напитков во вселенной, поскольку содержит натуральные элементы.

      Другой альтернативой безалкогольным напиткам может быть чай, который может обеспечить безопасность в нашем организме, так как содержит антиоксиданты, помогающие бороться с проблемами со здоровьем. Теперь варианты чая, такие как зеленый чай, доступны с разными вкусами, такими как травы и лимон, которые считаются вспомогательным средством для снижения веса. Другой хорошей альтернативой безалкогольным напиткам могут быть фруктовые соки, так как они чистые и богаты витаминами.

      Добавить комментарий

      Ваш адрес email не будет опубликован.