Тибетский кулан 5: Тибетский кулан, 5 букв.

Содержание

Полуосёл - это... Что такое Полуосёл?

Кула́н, азиатский осёл (лат. Equus hemionus) — вид из семейства лошадиных. Внешне очень напоминает осла, но имеет немало общих признаков с лошадью, из-за чего кулана нередко называют полуослом. Считается, что кулан никогда не поддавался приручению, в отличие от африканского осла (см. ниже).

Характеристика

Длина тела кулана составляет более двух метров, длина хвоста около 40 см, высота на уровне плеч (в холке) 130 см, вес 250 кг. С этими показателями кулан несколько крупнее обычного домашнего осла. Верхняя сторона, как правило, серая, желтоватая или красно-коричневая; брюхо белое. По хребту тянется чёрный или тёмно-коричневый «ремень». У куланов более широкие копыта и более короткие уши по сравнению с ослами, кроме того их кисточка на хвосте и грива менее выражены.

Куланы — самые быстрые представители семейства лошадиных. Галопом они могут достигать на короткие дистанции скорость 70 км/ч, на длинные — 50 км/ч.

Впервые описаны были в 1775 году.

Подвиды и распространение

О распределении куланов в подвиды существует много разногласий. В более старых научных работах различаются семь видов куланов, которые сегодня в большинстве своём считаются подвидами. Некоторые зоологи считают кианга отдельным видом, так как у него наблюдаются наибольшие отклонения от общих характеристик. Однако в целом все ниже перечисленные подвиды относят к одному и тому же виду.

  • Онагр (E. h. onager), северный Иран
  • Туркменский кулан (E. h. kulan), Казахстан, Туркменистан
  • Джигетай (E. h. hemionus), Монголия
  • Хур (E. h. khur), южный Иран, Пакистан, северо-западная Индия
  • Кианг (E. h. kiang), западный Китай, Тибет
  • Анатолийский кулан (E. h. anatoliensis), Турция †
  • Сирийский кулан (E. h. hemippus), Сирия, Месопотамия, Аравийский полуостров †

Кианг является самым крупным из подвидов кулана, достигая 140 см в холке и весом до 400 кг. Шерсть у киангов красновато-коричневая. Сведения о киангах крайне скудны. Кианг любит плавать в воде и выдерживает условия жизни на высоте до 5,5 тысяч метров над уровнем моря. Именно на такой высоте были встречены кианги на южных склонах Гималаев и высокогорных равнинах Тибета. Долгое время киангов не было ни в одном зоопарке мира, кроме Пекина. В 1957 году двух киангов по кличке Немо и Неда продали в Рижский зоопарк. Эта пара жила до 27 лет и оставила после себя девятерых потомков. К 1984 году существовало уже 72 кианга, прямых потомка Немо и Неды. Чтобы спасти этих животных от вырождения, связанного с близкородственным скрещиванием, были закуплены в Пекине и Берлине новые кианги. Сегодня увидеть кианга можно лишь в нескольких зоопарках мира: в Москве , Риге, Пекине, Берлине и Сан-Диего (США).

По мнению некоторых зоологов онагра и туркменский кулан — один и тот же подвид. Но по результатам новейших молекулярно-генетических исследований обе популяции можно строго отличить друг от друга. От джигетая иногда отделяют ещё один подвид — гобийского кулана (E. h. luteus).

Длина тела подвида джигетай 210 см.

В западной части своего ареала кулан раньше встречался наряду с диким ослом. Сегодня оба вида в этих регионах в дикой природе истреблены. Жизненным пространством кулана являются засушливые полупустыни, в которых он питается негусто растущей травой. Куланы нуждаются в питьевых точках по близости, так как не могут долго выносить отсутствие воды.

Приручение

Современные исследования ДНК доказывают, что все нынешние домашние ослы являются потомками африканского осла. Составленное по результатам генетических исследований генеалогическое древо чётко разделяет ослов в африканскую и азиатскую ветвь. Куланы относятся ко второй из них. Вопрос, поддаётся ли кулан одомашниванию и удавалось ли уже это в прошлом, горячо обсуждается. Некоторые считают изображённых на древних барельефах из Месопотамии (Ур) зверей ни лошадьми, ни ослами, и делают вывод, что речь идёт о куланах, которых древние шумеры и аккадцы сумели приручать и запрягать перед повозками. Во всяком случае, все попытки приручения куланов, предпринятые в новое время, не имели успеха. Считается более вероятным, что в Месопотамии был одомашнен африканский осёл (который несмотря на своё название встречался и в Передней Азии). Некоторые исследователи придерживаются мнения, что древние шумеры использовали гибридов ослов и куланов. Сегодняшние куланы привыкают к людям в неволе, но не становятся ручными.

Литература

Ливанова Т.К Лошади. — М.: ООО «Издательство АСТ», 2001.-256 с. ISBN 5-17-005955-8

Ссылки

Wikimedia Foundation. 2010.

Подвиды. Приручение

Подвиды О распределении куланов в подвиды существует много разногласий. В более старых научных работах различаются семь видов куланов, которые сегодня в большинстве своём считаются подвидами. Многие зоологи считают кианга отдельным видом, так как у него наблюдаются наибольшие отклонения от общих характеристик. Однако в целом все нижеперечисленные подвиды относят к одному и тому же виду. Онагр (E. h. onager), северный Иран Туркменский кулан (E. h. kulan), Казахстан, Туркменистан Хулан (E. h. hemionus), Монголия Хур (E. h. khur), южный Иран, Пакистан, северо-западная Индия Кианг (E. h. kiang), западный Китай, Тибет † Анатолийский кулан (E. h. anatoliensis), Турция † Сирийский кулан (E. h. hemippus), Сирия, Месопотамия, Аравийский полуостров Кианг является самым крупным из подвидов кулана, достигая 140 см в холке и весом до 400 кг. Шерсть у киангов красновато-коричневая. Сведения о киангах крайне скудны. Кианг любит плавать в воде и выдерживает условия жизни на высоте до 5,5 тысяч метров над уровнем моря. Именно на такой высоте были встречены кианги на южных склонах Гималаев и высокогорных равнинах Тибета. Долгое время киангов не было ни в одном зоопарке мира, кроме Пекина. В 1957 году двух киангов по кличке Немо и Неда продали в Рижский зоопарк. Эта пара жила до 27 лет и оставила после себя девятерых потомков. К 1984 году существовало уже 72 кианга, прямых потомка Немо и Неды. Чтобы спасти этих животных от вырождения, связанного с близкородственным скрещиванием, были закуплены в Пекине и Берлине новые кианги. Сегодня увидеть кианга можно лишь в нескольких зоопарках мира: в Москве, Риге, Пекине, Берлине и Сан-Диего (США). По мнению ряда зоологов онагр и туркменский кулан — один и тот же подвид. Но по результатам новейших молекулярно-генетических исследований обе популяции можно отличить друг от друга. От джигетая иногда отделяют ещё один подвид — гобийского кулана (E. h. luteus). Длина тела подвида джигетай 210 см. В западной части своего ареала кулан раньше встречался наряду с диким ослом. Сегодня оба вида в этих регионах в дикой природе истреблены. Жизненным пространством кулана являются засушливые полупустыни, в которых он питается негусто растущей травой. Куланы нуждаются в питьевых точках поблизости, так как не могут долго выносить отсутствие воды. Приручение Современные исследования ДНК доказывают, что все нынешние домашние ослы являются потомками африканского осла. Составленное по результатам генетических исследований генеалогическое древо чётко разделяет ослов в африканскую и азиатскую ветвь. Куланы относятся ко второй из них. Вопрос, поддаётся ли кулан одомашниванию и удавалось ли уже это в прошлом, горячо обсуждается. Некоторые считают изображённых на древних барельефах из Месопотамии (Ур) зверей ни лошадьми, ни ослами, и делают вывод, что речь идёт о куланах, которых древние шумеры и аккадцы сумели приручать и запрягать перед повозками. Во всяком случае, все попытки приручения куланов, предпринятые в новое время, не имели успеха. Считается более вероятным, что в Месопотамии был одомашнен африканский осёл (который несмотря на своё название встречался и в Передней Азии). При раскопках городища Тель-Брак в Месопотамии обнаружены кости гибридов домашнего осла и кулана, которые использовались как тягловый скот в 4-3 тыс. до н. э., до распространения лошади. Сегодняшние куланы привыкают к людям в неволе, но не становятся ручными. В Монголии считается, что куланов невозможно приручить. Название «кулан», так же, из монгольского языка образовано от слова «хулан», что означает «непобедимый, быстрый, шустрый». Википедия

Подвиды

О распределении куланов в подвиды существует много разногласий. В более старых научных работах различаются семь видов куланов, которые сегодня в большинстве своём считаются подвидами. Многие зоологи считают кианга отдельным видом, так как у него наблюдаются наибольшие отклонения от общих характеристик. Однако в целом все нижеперечисленные подвиды относят к одному и тому же виду.

  • Онагр (E. h. onager), северный Иран
  • Туркменский кулан (E. h. kulan), Казахстан, Туркменистан
  • Хулан (E. h. hemionus), Монголия
  • Хур (E. h. khur), южный Иран, Пакистан, северо-западная Индия
  • Кианг (E. h. kiang), западный Китай, Тибет
  • † Анатолийский кулан (E. h. anatoliensis), Турция
  • † Сирийский кулан (E. h. hemippus), Сирия, Месопотамия, Аравийский полуостров

Кианг является самым крупным из подвидов кулана, достигая 140 см в холке и весом до 400 кг. Шерсть у киангов красновато-коричневая. Сведения о киангах крайне скудны. Кианг любит плавать в воде и выдерживает условия жизни на высоте до 5,5 тысяч метров над уровнем моря. Именно на такой высоте были встречены кианги на южных склонах Гималаев и высокогорных равнинах Тибета. Долгое время киангов не было ни в одном зоопарке мира, кроме Пекина. В 1957 году двух киангов по кличке Немо и Неда продали в Рижский зоопарк. Эта пара жила до 27 лет и оставила после себя девятерых потомков. К 1984 году существовало уже 72 кианга, прямых потомка Немо и Неды. Чтобы спасти этих животных от вырождения, связанного с близкородственным скрещиванием, были закуплены в Пекине и Берлине новые кианги. Сегодня увидеть кианга можно лишь в нескольких зоопарках мира: в Москве, Риге, Пекине, Берлине и Сан-Диего (США).

По мнению ряда зоологов онагр и туркменский кулан — один и тот же подвид. Но по результатам новейших молекулярно-генетических исследований обе популяции можно отличить друг от друга. От джигетая иногда отделяют ещё один подвид — гобийского кулана (E. h. luteus).

Длина тела подвида джигетай 210 см.

В западной части своего ареала кулан раньше встречался наряду с диким ослом. Сегодня оба вида в этих регионах в дикой природе истреблены. Жизненным пространством кулана являются засушливые полупустыни, в которых он питается негусто растущей травой. Куланы нуждаются в питьевых точках поблизости, так как не могут долго выносить отсутствие воды.

Приручение

Современные исследования ДНК доказывают, что все нынешние домашние ослы являются потомками африканского осла. Составленное по результатам генетических исследований генеалогическое древо чётко разделяет ослов в африканскую и азиатскую ветвь. Куланы относятся ко второй из них. Вопрос, поддаётся ли кулан одомашниванию и удавалось ли уже это в прошлом, горячо обсуждается. Некоторые считают изображённых на древних барельефах из Месопотамии (Ур) зверей ни лошадьми, ни ослами, и делают вывод, что речь идёт о куланах, которых древние шумеры и аккадцы сумели приручать и запрягать перед повозками. Во всяком случае, все попытки приручения куланов, предпринятые в новое время, не имели успеха. Считается более вероятным, что в Месопотамии был одомашнен африканский осёл (который несмотря на своё название встречался и в Передней Азии). При раскопках городища Тель-Брак в Месопотамии обнаружены кости гибридов домашнего осла и кулана, которые использовались как тягловый скот в 4-3 тыс. до н. э., до распространения лошади. Сегодняшние куланы привыкают к людям в неволе, но не становятся ручными. В Монголии считается, что куланов невозможно приручить. Название «кулан», так же, из монгольского языка образовано от слова «хулан», что означает «непобедимый, быстрый, шустрый».

Википедия

Кулан в Красной книге России


Вид, принадлежащий к семейству лошадиных – кулан, внешне больше напоминает осла. Официальное название Equus hemionus. Несмотря на внешние особенности, с лошадьми вид также имеет множество схожих черт. Второе название кулана, которое используется не менее часто, полуосел или кианг. В переводе название также обозначает мула.

Кулан Equus hemionus

Кулан: краткое описание

Во времена Советского союза вид был распространен по всем степным территориям. С годами из-за ряда причин число взрослых особей уменьшилась, при этом в некоторых местах популяция пропала вовсе.

Белик Дмитрий Романович

Доктор биологических наук, ведущий научный сотрудник Зоологического института РАН

Задать вопрос

Первой причиной стали изменения климата, которые негативно повлияли на все популяции, которые живут в условиях дикой природы.

Вторая причина – освоение территорий человеком. В результате многие виды вынуждены мигрировать и жить в менее благоприятных условиях. Как результат адаптивность вида снижается, как и число взрослых особей.

Тибетский кулан, как и сибирский, нуждается в дополнительной защите. Для этого и нужна Красная книга по отдельным регионам.

Сибирские куланы Тибетский кулан

Кулан: сколько осталось

Полуосел не находится в статусе исчезнувшего, но также находится под угрозой. Тенденция последних лет вызывает серьезные опасения. Еще один фактор, который негативно влияет на вид – он не обитает на специальных природоохранных территориях, а потому не подпадает под различные программы защиты.

Туркменский, азиатский подвид также находится в шатком положении. Средняя численность по подвидам составляет около 2-3 тыс. в разных регионах. Популяции располагаются без единой системы, локально.

Кулан парнокопытное или непарнокопытное

Полуосел относится к семейству лошадиных. По своей сути, маленький осел – лошадь. Род животного определяет его основные характеристики и продолжительность жизни. Отряд – непарнокопытные.

 

Внешние характеристики

Полуосел, как отдельный вид, был открыт в 1775 году. Он является чем-то средним между лошадью и ослом. Длина тела не превышает 2 м, но средняя длина взрослой особи составляет около 175 см.

Хвост животного длинный, примерно 40 см. Высота составляет до 125 см. Вес взрослой особи варьируется от 120 до 300 кг. На внешние характеристики напрямую влияет образ жизни популяции, среда обитания.

Кианг больше, чем обычный осел, его тело массивнее. Разница между самками и самцами не значительна.

Основные характеристики:

  1. Голова, как у домашней лошади, большая.
  2. Ушные раковины длинные, что является отличительной чертой полуосла. Длина ушей варьируется от 17 до 25 см.
  3. Ноги тонкие, узкие. Копыта имеют вытянутую форму.

Волосяной покров густой, его длина меняется в зависимости от сезона. Летом волосы значительно короче. Он плотно прилегает к коже. Зимой волосы длинные, они неплотно прилегают, что позволяет согревать животное даже при очень низких температурах.

Грива есть, она в основном расположена вдоль шеи и не сильно выражена. Она заканчивается в районе холки. Такой отличительной черты, как «челки» характерной для лошади, нет. Хвост в меру массивный. На его конце есть своеобразный пучок.

Общий окрас волос равномерный, темно-песчаный. Насыщенность и оттенки разные, зависят от региона проживания полуосла. На спине есть узкая, но темная полоса. Грива, уши отличаются бурым окрасом. Хвост более светлый, выделяет на фоне общего окраса. Он почти белый.

Кулан: видовые особенности

В отличие от ослов и лошадей, кулан отличается хорошим зрением и слухом. Подобная особенность служит защитой – подкрасться к популяции практически невозможно. Заметить движение кулан способен на расстоянии почти в 1,5 км. Есть и острое обоняние.

Где обитает кулан

Идеальным местом проживания являются пологие склоны – не зря мул степной. Взрослые особи могут подниматься на высоту от 300 до 600 м. Рядом обязательно должен быть водоем – дикий осел может жить в пустыне, но не переносит жажду. Природная зона обитания не обширная. Обычно популяция выбирает закрытые участки.

Кулан: чем питается

Вид является травоядным, а значит, его рацион преимущественно растительный. Основа питания – трава и злаковые. Зимой, особенно с большим количеством снега, питание затрудняется.

У кулана появляются проблемы по добыче пищи, поэтому для вида так важно оставаться на подходящей по погодным условиям территории.

Размножение

В период брачного периода в стае вожак выгоняет всех самцов, которые борются после за непокрытых самок. Сразу после рождения молодняк не самостоятельный, долго зависит от самок. Спаривание происходит в одно время. Подвиды, как азиатский или джейран, размножаются одинаковым способом.  

Заключение

Кулан только внешне напоминает осла, но по общим характеристикам больше походит на лошадь. Рацион вида преимущественно растительный.

Лошадиные
Царство: Животные
Тип/Отдел: Хордовые
Класс: Млекопитающие
Отряд/Порядок: Непарнокопытные
Семейство: Лошадиные
Категория редкости: 0 – вероятно исчезнувшие
Красный список МСОП: Нет

Кулан животное (58 фото)

1

Лошадь Кулан


2

Степной Кулан


3

Туркменский Кулан


4

Сирийский Кулан


5

Сирийский Кулан


6

Кулан Индия


7

Скакуны (род)


8

Дикий осел онагр


9

Лошадь Пржевальского и Кулан


10

Кулан Якутский


11

Аббисино нубийский осел


12

Туркменский Кулан


13

Кулан Гал и дарим


14

Персидский Кулан - Equus hemionus Onage


15

Дикая лошадь Пржевальского


16

Кьян дикий осел


17

Дикий осел Кулан


18

Туркменский Кулан


19

Кулан Индия


20

Степной Кулан


21

Дикий осел Кулан


22

Кулан Джейран Бадхыза


23

Осёл Кулан


24

Дикий осел Кианг


25

Кулан Церковь


26

Дикий нубийский осел


27

Сирийский Кулан


28

Тибетский Кулан


29

Equus hemionus kulan


30

Лошадь Пржевальского и Кулан


31

Сирийский Кулан


32

Лошак ослица


33


34

Equus hemionus лошадь


35

Туркменский Кулан


36

Тибетский Кулан


37

Дикий ишак


38

Сирийский Кулан


39

Монгольский Кулан


40

Сирийский Кулан


41

Фауна Сомали


42

Степной Кулан


43

Кулан Якутский


44

Кулан Equus hemionus


45

Саудовская Аравия дикий осёл онагр


46

Кианг из ярмарка


47

Ослы куланы


48

Онагр животное


49

Монгольский Кулан


50

Конгкондский Кулан


51

Млекопитающее Кулан


52

Тибетский Кулан


53

Дикий нубийский осел


54

Туркменский Кулан


55

Дикий Кулан


56

Дикий осел Кулан


57

Степной Кулан


58

Кулан Equus hemionus красная книга

КУЛАН

Систематическое положение

Царство: животные (Animalia).

Тип: хордовые (Chordata).

Класс: млекопитающие (Mammalia).

Отряд: непарнокопытные (Perissodactyla).

Семейство: лошадиные (Equidae).

Род: лошади (Equus).

Вид: кулан (Equus hemionus).

Почему занесен в Красную книгу

Кулан, как и лошадь Пржевальского, в России в дикой природе не встречается. В конце XVIII — начале XIX века куланов еще можно было встретить на бескрайних просторах нашей родины. Однако уже к началу прошлого столетия они исчезли из дикой природы исчезли. Основные причины этого такие же, как и для лошади Пржевальского, — прямое истребление и сокращение пригодных местообитаний.

Где обитает

Еще не так давно кулана можно было встретить в Забайкалье, Восточной Европе, Западной Сибири, Казахстане, Средней и Центральной Азии, Тибете, на Аравийском полуострове и северо-западе Индии. На всей этой территории куланы заселяли злаковые степи, полупустыни, пустыни различного типа, высокогорные плато. Им нравились как открытые равнины, так и пересеченные местности. В целом для этого вида лошадей характерен оседлый образ жизни, они совершают лишь незначительные миграции, когда необходимо найти новое пастбище или водопой.

В наши дни кулан встречается в пустынях Передней, Средней и Центральной Азии.

Как узнать

Внешность кулана соответствует его второму названию — азиатский осел. Его также иногда именуют полуослом, ведь очень сложно определиться, на кого же этот зверь больше похож — на лошадь или на осла.

Длина тела кулана обычно составляет от 175 до 200 см, длина хвоста — до 40 см, высота в холке — 125 см, вес животного колеблется в пределах от 120 до 300 кг. Интересно, что кулан, готовясь к зиме, меняет свою короткую гладкую шерсть на длинную и курчавую.

Грива у куланов небольшая и жесткая, похожа на щетку. Если обратить внимание на хвост этого животного, вновь вспоминается ослик.

Образ жизни и биология

Больше всего времени куланы проводят на пастбищах — по 13-15 ч в сутки, еще 5-8 ч они отдыхают и от 2 до 5 ч затрачивают на передвижение. Куланы — дневные животные, ночью они спят.

Малыши рождаются слабенькими, встают только за материнским молоком, правда, делают это через каждые 10 мин. Мать кормит детеныша примерно до 10 месяцев, но при этом жеребята постепенно учатся самостоятельно есть траву. Эти животные чувствуют перемену погоды за 10-12 ч. Ощущая, что надвигается метель или снежный буран, они заблаговременно уходят в укрытия.

В основном куланы держатся небольшими табунами, каждый из которых состоит из взрослого самца, самок и маленьких жеребят, — всего 5-12 животных. Пищевой рацион этих лошадей включает более 100 видов трав, причем зимой они даже раскапывают снег, для того чтобы полакомиться сухими растениями. И только если толщина снега превышает 20 см, куланы мигрируют в менее снежные районы. Это невероятно быстрые и ловкие животные. Они способны развивать скорость до 65 км/ч и спускаться со склонов крутизной 70°. Кроме того, куланы невероятно отважны. Если спастись бегством от преследования не получается, кулан занимает оборонительную позицию. Он не v боится собак и диких кабанов, не паникует и перед человеком. Если драка неизбежна, то кулан пускает в ход все: зубы, копыта, голову.

■ Это интересно

Современные ученые выделяют семь подвидов куланов. Многие из них имеют интересные и необычные для нашего слуха названия: онагр, джигетай, хур, кианг, анатолийский кулан.

Этот вид лошадей может питаться травами с высокой концентрацией эфирных масел. Кроме того, они пьют соленую воду из Аральского моря. В ней содержится более 10 г солей на литр. Животное может выпить до 20 л такой воды за одни сутки.

  • Предыдущее: КУКУШКИ
  • Следующее: КУЛАЧКОВЫЙ ВАЛ

Чем интересен Онагр ?

Онагр (Equus hemionus onager), непарнокопытное животное рода лошадей; подвид кулана.. . «Онагр проворен, подвижен, взгляд у него умный и хитрый, внешность изящная, движения полны игривости. Это зоологический царь Востока! » Бальзак Действительно, онагры, или куланы (Equus hemionus), обладают чертами, воспетыми классиком в «Шагреневой коже» . Они имеют легкое, стройное телосложение, высоконоги. У них красивый цвет шкуры – песчано-желтый круп от холки по хребту пересекает узкая черно-бурая полоска, а от ушей до холки эту линию продолжает маленькая стоячая гривка. Брюхо и внутренняя часть бедра – белые. Длина тела у онагров 200–220 см, высота в холке 110–137 см, масса — 120–127 кг. А вот называя онагра осликом, французский писатель ошибался, впрочем, ему простительно — он не зоолог. На самом деле онагр объединяется в один подрод с лошадями, то есть он дикая степная лошадка. Потому-то его нрав так не похож на ослиный. онагр удивительно быстро бегает (чего не скажешь о вислоухих и упрямых ослах) . Всадник на лошади (даже на весьма быстроходной) , как правило, не может догнать его. Животное может долго терпеть преследование, а «наигравшись» быстро уносится вдаль. Удивительна способность онагра добывать пищу из-под снега. Причем снежный покров, с которым справляются лошадки при помощи своих копыт, может достигать 15–20 см. Такой способ пастись, разрывая снег копытами, даже имеет специальное название – тебеневка. И онагры отлично тебенюют, но это отнимает у них много сил и снежные зимы — тяжелое испытание для животных. Стоит рассказать и об их агрессивном нраве. Онагры в брачный период зачастую конфликтую друг с другом (обычно стычки происходят, когда один самец хочет отбить стадо самок у другого) . Тогда они лягаются, злобно напрыгивают друг на друга, стараются укусить. Излюбленный прием у онагров в таких стычках — схватить противника зубами за скакательный сустав и раскручивать его вокруг своей оси. Во время гона многие самцы бывают со следами укусов и ударов. Правда, никто из наблюдателей не отмечает летальных исходов таких драк. У онагров отлично развиты зрение, слух и обоняние. Подобраться к нему в степи незамеченным – почти невозможно. Идущего человека онагр различает более чем за километр, ползущего за 150–200 метров. Щелчок фотоаппарата или покашливание скрытого в укрытии исследователя кулан различает метров за 60. Среда обитания онагра – полупустыни и степи. Когда-то он расселялся в Восточной Европе, Южной Сибири, Передней, Средней и Центральной Азии, Тибете и Западной Индии. В Турции он встречается и по сей день, но ареал распространения этого непарнокопытного значительно сократился, более того куланы занесены в Международную красную книгу. ..

Кулан (азиатский осёл) - млекопитающее животное, строение, питание, обитание, описание, фото, картинки

Кулан или азиатский осёл – лат. Equus hemionus, представитель класса млекопитающие, относится к семейству лошадиные. Единственный дикий представитель рода Equus в европейской фауне, принадлежит к подроду ослов (Asinus). К последнему, кроме Е. hemionus, относятся еще один или два вида африканских серых, или настоящих ослов, от которых ведет свою родословную и современный домашний осел. Кроме окраски, африканские ослы отличаются от азиатских наличием поперечных черных полос, идущих от холки по бокам плеч до уровня локтевых суставов, длинными ушами и очень узкими передними копытами.

Вместе с тибетским киангом и группой онагров Передней Азии по морфологическим особенностям кулан занимает как бы промежуточное положение между настоящими ослами и лошадьми, откуда все они получили название полуослов.

Строение куланов

Высота кулана в холке около 125 (от 110 до 140) см, длина туловища 175—200 см. Голова длиной около 50 см, кажется большой по сравнению с общей величиной животного. Уши длиной 24 - 25 см, несколько длиннее, чем у лошадей, но короче, чем у настоящих ослов. Общий тип сложения легкий; поджарое туловище покоится на высоких тонких конечностях с узкими вытянутыми копытами. Передние копыта все же, в отличие от африканских ослов, несколько шире задних. Каштаны имеются только на передних конечностях, при этом, в отличие от лошадей, они большие, расположены выше и представляют гладкие, лишенные волоса участки кожи. Хвост тонкий, от основания покрыт коротким, в летней шерсти плотно прилегающим к коже тонким волосом, и только дистальная его треть несет кисть из длинных грубых волос. Длина хвоста вместе с кистью составляет 60—80 см. Волосы на гриве короткие, торчащие вверх. Характерный для лошадей, особенно домашних, пучок волос между ушами на макушке головы, так называемая челка, не развит.

Общий тон окраски верхней части туловища, шеи, головы, а также наружной поверхности ног до запястных и заплюсневых суставов от светлого песчано-желтого, даже палевого, до красновато-коричневого, в зимнем мехе иногда с сероватым оттенком. Вдоль средней линии спины от гривы до начала длинных волос на хвосте тянется темно-бурая полоса шириной в несколько сантиметров, сопровождаемая иногда по бокам узкой светлой оторочкой. Грива, концы ушей и узкая полоса непосредственно над копытами темно-бурые. Кисть из грубых волос на конце хвоста, черная. Нижняя сторона туловища и шеи, конец морды, внутренняя поверхность и нижние части конечностей и ушных раковин, а также задние части бедер по сторонам хвоста светлые, от желтовато-сероватого до чисто белого цвета. В летний период волосяной покров короткий, плотно прилегает к коже, зимой более длинный (3 - 4 см) и волнистый.

Череп куланов с высоким лицевым отделом. Высота его впереди составляет не меньше 21.5 %  основной длины. Расстояние от заднего края сошника до заднего края костного нёба обычно больше расстояния от заднего края сошника до нижнего края затылочного отверстия. Сошниковый индекс (отношение второго промера к первому в процентах) низкий, составляет от 84.5 до 113.4% (в среднем 99.8%). Глоточные бугорки не заходят вперед дальше уровня большого разорванного отверстия (for. lacerum). Костные слуховые каналы длинные, составляют не меньше 5.5% основной длины черепа, направлены косо назад и вверх. Задний край носовой вырезки (между носовой и межчелюстной костями) расположен, как правило, на уровне заднего края. У нижнего края входа в носовую полость межчелюстные кости обычно образуют гребневидные бугорки. Симфиз нижней челюсти (длина участка срастания левой и правой ее половины), по сравнению с лошадьми, короткий; длина его не превышает 20% длины челюсти. Пространство между ветвями нижней челюсти образует перед их слиянием с нижней стороны расширение с закругленным передним и боковым краем. На крайних нижних резцах чашечка в той или иной степени недоразвита.

Число грудных и поясничных позвонков — 23, Конечности длинные, особенно их дистальные звенья. Длина скелета свободной передней конечности составляет больше 75% длины туловища. Длина пястной кости (metacarpale) составляет не меньше 28% длины всего скелета передней конечности. Пястные, плюсневые и кости фаланг очень тонкие. Ширина пястной кости (metacarpale) в средней части не превышает 12% ее длины; тот же индекс для плюсневой кости не свыше 10%. Ширина копытной (третьей) фаланги к ее длине по переднему краю на передней конечности составляет меньше 140% (от 132 до 137%). Срединный гребень дистального суставного блока метаподий, по сравнению с лошадьми, более низкий и закругленный.

Обитание и распространение куланов

Азиатские ослы ведут свою историю от верхнеплиоценовых, уже однопалых лошадей. Родиной их следует считать Центральную или южную Азию, где в нижнем или среднем плейстоцене Индии обитал их вероятный прямой предок Е. namadicus Falc. Форма, почти ничем не отличимая от современного Е. hemionus, найдена в верхнем плейстоцене Китая. Территорию Европейского континента полуослы заселяют лишь по окончании ледникового периода, в эпоху бронзы и неолита. До этого здесь с нижнего и до верхнего плейстоцена обитала не имеющая прямого отношения к современным ослам очень длинноногая и тонконогая форма Е. hidruntinus.

В настоящее время область географического распространения азиатских ослов охватывает Переднюю, Среднюю и Центральную Азию, начиная с Сирии, через Ирак, Иран, Афганистан, Среднюю Азию, Пакистан, Тибетское плоскогорье и пустыню Гоби до Южного Забайкалья (Даурии) и, возможно, северо-восточного Китая. Восточная граница распространения не установлена.

На территории России и Украины кулан прежде был распространен неизмеримо шире, чем в настоящее время. Остатки, несомненно, принадлежащие кулану, найдены в слоях римского времени на территории Южного Крыма (Симферополь). Есть указания (Шарлемань, 1949), что вплоть до XVI— XVII в. он водился даже на территории Украины не только в степной полосе, но и в лесостепи от побережья Черного моря, лимана Днепра и Буга до широты Киева. С первых веков и до XII—XIII в. н. э. куланы водились в Закавказье в долине среднего течения р. Аракса (Даль, 1954). В конце XVIII и даже в середине XIX в. западной границей служила, по-видимому, река Урал или Волга, а к северу, в районе р. Иртыша, доходила до 52° с. ш. По сообщению Г. С. Карелина (1875), куланы, хотя и не ежегодно, появлялись на левой стороне Урала против форта Редутского. Экземпляр кулана был добыт им в 1855 г. между р. Сагизом и Эмбой. Есть сведения, что куланы в XVIII в. водились даже в Барабинской степи (Селевин, 1932).

В середине прошлого века они были многочисленны по берегам Каспийского и Аральского морей в районе Устюрта и Мангышлака, на севере доходили до подножий Мугоджарских гор. В 1839 или 1840 г. «дикая лошадь», судя по описанию несомненный кулан, была поймана в 65 верстах от бывшего Локтевского завода у западной окраины Алтая (Селевин, 1937). Если не водился кулан постоянно, то в свое время имели место регулярные его забеги из Монголии в степи южного Забайкалья (Radde, 1861, 1862).

Еще в конце XIX в. куланы были широко распространены по равнинным степям и пустыням Казахстана, Туркмении и Узбекистана. В начальном периоде постройки Закаспийской железной дороги многочисленные табуны их показывались около Казанджика, а также между Душаком и Кары-Бендом. В 80-х годах А. Вальтер (Radde и Walter, 1889) в большом числе встречал на холмах между реками Тедженом и Мургабом и в частности в районе Ислам-Чешме и Акрабат. Изредка встречались они даже на территории нынешней Павлодарской области Казахской ССР (Антипин, 1941).

В литературе известно довольно большое число случаев появления отдельных животных и небольших табунов куланов в разных местностях Казахстана вплоть до 30-х годов этого века. Так, отмечались они для отдельных пунктов Прибалхашья, Бет-Пак-Далы, устья Аягуза, в Алакульской котловине и даже в центральном Казахстане. Однако подавляющее большинство приводимых случаев основано на расспросах местных жителей и охотников и поэтому не всегда достоверно. Два последние более или менее достоверные указания на встречи следов пребывания куланов в юго-восточном Казахстане относятся к 1936—1937 гг.: один — к низовьям р. Или на протоке Топара-Кургак-Топаре (Слудский, 1939), а второй — к району левобережья Или между государственной границей, хребтом Турайгыр и р. Чарын (Селевин, 1937). В настоящее время в пределах Казахстана кулан, как постоянный обитатель, отсутствует, но возможны отдельные его заходы из Китая через Джунгарские ворота.

На территории Европы кулан сохранился лишь на самом юге Туркмении в западной части Теджено-Мургабского междуречья, в районе между Кушкой и Серахсом. К середине 30-х годов нашего столетия небольшое число куланов более или менее постоянно обитало в узкой полосе вдоль границы Советского Союза с Ираном и Афганистаном от аула Миона на западе до поста Ислам-Чешме на востоке (Шатерникова и Румянцев, 1934). В наибольшем числе они встречались в районе Акар-Чешме (хребет Гёзгельды) и в котловине соленых озер Ер-Ойлан-Дуз. Как выяснил М. П. Розанов (1937), весной и в начале лета табуны куланов с жеребятами держатся севернее и северо-восточнее Акар-Чешме близ колодца н хребта Элли-Бир. Осенью, вытесняемые стадами домашних овец, они спускаются в долину Куллели-Дуз у самой афганской границы и к реке Эгригёк, около 70 км к востоку от Акар-Чешме, а зиму проводят в котловине озер Ер-Ойлан-Дуз.

К западу от только что перечисленных мест кулан, как постоянный обитатель, отсутствует. Однако, по свидетельству К. К. Флерова (1932), небольшие табуны в 5—10 голов их появляются в окрестностях поста Чильдухтер, куда они забегают из соседних районов Афганистана. Реже наблюдали их вблизи долины Мургаба к востоку от погранзаставы Меручак. Весной 1930 г. табунок из 4 голов наблюдался к востоку от аула Сары-Чоп.

В Европе кулан взят под государственную охрану. Охота на него повсеместно и строжайше запрещена. На юге Туркмении учрежден специальный Бадхызский куланий заповедник, где в настоящее время число куланов исчисляется уже сотнями голов и где проводится работа по его одомашнению.

С 1953 года проводится работа по акклиматизации кулана в заповеднике Барса-Кельмес на Аральском море. Издавна в условиях полувольного паркового содержания куланы существуют на юге Украины в Аскании-Нова.

Литература:

1. И.И. Соколов "Фауна СССР, Копытные звери" Издательство академии наук, Москва, 1959 год.

Животный мир тибетских степей | Журнал маммологии

Любой обзор работы Шаллера должен включать признательность за его энергию и поддержку, которую он вызывает у граждан, с которыми он работает. Тибетская степь огромна, и это исследование необъятно. В результате его усилий китайское правительство увеличило усилия по сохранению в Тибете.

Первая глава этой прекрасной книги посвящена краткой истории ледниковых периодов и путешествий первых пришельцев, а также описывает ранние документы о растениях и животных, найденных там.В главе 2 представлены данные о температуре, погодных условиях, высоте над уровнем моря, местности и неблагоприятных условиях. Эти условия отражают суровые условия, в которых работал Шаллер.

Глава 3 меняет темп работы, сосредотачиваясь на тибетской антилопе ( Pantholops hodgsoni ), широко известной как чиру. Его среда обитания изначально находится в восточном Ладакхе (Индия), но чиру сезонно пересекает Тибет и южный Синцзян. На картах указаны маршруты миграции, а в таблицах приведены данные о наблюдениях в заповеднике Чанг Тан за 1991–1993 годы.Сравнения нижней челюсти приведены в таблицах. Регистрируются паразиты и болезни. Описываются коэффициенты рождаемости и смертности (по причинам). Приведены зимние данные о корме, недоедании, размере и составе стада. Трудно понять, как эти данные были собраны в опасных сугробах и температурах, которые часто были ниже 0.

В главе 4 речь идет о тибетских архарах ( Ovisamm ), вымирающем подвиде, близком по таксономии к овце Марко Поло. Физические данные сравнивают размеры и относительную форму рогов.Распределение популяции, а также размер и динамика стада завершают эту главу.

Глава 5 касается голубых овец, или бхарал ( Pseudois nayaur ), с точки зрения таксономии, брачных привычек, распределения, отношения к горным козлам, динамики популяции и стада, а также хищников. Глава 6 посвящена тибетским газелям ( Procapra picticaudata ) и обсуждает их связь с другими газелями в Тибете. На нем красиво нарисованы различия их рогов.Обсуждаются подсчеты популяций и районы нагула различных видов.

Глава 7 дает представление о популяции диких яков. Шаллер называет Чанг-Тан последней цитаделью тибетских диких яков, классифицируемых как Bos grammiens , согласно Groves (1981). Он сравнивает их с одомашненными яками и отмечает, что дикий як крупнее одомашненного. В его главе 9 говорится, что дикие двугорбые верблюды ( Camelus bactrianus ferus ) меньше домашних.Позже, в последних 4 главах, он упоминает выпас как смягчающий фактор. Кроме того, ручные двугорбые верблюды должны пастись на тропах, по которым их водят хозяева, и они потребляют воду иначе, чем дикие. По словам Шаллера, верблюды больше ориентированы на воду, чем на пищу, и создают другие проблемы, чем яки. Хищники чаще охотятся на диких верблюдов, чем на яков, потому что первые не так эффективны в борьбе с хищниками. Яки образуют круги, очень похожие на американских бизонов, и защищают своих детенышей.

В главе 8 рассматривается только 1 вид, белогубый олень ( Cervus thoroldi ). Обсуждаются распределение, размер стада и внешний вид. Остальные олени встречаются в тибетских степях, но не включены в исследование. Они перечислены в Приложении A в разделе Семейство Cervidae.

В главе 10 есть несколько точных данных о численности населения кианга, или дикого осла ( Equus hemonious kiang ). Шаллер допускает трудности с получением точных подсчетов населения для киангов, но делает некоторые предположения на основе своих опросов, заявляя, что плотность населения для Чанг-Тан равна 0.1 кианг / км 2 , или около 10 000 животных. Позже, в таблице, в которой сравниваются жеребята и молодые взрослые особи, он дает размер выборки в 1063 особи для молодых взрослых, что составляет 7,9% от общего числа; это будет около 84 жеребят в стаде в 1063 киана. Затем он приводит данные о 2,4% стада из 218 животных на весну следующего года в том же районе. Таким образом, сравнивать сложно, но Шаллер говорит, что это связано с сезонным сокращением поголовья и другими факторами, такими как территориальность и смертность молодняка.Поскольку размер стада невелик, способность к побегу увеличивается при обнаружении злоумышленников. Шаллер дает лучшее, что я видел в этой области, но вряд ли на это можно положиться. Это показывает, что необходимо проделать большую работу по оценке фактического количества наблюдаемых животных. Однако Шаллер приводит причины, по которым смертность, информация о сезонном выпасе и территориальность различаются среди копытных. Он сравнивает монгольского дикого осла (кулан) с тибетским диким ослом (Kiang) и одичавшим диким ослом, говоря, что оценка Гроувсом (1981) соотношения молодых и взрослых особей была высокой, 22%, для южного кулана в Гоби. Пустыня.

Глава 11 дает прекрасное описание тибетских хищников и их взаимоотношений. Рассказ о волках был первым, что меня заинтересовало, потому что в 1992 году я спрашивал в нескольких местах в Китае, включая зоопарки Пекина и Чэнду, информацию о тибетском волке ( Canis lupus chang ), но не получил ответа. Мне с трудом удалось достать образец волос для моих исследований волчьей шерсти в Пекинском зоопарке у очень старого и рассерженного черного волка в клетке размером 5 на 5 футов, в которой он прожил 10 лет.Тем не менее, Шаллеру удалось предоставить важную информацию о наблюдениях за волками и их хищничестве в 1994 году. Среди других обсуждаемых хищников - тибетский бурый медведь ( Ursus arctus pruinosis ) и рысь ( Felis lynx ). Обсуждая снежных барсов ( Panthera uncia ), он представляет таблицу, в которой перечислено содержимое дропов, которое включает останки голубых овец, Cervus оленей, кабаргу, домашних овец, яков, пищух, зайцев, птиц и растительность. В Приложении А он упоминает другие виды млекопитающих, на которые нет ссылок в тексте.В Приложении B перечислены виды птиц и рептилий.

Последние 4 главы книги, главы 12–15, вероятно, являются наиболее важными для оценки успешности исследования. В главе 12 Шаллер дает хорошо составленные диаграммы растительных сообществ в различных ландшафтах, нишах и субнишах. Биомасса измерялась тщательно, а влажность регистрировалась для различных сезонов. Были зарегистрированы токсичные растения, такие как Oxytropis falcata и O. stracheyouna . Задокументированы посевы листьев отдельных растений.Содержание минералов наблюдали и записывали. В зависимости от содержания питательных веществ в таблицу были занесены различные ландшафты. Процентное содержание белка в различных разнотравных и граминоидах было сведено в таблицу. Использование по видам было дано для участков растительности с упором на особые индивидуальные привычки питания. В главе 13 на основе анализа ДНК Шаллер предлагает некоторые изменения в таксономии тибетских копытных. Он особенно обсуждает племенную номенклатуру чиру и сайгака и их отношения.

В главе 14 Шаллер обсуждает поведенческие сравнения, которые подтверждают молекулярное сходство определенных видов. Такие поведенческие сравнения включают ухаживания, рытье ям, чтобы избежать воздействия солнца и мух, и многие другие, слишком многочисленные, чтобы упоминать их.

Глава 15 - прекрасное обсуждение сохранения заповедника Чанг Тан для «Кочевников, домашнего скота и дикой природы». Он полон положительных предложений, часть из которых уже реализована в проектах правительства Китая.Затем следует обсуждение «Руководства по сохранению реки Чанг Тан». К сожалению, эпилог, написанный в 1997 году, осуждает истощение дикой природы в этой области. Есть 18 страниц ссылок, многие на китайском написаны эрудированными биологами. Шаллер всесторонне переводит эти ссылки для читателя.

Размах усилий и приверженность, которые Шаллер проявляет к сохранению, феноменальны. Его анализ типов растительности для оценки выживаемости, его анализ ДНК и другие уникальные методы - это предложения, которые должны побудить некоторые из наших местных агентств к действию.Для нашего собственного местного вида необходимы более энергичные усилия по сохранению. Джордж Шаллер написал вдохновляющую книгу и заслуживает похвалы за его усилия. Лилли Рендт (на пенсии), Юго-западный музей маммологии, Университет Нью-Мексико, Альбукерке, Нью-Мексико, 11005 .

Цитированная литература

1981

.

Систематические родственные связи крупного рогатого скота ( Artiodactyla, Bovidae ).

Zoologische Systematic und Evolutionforschung

19

:

264

-

278

.

Американское общество маммологов

фактов об ослах | Живая наука

Ослы, также называемые ослами и ослами, встречаются по всему миру. Они являются членами семейства Equidae, в которое также входят лошади и зебры. Они очень похожи на своих кузенов, но имеют длинные висячие уши и, как правило, коренастее лошадей или зебр.

Размер

Ослы бывают трех основных типов: дикие, одомашненные и одомашненные.Дикие ослы обычно вырастают до 49 дюймов (125 сантиметров) от копыт до плеч и весят около 551 фунта. (250 килограмм).

Домашние ослы различаются по размеру в зависимости от способа разведения. По данным Государственного университета Оклахомы, существует восемь различных типов одомашненных ослов. Обычно они весят от 400 до 500 фунтов. (От 180 до 225 кг) и от 36 до 48 дюймов (от 92 до 123 см) от копыта до плеча.

По данным Сети разнообразия животных Мичиганского университета, самый маленький осел - это миниатюрный осел.Они вырастают всего до 36 дюймов (92 см) от копыта до плеча и весят менее 400 фунтов. (180 кг). Мамонт, являющийся самой крупной породой ослов, имеет длину 56 дюймов (143 см) от копыта до плеча и весит около 950 фунтов. (430 кг).

Куланы (Equus hemionus kulan) - дикие ослы, обитающие в основном в Туркменистане. (Изображение предоставлено Владимиром Врангелем Shutterstock)

Среда обитания

Дикие ослы встречаются только в пустынях и саваннах в северной Африке от Марокко до Сомали, на Аравийском полуострове и на Ближнем Востоке.

Домашние ослы, с другой стороны, встречаются по всему миру, но предпочитают сухие и теплые места. Например, по данным Государственного университета Оклахомы, абиссинского осла разводят в Эфиопии, а анатолийского осла разводят в Турции.

Один вид, кианг или тибетский дикий осел, встречается в Китае, северных частях Пакистана, Индии, Непале и Бутане.

Привычки

Самцов ослов называют джеками, а самок - дженнетами или дженни. Ослы очень общительны и обычно живут группой, называемой стадом.Стадо обычно возглавляет один домкрат и состоит из нескольких дженни в дикой природе. Были обнаружены более крупные стада, в которых есть несколько самцов. Пока дополнительные самцы подчиняются доминирующему самцу, все идет гладко. Однако ослы, похоже, не образуют крепких связей. В дикой природе стада часто распадаются и регулярно реформируются с новыми членами.

Ослы отдыхают в самое жаркое время дня. Они более активны утром и вечером, путешествуют и едят вместе со стадом.

Согласно Глобальной базе данных по инвазивным видам, домашних ослов обычно используют для выращивания вьючных животных или молока. Иногда ослов обучают защищать другой домашний скот от хищников. Они будут топтать любое животное, которое сочтут угрозой.

Диета

Ослы обычно любят есть траву, хотя они также едят кусты и пустынные растения. Вместо того, чтобы сразу рвать траву зубами, ослы хватают растение губами, затягивают его ртом, затем рвут своими плоскими зубами и растирают, чтобы проглотить.

Ослы - ненасытные едоки. Осел может съесть до 6000 фунтов. (2722 кг) пищи в год, согласно Глобальной базе данных по инвазивным видам. Когда речь идет о диких ослах, это огромное количество вызывает беспокойство. Одичавшие ослы могут переселяться в места обитания и брать пищу у местных животных.

Потомство

Хотя ослов, похоже, не волнует, кто в их стаде, они также не разборчивы в том, с кем размножаться. Помимо других ослов, они будут размножаться с лошадьми и зебрами.Потомство - гибриды двух типов лошадиных. По данным Университета Майами, при спаривании гнезда и самки лошади получается животное, называемое мулом, а из дженни и самца - лошак. Спаривание между зеброй и ослом дает то, что называется зеброидом, зеброй или зидонком. Гибриды почти всегда бесплодны и не могут давать потомства.

Период беременности ослов составляет около 12 месяцев. Осликов-детенышей называют жеребятами. Жеребята весят от 19 до 30 фунтов. (8.От 6 до 13,6 кг) при рождении и может стоять и кормить грудью уже через 30 минут после рождения. В 5 месяцев жеребят отлучают от груди, а в 2 года они становятся достаточно взрослыми, чтобы спариваться. Самки, как правило, рожают нового жеребенка каждый год.

Взрослый и детеныш сомалийского дикого осла (Equus africanus somaliensis) пасутся. (Изображение предоставлено: Sergei25 Shutterstock)

Классификация / таксономия

Вот таксономия ослов в соответствии с Интегрированной системой таксономической информации (ITIS):

Kingdom : Animalia Subkingdom : Bilateria Infrakingdom 129 Deuterostomia : Deuterostomia 90 : Chordata Subphylum : Vertebrata Infraphylum : Gnathostomata Суперкласс : Tetrapoda Class : Mammalia Subclass : Theria Infraclass 000: Equheria 9: род. Виды :

Equus asinus - осел, осел, осел Equus hemippus - Сирийский дикий осел, ахдари Equus khur - Индийский дикий осел, khur Equus africanus : Африканский дикий осел

03

  • Equus africanus africanus - Дикий нубийский осел
  • Equus africanus somaliensis - Сомалийский дикий осел

Equus hemionus - Азиатский дикий осел, онагр, кулан

Подвиды :

  • Equus Equus hemionus кулан - кулан, туркменский онагр
  • Equus hemionus onager - иранский онагр

Equus kiang - тибетский дикий осел, kiang

Подвиды :

    • Eastern Equrius Equus kiang kiang - Western kiang
    • Equus kiang polyodon - Sounthern kiang

    Статус сохранения

    Хотя домашним ослам нет угрозы исчезновения, этого нельзя сказать о диких ослах.По данным Международного союза охраны природы (МСОП), африканский дикий осел находится под угрозой исчезновения, и осталось от 23 до 200 взрослых особей. Азиатские дикие ослы классифицируются как находящиеся под угрозой исчезновения, их популяция составляет около 28000 человек.

    Зедонк - это гибрид осла и зебры. Их еще называют zonkeys. (Изображение предоставлено: Джесс Крафт Шаттерсток)

    Другие факты

    Если осел одичал, он будет искать теплую и сухую среду обитания.

    Когда лошади напуганы, они часто прыгают или убегают.Когда ослы напуганы, они замерзают и исследуют все, что их пугает, что дало им репутацию упрямых. Однако обычно ослы очень послушны.

    У ослов обычно есть темная полоса меха на спине и плечах, и они могут рождаться с широким спектром окрасов.

    Дополнительные ресурсы

    Характеристика Prdm9 у непарнокопытных и бесплодие мулов

    Абстрактные

    Prdm9 ( Meisetz) - первый ген видообразования, обнаруженный у позвоночных, обеспечивающий репродуктивную изоляцию.Этот локус кодирует мейоз-специфичную гистоновую h4-метилтрансферазу, которая определяет горячие точки мейотической рекомбинации во время гаметогенеза. Аллельные различия в Prdm9 , характеризующиеся переменным количеством доменов цинкового пальца (ZF), были связаны с гибридной стерильностью у самцов домашних мышей через нарушение сперматогенности на стадии пахитены. Мул, классический пример гибридной стерильности у млекопитающих, также демонстрирует сходное нарушение сперматогенеза, что делает Prdm9 интересным кандидатом для оценки у гибридов лошадей.В этом исследовании мы охарактеризовали ген Prdm9 у всех видов непарнокопытных путем анализа вариации последовательности доменов ZF и оценки положительного отбора. Мы также оценили роль Prdm9 в стерильности гибридов путем оценки аллельных различий доменов ZF у гибридов лошадей. Мы обнаружили замечательные вариации в последовательности и количестве доменов ZF среди видов непарнокопытных, начиная от пяти доменов у тибетского кига и азиатского дикого осла до 14 у зебры Греви. Положительный отбор был обнаружен у всех видов на аминокислотных участках, которые, как известно, связаны со специфичностью связывания ДНК доменов ZF у мышей и людей.Гибриды лошадей, в частности квартетная родословная, состоящая из фертильного мула, показала мозаику последовательностей и количества доменов ZF, что позволяет предположить, что вариация Prdm9 сама по себе не способствует стерильности гибридов лошади.

    Образец цитирования: Steiner CC, Ryder OA (2013) Характеристика Prdm9 у непарнокопытных и бесплодие у мулов. PLoS ONE 8 (4): e61746. https://doi.org/10.1371/journal.pone.0061746

    Редактор: Павел Михалак, Технологический институт Вирджинии, Соединенные Штаты Америки

    Поступило: 19 декабря 2012 г .; Одобрена: 12 марта 2013 г .; Опубликовано: 22 апреля 2013 г.

    Авторские права: © 2013 Steiner, Ryder.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Финансирование: Эта работа финансировалась грантом Национального научного фонда для проекта «Древо жизни млекопитающих» (AToL), номер гранта DEB-0629811. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

    Введение

    Увлекательный нерешенный вопрос в эволюционной биологии сосредотачивается на механизмах образования новых видов и процессах, которые сохраняют виды как отдельные объекты. Виды сохраняют свою целостность за счет набора репродуктивных барьеров до и после спаривания. Среди них гибридная стерильность - один из самых ранних постзиготных изолирующих барьеров при скрещивании видов, обычно встречающихся у гетерогаметного пола (XY или ZW), закономерность, известная как правило Холдейна [1].Считается, что постзиготные репродуктивные барьеры возникают из-за приобретения генетической несовместимости в дивергентных популяциях, как это было предложено моделью Добжанского-Мюллера [2], в которой отрицательный эпистаз между аллелями / локусами вызывает бесплодие или инвазивность гибридов [3].

    Несколько генов были связаны со стерильностью гибридов у модельных видов [4], [5]. В Drosophila некоторые примеры включают гены Odysseus-site homeobox [6], JYAlpha [7] и Overdrive [8].Совсем недавно Prdm9 ( Meisetz) был идентифицирован как первый ген видообразования, обеспечивающий репродуктивную изоляцию у позвоночных [9]. Этот ген кодирует мейоз-специфичную гистоновую h4-метилтрансферазу, которая экспрессируется только в половых клетках, вступающих в профазу мейоза [10], [11]. Prdm9 содержит домены KRAB и SET, которые являются высококонсервативными среди многоклеточных животных [12], за которыми следует набор Cys 2 His 2 повторяющихся доменов цинкового пальца (ZF) в тандеме около карбоксиконцевой области [13].Домены ZF представляют собой ДНК-связывающие области, которые модульно придают специфичность гену. Структура доменов ZF хорошо известна и состоит из 21 остатка консервативных аминокислот, которые координируют и позиционируют высоко вариабельную контактную область нуклеотидов, и семи консервативных аминокислотных линкеров, которые соединяются с соседними цинковыми пальцами [14]. Prdm9 ZF-домены демонстрируют быструю эволюцию и положительный отбор в различных организмах, включая человека, мышей, крупный рогатый скот и лосося [12], [15].Однако у других видов этот ген отсутствует (птицы, ящерицы, змеи) или приобрел разрушающие мутации, такие как псевдоген у собак [16].

    Prdm9 у позвоночных отвечает за активацию и спецификацию горячих точек мейотической рекомбинации в масштабе всего генома [17] - [21]. Prdm9 -нулевые мыши обнаруживают остановку гаметогенеза в профазе I мейоза и нарушение репарации двухцепочечных разрывов [10]. Аллельные различия в количестве доменов ZF в Prdm9 были связаны с гибридной стерильностью при скрещивании домашних мышей из-за нарушения сперматогенеза.Например, аллель Prdm9 , кодирующий 13 доменов ZF (PRDM9 B6 ) в Mus musculus domesticus (Mmd), вызывает бесплодие у самцов-гибридов F1 в сочетании с другим аллелем Mmd, содержащим 14 доменов ZF (PRDM9 C3H ). [9]. Более того, у людей редкие доминантные несинонимичные мутации в Prdm9 связаны с азооспермией, что также указывает на наличие аллельной несовместимости [22].

    Мулы, гибридное потомство самки лошади и самца осла, также демонстрируют сходные нарушения сперматогенеза на стадии пахитены мейоза [23], [24], что делает Prdm9 интересным геном-кандидатом для оценки при межвидовых скрещиваниях лошадей.Современные лошадиные принадлежат к недавно возникшей группе млекопитающих, расходящихся от общего предка около четырех миллионов лет назад [25], [26]. Из-за относительно недавнего времени расхождения многие жизнеспособные, но обычно бесплодные гибридные комбинации могут быть получены не только посредством опосредованного человеком воспроизводства, но и естественным путем [27], [28]. Утверждается, что различия в количестве и структуре гаплоидных наборов хромосом составляют основу неспособности хромосомных пар к синапсу в мейозе, вызывая бесплодие у гибридов лошадей [29].Однако сообщения о случаях, когда самки мулов и других гибридов лошадей с нечетным числом хромосом давали совершенно жизнеспособное потомство [30] - [33], предполагают, что механизмы, помимо хромосомных различий, способствуют стерильности гибридов у непарнокопытных.

    В этом исследовании мы исследуем роль гена Prdm9 в стерильности гибридов лошадей путем оценки аллельных различий доменов ZF у гибридов, включая фертильную родословную мулов. С этой целью мы охарактеризовали Prdm9 у всех видов непарнокопытных путем определения паттернов изменения последовательности доменов ZF и оценки положительного отбора.Хотя этот подход выявил радикальные изменения в количестве доменов ZF и быструю эволюцию среди видов, аллельная вариация Prdm9 сама по себе не вызывает бесплодия у непарнокопытных.

    Методы

    Заявление об этике

    Все образцы были собраны у животных после смерти или в ходе медицинского обследования в соответствии с номером IACUC 12-023. Это исследование было одобрено Зоологическим обществом Сан-Диего, Комитетом по институциональному уходу и использованию животных (N.H.I Assurance A3675-01).

    Отбор проб

    Всего мы изучили 14 особей лошадиных, принадлежащих к восьми видам: домашняя лошадь, Equus caballus (2 особи), лошадь Пржевальского, E. przewalskii (2), тибетский кианг, E. kiang (1) , Азиатский дикий осел, E. hemionus с двумя подвидами (онагр и кулан; 3), африканский дикий осел, E. asinus (2), горная зебра, E. zebra (2), зебра Берчелла, Э.burchelli (1) и зебра Греви, E. grevyi (1). Кроме того, были исследованы семь гибридов лошадей, соответствующих: E. hemionus kulan × E. kiang , E. przewalskii × E. caballus , E. grevyi × E. caballus , E . hemionus kulan × E. asinus , плодородный мул ( E. asinus × E. caballus ) и два ее потомка ( E. asinus × мул). Экстракцию ДНК проводили из биопсий крови, семенников, селезенки и кожи (таблица S1) с использованием фенол / хлороформного метода или набора DNeasy для крови и тканей (Qiagen).Образцы ДНК хранятся в Зоопарке Сан-Диего Института исследований по охране природы.

    Equid

    Prdm9 Последовательности

    Хорошо аннотированные Prdm9 последовательностей человека и мыши были получены из браузеров NCBI, Ensembl и UCSC. Эти последовательности были использованы для исследования генома домашней лошади (сентябрь 2007 г., Broad / equCab2) и предсказания гена Prdm9 с использованием TBLASTn. Лучшие совпадения показали идентичность последовательностей выше 75% для всех сравнений (лошадь-мышь, лошадь-человек).Последовательность ДНК лошади извлекали и использовали для конструирования праймеров в консервативных областях выравнивания последовательностей мыши, человека и лошади. В частности, были сконструированы праймеры для амплификации последнего экзона Prdm9 у лошадей, содержащих домены ZF: Prdm9 _I5F 5'CAGGCAGCCTTGTCAACATCTACCCT, Prdm9 _I6RbTdAtGATGATGATGA0008 и PrdmGATGATGATGATGATGATGTGTGTG8

    Амплификации полимеразной цепной реакции (ПЦР) проводили в объеме 20 мкл с использованием термоциклеров Eppendorf Mastercycler Gradient.Каждая реакция включала 30 нг матричной ДНК, 10 мкл 1X буфера Taq с 1,5 мМ MgCl 2 (Applied Biosystems), 0,3 мкл 10 мМ дезоксинуклеозидтрифосфатов, 0,6 мкл 1М каждого праймера и 0,15 единиц ДНК-полимеразы Taq (Applied Biosystems). Биосистемы). Условия цикла ПЦР: 95 ° C в течение 6 мин, затем 34 цикла денатурации при 94 ° C в течение 1 мин, отжиг при 59–60 ° C в течение 1 мин и удлинение при 72 ° C в течение 1 мин с последующим продлением. при 72 ° C в течение 10 мин.

    Все продукты ПЦР очищали с использованием набора для очистки гелей Qiaquick (Qiagen) и клонировали с помощью набора для клонирования TOPO TA (Invitrogen), следуя инструкциям производителя.Клонирование было осуществлено благодаря обнаружению двух продуктов ПЦР одинакового размера на 2% агарозных гелях у некоторых видов и гибридов непарнокопытных. Прямой и обратный праймеры M13 плюс праймеры Prdm9 использовали для секвенирования минимум пяти положительных клонов на вид и гибрид. Последовательности ДНК редактировали и выравнивали с помощью Sequencher 3.1.1 (Gene Codes, Ann Arbor, MI) и Geneious v1.2.1 [34], а затем корректировали на глаз, сохраняя рамку считывания домена ZF. Все равнозначные последовательности были транслированы и протестированы на кодирование нескольких доменов ZF в кадре.Последовательности Equid Prdm9 были отправлены в Genbank (номера доступа KC209783 – KC209813).

    Equid

    Prdm9 кДНК

    Суммарную РНК экстрагировали из семенников азиатского дикого осла (онагра) с использованием тризольного реагента. RT-PCR была настроена для отбора поли (A) РНК (мРНК) с олиго (dT) в соответствии с системой синтеза первой цепи с надстрочным индексом III (Invitrogen). Амплификацию целевой кДНК проводили с использованием специфических праймеров, которые также использовали для секвенирования: Prdm9 _E6F_cDNA 5 'AGCTAGAGATCCATCCATGTC и Prdm9 _I6R_cDNA 5' GTCCTCTTGGGGCTGAGACGTGAT.КДНК онагра секвенировали для подтверждения экспрессии Prdm9 в семенниках лошадиных и проверки последовательностей Prdm9 , полученных из геномной ДНК. Последовательности редактировали и выравнивали, как описано ранее.

    Prdm9 Идентификация ортолога и отображение символов

    Ортология последовательностей equid Prdm9 была первоначально проверена с помощью TBLASTn. Во всех случаях наилучшие совпадения (e <10 −6 ) всегда соответствовали последовательностям Prdm9 от других видов (например,g., Mus , Homo , Peromyscus , Apodemus ) со средней идентичностью последовательностей более 75%. Известные паралоги Prdm9 , такие как Prdm7 , никогда не считались лучшими. Последовательности Prdm9 с наивысшим баллом из Genbank были взяты для взаимного лучшего BLAST против равных последовательностей для проверки предполагаемых ортологов. Чтобы проверить идентичность последовательностей, последовательности equid Prdm9 были обработаны против генома домашней лошади с использованием BLAT (браузер UCSC).

    Наличие / отсутствие доменов ZF было картировано на байесовском филогенетическом дереве семейства Equidae [35] с использованием MacClade 4.08 [36] для проверки закономерностей эволюции доменов ZF среди клонов непарнокопытных. Предполагалось, что все символы неупорядочены и имеют одинаковый вес, а при расчетах учитывались только однозначные изменения.

    dN / dS Анализирует

    Из-за высокой степени согласованной эволюции, которая может происходить среди ZF-доменов, попарный анализ несинонимичного к синонимичному соотношению скоростей (dN / dS) последовательностей Prdm9 разных видов может вводить в заблуждение [15].Учитывая это, положительный анализ отбора проводился только для доменов ZF, состоящих из 28 аминокислот с двумя остатками цистеина и двумя остатками гистидина. ZF домены сравнивали внутри и среди видов непарнокопытных. Кодоны выравнивали с помощью выравнивания белков ClustalW [37] (параметры по умолчанию). Филогенетические деревья из каждого выравнивания были построены с использованием максимальной экономии в PAUP * версии 4.0b10 [38] и PhyML 3.0 [39]. Топологии принимались, если не наблюдалось серьезных расхождений между методами и деревья поддерживались 1000 повторениями начальной загрузки (> 80%) [40].Программа codeml из PAML [41] использовалась для выявления значительных различий в значениях правдоподобия между почти нейтральными (модель 7) и позитивными моделями отбора с неограниченной омегой (модель 8) и омегой, ограниченной до 1.0 (8a). Пороговые значения P были скорректированы для нескольких тестов (поправка Бонферрони). Аминокислотные сайты при положительном отборе и P-значения были выведены с использованием подхода Байеса-Эмпирического-Байесовского dN / dS в модели без ограничений 8.

    Результаты

    Equid

    Prdm9 Последовательности и положительный отбор

    Мы секвенировали последний экзон Prdm9, , который содержит домены ZF, у 14 непарнокопытных особей.Эти последовательности варьировались от 1074 до 1830 п.н. в зависимости от вида. При использовании против генома домашней лошади последовательности лошадей соответствовали неаннотированной области в хромосоме 3 (положение 6378542–36379363) со средней идентичностью 96%. В частности, совпадения, полученные из браузеров NCBI, UCSC и Ensembl, характеризовались наличием ранних стоп-кодонов после третьего домена ZF по сравнению с сгенерированной нами последовательностью домашней лошади (рисунок 1), которая показывала большее количество доменов ZF. Попытки последовательности UCSC и NCBI были идентичны частичной последовательности из Ensembl, аннотированной как Prdm7 , гену паралога Prdm9 , обнаруженному у других видов позвоночных.Этот результат предполагает, что у лошадиных может быть по крайней мере два гена Prdm , одна более короткая копия, аннотированная как Prdm7 , и вторая еще не аннотированная копия, соответствующая Prdm9 , которые различаются по последовательности и количеству доменов ZF.

    Рисунок 1. Выравнивание доменов домашней лошади Prdm9 ZF.

    Последовательность, подтвержденная как Prdm9 у домашней лошади (жирный шрифт), была обработана против генома лошади с использованием браузеров NCBI, UCSC и Ensemble.Аминокислотная вариация последовательной домашней лошади выделена синими открытыми прямоугольниками. Линкеры между доменами ZF обозначены серыми столбиками, начало доменов ZF - пунктирными линиями, стоп-кодоны - звездочками, а остатки Cys 2 His 2 - красными буквами.

    https://doi.org/10.1371/journal.pone.0061746.g001

    В последовательностях equid Prdm9 мы идентифицировали 13 различных доменов ZF, характеризующихся изменением аминокислот в определенных положениях -5, -2, -1, 3 и 6 (рисунок 2).Все виды показали конечный экзон Prdm9 , содержащий смесь доменов ZF, некоторые из которых появляются в видоспецифичных клонах. Например, домены ZF A, D, I и K были идентифицированы только у кабаллиновых лошадей, родословная, состоящая из домашней лошади и лошади Пржевальского (рис. 3). У лошадей сильно варьировало количество доменов ZF: от пяти в тибетском кианг ( E. kiang ) до 14 доменов ZF в зебре Греви (рис. 3). Внутривидовые вариации в количестве доменов ZF также наблюдались у таких видов, как лошадь Пржевальского, варьируя от 8 до 11, онагра от 7 до 8 и горная зебра от 6 до 7 доменов ZF.Гетерогенность между парами хромосом была обнаружена у африканского дикого осла, домашнего осла, онагра и горной зебры, различающихся одним или двумя доменами ZF, или до семи у зебры Берчелла. Более того, повторяющиеся домены ZF были распознаны у всех исследованных индивидуумов, что позволяет предположить, что Prdm9 , возможно, претерпел согласованную эволюцию у непарнокопытных; то есть некоторые домены ZF имеют идентичные последовательности, причем внутривидовые вариации меньше, чем между видами. В частности, зебра Греви показала наибольшее количество идентичных повторяющихся доменов с пятью копиями ZF-домена H и шестью копиями C в обеих хромосомах.

    Рисунок 2. Prdm9 доменов ZF, идентифицированных у видов непарнокопытных.

    Каждый домен ZF закодирован цветом / буквой, а аминокислотные вариации указаны в положениях -5, -2, -1, 3 и 6 (серые пустые прямоугольники). Домены ZF под пунктирными линиями - это те, которые идентифицированы только у гибридов лошадей, но не у видов непарнокопытных. Линкер из семи аминокислот обозначен серыми столбиками, а остатки Cys 2 His 2 красными буквами.

    https://doi.org/10.1371 / journal.pone.0061746.g002

    Рис. 3. Диплоидная структура доменов Prdm9 ZF у эквидов.

    Отображается количество и последовательность доменов ZF с указанием пола человека. ZF-домены с цветовой / буквенной кодировкой соответствуют рисунку 2. Специфические для происхождения домены ZF картированы на филогении непарнокопытных согласно [33]. Домашние лошади демонстрировали ту же последовательность Prdm9 для последнего экзона, таким образом, изображена только одна последовательность. Последовательность onager Prdm9 , полученная из кДНК, обозначена звездочкой.

    https://doi.org/10.1371/journal.pone.0061746.g003

    Положительный отбор оценивался в доменах ZF каждого вида и вида вместе взятых. Значения –2 δ ln L между моделями M8 и M8a варьировались от 7,35 (P = 0,0258) у азиатских диких ослов до 15,05 (P = 0,0005) у горных зебр, что свидетельствует о наличии положительного отбора у всех видов независимо ( P <0,05; таблица S2). Подход Bayes-Empirical-Bayes dN / dS выявил положительно выбранные сайты, соответствующие положениям аминокислот -5, -2, -1, 3 и 6 (таблица 1).Анализ всех видов вместе взятых также обнаружил положительный отбор в доменах ZF после поправки на множественные сравнения (P <0,0063). Меньшее количество аминокислотных положений показало признак положительного отбора, соответствующий сайтам -1 и 6, со значениями dN / dS, превышающими нейтральную скорость, в 8 раз или более (Рисунок 4).

    Рис. 4. Оценка dN / dS вариабельных аминокислотных участков у всех непарнокопытных.

    доменов ZF всех видов вместе были протестированы на положительный отбор, при этом значимые сайты отмечены двумя звездочками (P <0.01).

    https://doi.org/10.1371/journal.pone.0061746.g004

    Prdm9 Вариация последовательности у гибридов лошадей

    Мы также секвенировали последний экзон Prdm9 семи гибридов лошадей. Сходные домены ZF были идентифицированы у гибридов относительно видов непарнокопытных. Некоторые последовательности не были обнаружены, в том числе ZF-домены E и J. Четыре домена были отмечены только у гибрида лошадь × домашняя лошадь Пржевальского и фертильного мула (рис. 2). Все гибриды показали химерный состав и различное количество доменов ZF между парами хромосом. Prdm9 различается между гибридными хромосомами одним доменом у азиатского дикого осла (кулан) × тибетского кианга (5 и 6 ZF) и азиатского дикого осла (кулан) × африканского дикого осла (6 и 7), на три домена (8 и 6 ZF). 11) у гибридов зебры Греви × домашняя лошадь и лошадь Пржевальского × домашней лошади (рис. 5А).

    Рис. 5. Prdm9 ZF доменов у гибридов лошадей.

    (A) Вариация последовательности и количество доменов ZF у гибридов с родительским вкладом, выведенным в соответствии с рисунком 3.(B) Сегрегация доменов ZF в родословной фертильного мула с указанием количества и последовательности доменов ZF для родителей (мула-самца и осла-производителя) и двух потомков. Открытые красные прямоугольники указывают на хромосому, полученную от матери, а синие прямоугольники - от производителя. Число диплоидных хромосом (2n) и пол указаны для всех особей в родословной.

    https://doi.org/10.1371/journal.pone.0061746.g005

    Репродуктивный статус исследованных гибридов лошадей неизвестен, за исключением одной фертильной самки мула, родословная которой известна.Мы исследовали квартет, состоящий из фертильного мула (мать, 2n = 63), осла (отец, 2n = 62) и двух потомков F1 (самцы, 2n = 63). Мы использовали эту родословную информацию для оценки роли различий аллелей Prdm9 в гибридной стерильности непарнокопытных. Было обнаружено, что у обоих родителей одинаковое количество доменов ZF, причем одна хромосома содержит 10, а остальные восемь доменов (рис. 5B). Последовательности между парами хромосом были подобны у осла, но химерны у плотиного мула, показывая характеристики домашнего осла и лошади.Родительские хромосомы, содержащие 8 доменов ZF, отделены от мулов F1, в результате чего образуются две хромосомы с равным количеством доменов ZF. Мулы F1 демонстрировали химерный состав доменов ZF, наблюдаемый у самок, и вариации последовательности в аминокислотных сайтах -2, -1, 3 и 6. Эти результаты предполагают, что ни нечетное число хромосом (2n = 63), ни аллельные различия в числе ZF-доменов Prdm9 вызывает бесплодие у самки мула.

    Обсуждение

    Генетическая изменчивость и положительный отбор

    В этом исследовании мы сгенерировали частичные последовательности, проверенные как ортологи Prdm9 для 14 особей всех видов непарнокопытных и семи гибридов лошадей.Последовательности равных, расходящиеся с геномом лошади, лучше всего подходят таким образом, чтобы можно было предположить, что копии генов Prdm еще не аннотированы в геноме лошади. Дупликация генов Prdm не является чем-то необычным и была описана у других позвоночных, по крайней мере, у людей известно 17 членов семейства Prdm [42]. У приматов Prdm7 является известным паралогом Prdm9 , который претерпел серьезные структурные перестройки, уменьшающие количество кодируемых цинковых пальцев и модифицирующие сплайсинг генов [43].Отсутствие аннотированных генов Prdm в геноме лошади может быть результатом ограничений, связанных с текущими методами сборки генома при идентификации дублированных геномных областей или сателлитной ДНК [44].

    Prdm9 ZF-домены у непарнокопытных демонстрировали резкое изменение численного и аминокислотного состава. Эта высокая вариабельность расширяет находки у других организмов, демонстрируя быструю эволюцию этих доменов [14], [15]. Prdm9 Домены ZF предположительно быстро эволюционируют из-за нестабильности, происходящей из минисателлитной структуры массива ZF [16].Кроме того, Оливер и др. [15] предположили, что Prdm9 может функционировать путем связывания с повторяющимися последовательностями ДНК, обнаруженными в перицентрических и центромерных областях, которые состоят из быстро развивающихся повторяющихся мотивов [45]. In vitro , PRDM9, как было показано, связывает ДНК в горячих точках рекомбинации через свои домены ZF, а генетические манипуляции с доменами ZF изменяют локализацию горячих точек [11], [18].

    Множественные исследования подтвердили, что Prdm9 ZF доменов подверглись сильному положительному отбору, хотя этот паттерн может не охватывать всех многоклеточных животных [14], [15].У грызунов и приматов положительный отбор в определенных позициях связывания ДНК (-1, 3, 6) привел к дивергентной эволюции [15]. У непарнокопытных положительный отбор ограничивался положениями аминокислот -1 и 6, которые соответствуют сайтам, ответственным за определение специфичности связывания ДНК Prdm9 . Структурные исследования показали, что аминокислоты внутри α-спирали ZF в положениях -1, 3 и 6 взаимодействуют с основаниями 3, 2 и 1 соответственно в первичной цепи ДНК [46]. Отбор, действующий на остатки -1 и 6 равных ZF-доменов, может изменять предпочтения связывания ДНК, кодируемые Prdm9 среди этих видов.

    Гибридная стерильность у лошадей

    Аллельная несовместимость в гене Prdm9 , описанная у домашней мыши [9], [47], представляет собой вероятный генетический механизм, объясняющий стерильность гибридов у непарнокопытных. Однако у фертильной самки мула изменение количества доменов ZF, по-видимому, не приводит к аллельной несовместимости в пределах Prdm9 , а затем к бесплодию. Этот результат не является неожиданным, учитывая, что фертильность самок гибридных домовых мышей никогда не нарушается из-за аллельных различий Prdm9 , учитывая, что бесплодие обусловлено самцами (гетерогаметный пол) в соответствии с правилом Холдейна [9].

    На основании наших результатов нельзя сделать четкий вывод о роли Prdm9 в стерильности гибридов лошадей, за исключением того, что вариация Prdm9 доменов ZF сама по себе не способствует стерильности. Это предположение подтверждается единственным фертильным самцом непарнокопытных в этом исследовании, который также показывает вариации в количестве доменов ZF, домашняя осла. Prdm9 Ген все еще может быть важным геном видообразования у непарнокопытных из-за генетической несовместимости с другими локусами (эпистатические эффекты) [47].В частности, известно, что Prdm9 взаимодействует с хромосомой X (область DXSr62) у домашней мыши, и известно, что оба локуса необходимы для обеспечения стерильности F1 [48]. Незначительные QTL на хромосомах 13 и 14 также играют роль в стерильности гибридов, будучи достаточными для активации генетической несовместимости у гибридов мышей-самцов [48]. Гибридная стерильность у домашних мышей, по-видимому, имеет олигогенную природу, что указывает на важность учета генетических взаимодействий Prdm9 .

    Несомненно, Prdm9 не является единственным геном, связанным с гибридной стерильностью у позвоночных, поскольку этот ген отсутствует у многих видов, таких как Xenopus , Anolis и Gallus [12], или стал псевдогеном, что подтверждено. у собак [16].Тем не менее, наши открытия быстрой эволюции Prdm9 ZF доменов в дополнение к известной функции этого гена в определении горячих точек мейотической рекомбинации, подтверждают его важную роль в гаметогенезе у непарнокопытных. Дальнейшие исследования с рассмотрением дополнительных гибридов лошадиных и изучение генетических взаимодействий Prdm9 с другими локусами внесут вклад в прояснение роли этого гена в создании барьеров репродуктивной изоляции у этой группы млекопитающих, находящихся под угрозой исчезновения.

    Благодарности

    Мы хотели бы поблагодарить Леону Хемник, Андреа Путман, Хайди Дэвис и трех анонимных рецензентов за полезные комментарии к рукописи.В лаборатории помогали Анна Мительберг и Розана Турси (летние стажеры San Diego Zoo Global).

    Вклад авторов

    Задумал и спроектировал эксперименты: CCS OAR. Проведены эксперименты: CCS. Проанализированы данные: CCS. Предоставленные реагенты / материалы / инструменты анализа: OAR. Написал бумагу: CCS OAR.

    Ссылки

    1. 1. Лори К. (1997) Слабый пол гетерогаметен: 75 лет правления Холдейна. Генетика 147: 937–951.
    2. 2. Muller H (1942) Изолирующие механизмы, эволюция и температура.В: Т Д, редактор. Биологические симпозиумы. Ланкастер, Пенсильвания: Jaques Cattell Press. С. 71–125.
    3. 3. Койн Дж., Орр Х. (2004) Видообразование. Сандерленд, Массачусетс: Sinauer Associates, Inc. 545 стр.
    4. 4. Пресгрейвс Д. (2010) Молекулярная эволюционная основа видообразования. Nature Reviews Genetics 11: 175–180.
    5. 5. Джонсон Н.А. (2010) Гены гибридной несовместимости: остатки геномного поля битвы? Тенденции в генетике 26: 317–325.
    6. 6. Perez D, Wu C (1995) Дальнейшая характеристика локуса Odysseus гибридной стерильности у Drosophila: одного гена недостаточно.Генетика 140: 201–206.
    7. 7. Masly J, Jones C, Noor M, Locke J, Orr H (2006) Транспозиция гена как причина гибридной стерильности у Drosophila. Наука 313: 1448–1450.
    8. 8. Phadnis N, Orr H (2009) Один ген вызывает как мужскую стерильность, так и нарушение сегрегации у гибридов Drosophila. Наука 323: 376–379.
    9. 9. Mihola O, Trachtulec Z, Vlcek C, Schimenti JC, Forejt J (2009) Ген видообразования мыши кодирует мейотическую метилтрансферазу гистона h4.Наука 323: 373–375.
    10. 10. Hayashi K, Yoshida K, Yasuhisa M (2005) Метилтрансфераза гистона h4 контролирует эпигенетические события, необходимые для профазы мейоза. Природа 438: 374–378.
    11. 11. Gray C, Barthes P, Chauveau-Le Friec G, Langa F, Baudat F, et al. (2011) ДНК-связывающая специфичность мышиного PRDM9 определяет сайты триметилирования гистона h4 лизина 4 для инициации мейотической рекомбинации. PLoS Biology 9: e1001176.
    12. 12. Ponting CP (2011) Каковы геномные движущие силы быстрой эволюции PRDM9? Тенденции в генетике 27: 165–171.
    13. 13. Hayashi K, Matsui Y (2006) Meisetz, новая гистон-триметилтрансфераза, регулирует мейоз-специфический эпигенез. Клеточный цикл 5: 615–620.
    14. 14. Томас Дж. Х., Эмерсон Р. О., Шендуре Дж. (2009) Необычайная молекулярная эволюция гена фертильности PRDM9. PLoS One 4: e805.
    15. 15. Оливер П.Л., Гудштадт Л., Байес Дж. Дж., Биртл З., Роуч К.С. и др. (2009) Ускоренная эволюция гена видообразования Prdm9 в различных таксонах многоклеточных животных.PLoS Genetics 5: e1000753.
    16. 16. Munoz-Fuentes V, Di Rienzo A, Vila C (2011) Prdm9 , главный детерминант горячих точек мейотической рекомбинации, не работает у собак и их диких родственников, волков и койотов. PLoS one 6: e25498.
    17. 17. Майерс С., Боуден Р., Тумиан А., Бонтроп Р. Э., Фриман С. и др. (2009) Стремление против мотивов горячих точек у приматов предполагает участие гена PRDM9 в мейотической рекомбинации. Наука 327: 876–879.
    18. 18. Baudat F (2010) PRDM9 является основным детерминантом горячих точек мейотической рекомбинации у людей и мышей.Наука 328: 690–690.
    19. 19. Парванов Е.Д., Петков П.М., Пайген К (2010) Prdm9 контролирует активацию горячих точек рекомбинации млекопитающих. Наука 327: 835–835.
    20. 20. Берг И.Л., Нойман Р., Сарбайна С., Оденталь-Гессе Л., Батлер Н.Дж. и др. (2011) Варианты белка PRDM9 по-разному регулируют набор горячих точек мейотической рекомбинации человека, высокоактивных в африканских популяциях. Слушания Национальной академии наук Соединенных Штатов Америки 108: 12378–12383.
    21. 21. Segurel L, Leffler EM, Przeworski M (2011) Случай непостоянных пальцев: как белок цинкового пальца PRDM9 определяет горячие точки мейотической рекомбинации у людей. PLoS Biology 9: e1001211.
    22. 22. Миямото Т., Ко Э., Сакугава Н., Сато Х., Хаяси Х. и др. (2008) Два однонуклеотидных полиморфизма в гене PRDM9 (MEISETZ) могут быть генетическим фактором риска для японских пациентов с азооспермией из-за ареста мейоза. Журнал вспомогательной репродукции и генетики 25: 553–557.
    23. 23. Chandley AC, Jones RC, Dott HM, Allen WR, Short RV (1974) Мейоз у межвидовых гибридов лошадей: самец мула и лошка. Цитогенетика и клеточная генетика 13: 330–341.
    24. 24. Хорие Т., Нисикава Ю. (1959) Исследования репродуктивной способности мулов II. О функциях яичек. Бюллетень Национального института сельскохозяйственных наук, серия G 8: 143–149.
    25. 25. Линдси Э., Опдайк Н., Джонсон Н. (1980) Расселение лошади Equus в плиоцене и расселение млекопитающих в позднем кайнозое.Природа 287: 135–138.
    26. 26. Hulbert RJ (1996) Происхождение лошади. В: Olsen S, редактор. Лошади сквозь время. Боулдер, Колорадо: Робертс Ринчарт. С. 11–34.
    27. 27. Allen WR, Short RV (1997) Межвидовая и внеспецифическая беременность у непарнокопытных: все идет. Журнал наследственности 88: 384–392.
    28. 28. Кордингли Дж. Э., Сундаресан С., Фишхофф И., Шапиро Б., Раски Дж. И др. (2009) Угрожает ли зебра Греви, находящаяся под угрозой исчезновения, гибридизация? Сохранение животных 12: 505–513.
    29. 29. Benirschke K, Low RJ, Sullivan MM, Carter RM (1964) Хромосомное исследование предполагаемого фертильного мула-кобылы. Журнал наследственности 55: 31-.
    30. 30. Short RV, Chandley AC, Jones RC, Allen WR (1974) Мейоз у межвидовых гибридов лошадей: гибрид лошади Пржевальского / домашней лошади. Цитогенетика и клеточная генетика 13: 465–478.
    31. 31. Райдер О.А., Хемнлк Л.Г., Боулинг А.Т., Бениршке К. (1985) Жеребенок самца мула считается потомком самки мула и ослицы.Журнал наследственности 76: 379–381.
    32. 32. Rong R, Chandley AC, Song J, McBeath S, Tan PP и др. (1988) Плодовитый мул и лошак в Китае. Цитогенетика и клеточная генетика 47: 134–139.
    33. 33. Генри М., Гастал Э.Л., Пинейро ЛЕЛ, Гимармес СЭФ (1995) Образец спаривания и анализ хромосом мула и ее потомства. Биология репродукции. Серия монографий 1: 273–279.
    34. 34. Драммонд А., Кирс М., Хелед Дж., Мойр Р., Тирер Т. и др. (2006) Geneious v1.2.1, Доступно: http://www.geneious.com/.
    35. 35. Steiner C, Mitelberg A, Tursi R, Ryder O (2012) Молекулярная филогения современных непарнокопытных и эффекты предкового полиморфизма в разрешении филогении на уровне видов. Молекулярная филогенетика и эволюция 65: 573–581.
    36. 36. Мэддисон Д., Мэддисон В. (2005) MacClade 4.08. Сандерленд, Массачусетс: Sinauer Associates, Inc.
    37. 37. Томпсон Дж., Хиггинс Д., Гибсон Т. (1994) CLUSTAL W: повышение чувствительности последовательного последовательного выравнивания с помощью взвешивания последовательностей, штрафов за пропуски для конкретных позиций и выбора матрицы весов.Исследование нуклеиновых кислот 22: 4673–4680.
    38. 38. Swofford D (2002) PAUP *: Филогенетический анализ с использованием экономичности (и других методов) 4.0 Beta. Sinauer Associates, Inc: Сандерленд, Массачусетс.
    39. 39. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W. и др. (2010) Новые алгоритмы и методы оценки филогении максимального правдоподобия: оценка производительности PhyML 3.0. Систематическая биология 59: 307–321.
    40. 40. Felsenstein J (1985) Пределы уверенности в филогении: подход, использующий бутстрап.Evolution 39: 783–791.
    41. 41. Yang Z (1997) PAML: программный пакет для филогенетического анализа методом максимального правдоподобия. Компьютерные приложения в биологических науках 13: 555–556.
    42. 42. Fog C, Galli G, Lund A (2011) Белки PRDM: важные игроки в дифференциации и болезни. BioEssays 34: 50–60.
    43. 43. Фумасони И., Мани Н., Рамбальди Д., Скафетта Г., Алкалай М. и др. (2007) Расширение семьи и генные перестройки способствовали функциональной специализации генов PRDM у позвоночных.BMC Evolutionary Biology 7: 187.
    44. 44. Alkan C, Sajjadian S, Eichler E (2011) Ограничения сборки последовательности генома следующего поколения. Природные методы 8: 61–65.
    45. 45. Смит Г.П. (1976) Эволюция повторяющихся последовательностей ДНК путем неравного кроссовера. Наука 191: 528–535.
    46. 46. Choo Y, Klug A (1994) Выбор участков связывания ДНК для цинковых пальцев с использованием рационально рандомизированной ДНК выявляет закодированные взаимодействия. Труды Национальной академии наук Соединенных Штатов Америки 91: 11168–11172.
    47. 47. Flachs P, Mihola O, Šimeček P, Gregorová S, Schimenti JC, et al. (2010) Интерактивная и межгенная несовместимость гена Prdm9 ( Hst1 ) при стерильности гибридов мышей. PLoS Genetics 8 (11): e1003044.
    48. 48. Дзур-Гейдосова М., Симечек П., Грегорова С., Бхаттачарья Т., Фореджт Дж. (2012) Анализ генетической архитектуры гибридной стерильности F1 у домашних мышей. Evolution 66: 3321–3335.

    (PDF) Технико-экономическое обоснование реинтродукции кулана (Equus hemionus kulan) в центральную степь Казахстана

    Отчет НИНА 1366

    55

    9 Список литературы

    АСБК.2015a. АСБК изучает хранителя степи. НОВОСТИ АКБК, 2: 9-10.

    АСБК. 2015b. Аэрофотосъемка сайгака и изучение гибели сайгака. Годовой отчет ACBK, 6-7.

    АСБК. 2016. Аэросъемка. НОВОСТИ АСБК, 4: 5.

    Абатуров Б.Д., Ларионов К.О., Колесников М.К., Никонова О.А. 2005. Состояние и кормовая обеспеченность

    сайгаков на пастбищах с разной растительностью, Зоологический журнал, 84 (3): 377-390.

    Абдельгавад, А., Дамиани, А., Хо, С.Ю.В., Штраус, Г., Szentiks, C.A., East, M.L., Osterrieder, N.,

    Greenwood, A.D., 2016. Alphaherpesviruses зебры (EHV-1 и EHV-9): генетическое разнообразие, активность La-

    ,

    и сопутствующие инфекции. Вирусы, 8 (10): 262–13.

    Аса, С.С. 2002. Репродуктивная биология лошадей. Страницы 113-117 в: Moehlman P.D. (Эд). Публикация МСОП -

    , Служба поддержки, Кембридж, Соединенное Королевство.

    Асылбеков А.Д. 2013. В Казахстане сосдан государственный пририодний заповедник «Алтын Дала».

    Степной бюлетень, 37: 25-27.

    Аткинсон, М., Блумер. E.S. 1997. Использование нейролептика длительного действия на монгольской дикой лошади

    (Equus prezwalskii prezwalskii) для облегчения создания холостяцкого стада. Proc. AAZV, pp.

    199–200.

    Бокус, К.Л., Ральстон, С.Л., Нокелс, К.Ф., Маккиннон, А., Сквайрс, Е.Л., 1990. Влияние транспорта на раннюю эмбриональную гибель кобыл. Журнал зоотехники, 68: 345-351.

    Банников А.Г., 1981. Азиатский дикий осел.Лесная Промышленность, Москва, Россия. [На русском языке,

    , английский перевод М. Пруткиной, Зоологическое общество Сан-Диего]

    Бове, В., Кокер, Р., Нуртазина, Г., Гитиан, Дж. 2015. Политика и системы животноводства, способствующие развитию

    Бруцеллез Возрождение в Казахстане. Экологическое здоровье. DOI: 10.1007 / s10393-015-1030-7

    Бекенов А.Б., Грачеванд И.А., Милнер-Гулланд Э. 1998. Экология и управление сайгаком

    в Казахстане. Обзор млекопитающих, 28 (1): 1–52.

    Беннет, Э.А., Шамплот, С., Питерс, Дж., Арбакл, Б.С., Гимарайнш, С., Прувост, М., Бар-Дэвид, С.,

    Дэвис, С.Д.М., Готье, М., Каченский, П., Куэн, Р., Машкур, М., Моралес-Мунис, А., Пучер,

    E., Турнепиче, Дж. Ф., Уерпманн, Л. П., Баласеску, А., Жермонпре, М., Гундем, К. Ю., Хемами ,

    MR, Moulle, PE, Otzan, A., Uerpmann, M., Walzer, C., Grange, T., Geigl, EM 2017. Укрощение

    позднечетвертичная филогеография евразийского дикого осла через древние и современные ДНК.

    PLoS ONE, 12: e0174216.

    Бурник Штурм, М., Ганбаатар, О., Фойгт, К.С., Каченский, П. 2016 EarlyOnline. Последовательный стабильный изотопный анализ

    выявил различия в диетической истории трех симпатрических видов непарнокопытных в Голых Гоби Mon-

    . Журнал прикладной экологии. DOI: //10.1111/1365-2664.12825

    Buuveibaatar, B., Mueller, T., Strindberg, S., Leimgruber, P., Kaczensky, P., Fuller, T.K. 2016a. Hu-

    Деятельность

    человек отрицательно влияет на распространение копытных в Монгольской Гоби.Biological Con-

    servation, 203: 168-175.

    Буувейбаатар, Б., Стриндберг, С., Каченский, П., Пейн, Дж., Чимеддорж, Б., Наранбаатар, Г.,

    Амарсайхан, С., Дашням, Б., Мунхзул, Т., Пуревсурен , Т., Хосак, Д.А., Фуллер, Т.К. 2016b

    EarlyOnline. Монгольская Гоби поддерживает самые большие в мире популяции хуланов и зобных га-

    зелл. Орикс. DOI: 10.1017 / S0030605316000417

    Buzzard, P.J., Bleisch, W.V., Xü, D., Zhang, H. 2008.Доказательства утечки чиру. Журнал зоологии,

    276: 330-335.

    Цао, Ю., Т. Чжан, X. Лян, К. Цуй, Д. Дэн, Дж. Су. 2009. Совпадение рационов отдельных копытных в районе

    Кекексили, провинция Цинхай. Сычуаньский зоологический журнал, 1: 49-54.

    Chu, H.J., Jiang, Z.G., Lan, W.X., Wang, C., Tao, Y.S., Jiang, F., 2008. Диетическое совпадение у кхулана

    Equus hemionus, газель с зобом Gazella subgutturosa и домашний скот. Acta Zoologica Sinica,

    54 (6): 941-954.[На китайском языке с аннотацией на английском языке]

    Сравнительная плацентация

    2) Общие гестационные данные

    Одинокий детеныш рождается после почти годичной беременности (7-10 месяцев, согласно к обзору Hayssen et al., 1993). Лошади, Equus caballus , имеют обычно продолжительность беременности составляет 329-345 дней, в зависимости от «породы». Эта плацента пришла из племенной группы в Сан-Диего. Парк диких животных зоопарка и от плотины, где раньше было восемь детенышей.В новорожденный был здоров и выжил. У нас умерли два новорожденных, чтобы определить вес: самец весом 36,5 кг и самка весом 29,0 кг. кг. В октябре 2007 года другая самка родила здорового теленка; его плацента весила 2200 г, а в пуповине было три нормальных сосуда.

    3) Имплантация

    Ранние стадии плацентации не описаны, поэтому ничего не известно. известен пресловутый плацентарный (хорионический) «пояс» (лошадей) у этого вида лошадей.Имплантация плаценты лошади - и вероятно, разумно провести эту аналогию - сравнительно поздно, с бластоциста плавает и посылает сигналы на поверхность эндометрия в течение нескольких дней, пока он перемещается взад и вперед по двурогой матке. Equidae имеют «обильное количество маточного молока» (Amoroso, 1962; Ramsey, 1982), в котором бластоциста может перемещаться за несколько дней до собственно имплантация.Трофобласт поглощает питательные вещества из этих маточные выделения. Они состоят из настоящих выделений и эндометрия. мусор из дегенерирующего эпителия, который позже восстанавливается. Имплантация лошади, и другие наиболее важные аспекты плацентации лошади можно найти Аллена и Стюарта (2001).

    4) Общая характеристика плаценты

    Показанная здесь плацента весила 3450 г, имела длину 100 см и максимальную длину. 60 см в ширину.Он был равномерно тонким, около 0,2 см. Шнур был прикреплен около центра мембраны вывернулись. Еще одна плацента получила через несколько дней весил 3700 г, имел аналогичные размеры, но шлангокабель шнур более полно присутствовал. Его аллантоисная часть была длиной 37 см; амнионическая часть была длиной 30 см (всего 67 см). Плацента, которая были собраны ранее, пришли с другой плотины и весили всего 1500 г.Его шнур, однако, имел длину 44 см, и весь экземпляр размер 110 х 103 см. Еще одна плацента от слабого новорожденного жеребенка-самца весил 2025 г, размер 120х70 см, шнур длиной 41 см с четырьмя сосудами, много мелких сосудов и аллантоидного протока. Было прикреплено много мекония (400 г) материнскому аспекту этой плаценты, по-видимому, от неонатального страдание. В сентябре 2003 года появилась еще одна плацента. Он весил 3000 г, имел шнур из трех сосудов длиной 84 см и отмеченной спиралью.В амнионической части был выступ, похожий на «сосок» из из которых исходил волос. Это показано ниже.

    5) Подробная информация о барьере между плодами и матерью

    Как и другие члены семейства Equidae, кианги имеют диффузную ворсинчатую эпителио-хориальная плацента. Вся поверхность плаценты покрыта с короткими, слегка разветвленными ворсинками, покрытыми одним слоем трофобласт.Бинуклеарные клетки, обнаруженные у жвачных животных, отсутствуют. Под поверхность хориона и особенно в коротких межворсинчатых участках, трофобласт в основном цилиндрический, с короткими микроворсинками и часто желтые пигментные включения. Аморосо (1961) упомянул о каплях жира в цитоплазма.

    Я предполагаю, что это плацента, из-за способности киангов гибридизоваться с несколькими другими непарнокопытными очень похож на описанный для лошади.Тогда утверждение Рамсея (1982) может быть верным, что первоначально только «плоский» контакт с эндометрием, а ворсинки не форма (срастаться с материнским эндометрием) до седьмого-восьмого недели беременности. С другой стороны, нет больших отрезков «гладких». хорион »находятся между ворсинками, как она описывала. маленьких участков, но нижеследующие виды с низким увеличением показывают что имеется довольно равномерное распределение ворсинок.Конечно, были ничего похожего на «миниатюрные семядоли», к которым Аморозо (1961) сделал Справка. Я взял образцы из многих разных областей этих плацент и все они похожи, без больших участков гладкого хориона.

    14) Иммунология

    Была проделана большая работа по изучению аллоантигенов, определенных Т-клетками, в лошадь, осел и их гибриды (см., например, Baker et al., 2001), но Насколько я могу судить, подобной работы с гемионами не сообщалось. Скорее всего, подобные системы существуют и у этого вида.

    15) Патологические особенности

    О патологии Кианг ничего не написано. По нашему опыту, травма был причиной большинства смертей, а новорожденный умер от омфалита. Последний Полученная плацента содержала типичную тератому, «дермоид», в его мембранах, которые прилегали к средней части пуповины шнур.Интересно то, что это произошло с жеребенком-самцом, так как обычные известные дермоиды - это дермоиды, полученные из яичников. Можно только предположить, что это поражение не произошло из зародышевой клетки, но, возможно, из стволовой клетки. Я считаю, что его расположение исключает присутствие прерванный близнец. Тела Барра в клетках поражения найти не удалось. В сторону из этих наблюдений, жеребенок был слабым после рождения, его нужно было вырастить вручную и имел толстую «мясистую» культю пуповины.Смерть новорожденного с запутыванием пуповины описана выше.

    16) Физиологические данные

    Была проведена огромная работа по физиологии лошади, особенно репродуктивная биология. Однако я не смог установить аналогичные ссылки для любого хемиона. Доступ к данным о лошадях можно получить по просматривая биографические ссылки, перечисленные в Hayssen et al. (1993).

    17) Другие ресурсы

    Многочисленные клеточные штаммы этого и родственных им семейства лошадиных доступны в CRES. в зоопарке Сан-Диего, связавшись с доктором Оливером Райдером по адресу [email protected]

    18) Прочие примечания - Какая дополнительная информация необходима?

    Необходимо изучить ранние стадии плаценты, особенно для того, чтобы выяснить, существует ли хорионический пояс.Точно так же эндокринные исследования необходимы.

    Благодарность

    Фотографии животных в этой главе предоставлены Зоологическим обществом. Сан-Диего. Я также очень ценю помощь патологов в зоопарке Сан-Диего.

    Список литературы

    Аллен, У. Р. и Стюарт, Ф .: Плацентация лошадей. Репродукция.Fertil Dev. 13: 623-634, 2001.

    Аморосо, E.C .: Плацентация. Глава 15, стр.127-311, In, Marshall's Physiology Репродукции, В.II, А.С. Паркс, изд. Второе издание. Little, Brown & Co., Бостон, 1961.

    Бейкер, Дж. М., Стидуорси, М., Гулл, Т., Новак, Дж., Миллер, Дж. М. и Антчак, Д. Ф .: Сохранение распознавания антител и аллоантигенов, определенных Т-клетками между видами непарнокопытных.Репродукция. Fertil. 13: 635-645, 2001.

    Долан Дж. М. Младший: Обзор киангов, Equus kiang Moorcroft, 1841, хранившихся в европейских и североамериканских зоологических коллекциях до 1970 года. Equus 2 (# 3) 253- 268, 1999. Tierpark Berlin.

    Эндерс, А.К., Медоуз, С., Стюарт, Ф. и Аллен, У.Р .: Отказ эндометрия. развитие чашки в модели осла-в-лошади при аборте у лошадей. J. Anat. 188: 575-589, 1996.

    Хаук, М.Л., Кумамото, А.Т., Кабрера, Р.М. и Бениршке, К .: Хромосомные перестройки в родословной сомалийского дикого осла Equus africanus somaliensis (Perissodactyla, Equidae). Cytogenet. Cell Genet. 80: 117-122, 1998.

    Джонс, М.Л .: Продолжительность жизни копытных в неволе. Междунар. Зоопарк Yearbk. 32: 159-169, 1993.

    Готч, А.Ф .: Млекопитающие - объяснение их латинских имен. Blandford Press, Пул, Дорсет, 1979

    Серый, А.П .: Гибриды млекопитающих. Контрольный список с библиографией. 2-е издание. Сельскохозяйственное бюро Содружества Фарнхэм Ройял, Слау, Англия, 1972 г.

    Гровс, К.П .: Лошади, ослы и зебры в дикой природе. Книги Ральфа Кертиса, Голливуд, Флорида, 1974.

    Гурфилд Н. и Бениршке К .: Тератома плаценты у лошади. Вет. Дорожка. 40: 585-588, 2003.

    Hayssen, V., van Tienhoven, A. и van Tienhoven, A .: Asdell's Patterns репродукции млекопитающих: сборник данных по конкретным видам.Комсток / Корнелл University Press, Итака, 1993.

    Крумбигель, И .: Эйнхуфер. A. Ziemsen Verlag, Виттенберг, 1958.

    Новак, Р.М .: Млекопитающие Уокера. 6-е изд. Пресса Джона Хопкинса, Балтимор, 1999.

    Рэмси, Э.М.: Плацента. Человек и животное. Praeger Publ. Нью-Йорк, 1982.

    Райдер, О.А .: Хромосомный полиморфизм Equus hemionus .Cytogenet. Клетка Genet. 21: 177-183, 1978.

    Райдер, О.А. и Chemnick, L.G .: Хромосомная и молекулярная эволюция в азиатских дикие ослы. Genetica 83: 67-72, 1990.

    Характеристика Prdm9 у лошадиных и бесплодие у мулов

    Реферат

    Prdm9 ( Meisetz) - первый ген видообразования, обнаруженный у позвоночных, обеспечивающий репродуктивную изоляцию. Этот локус кодирует мейоз-специфичную гистоновую h4-метилтрансферазу, которая определяет горячие точки мейотической рекомбинации во время гаметогенеза.Аллельные различия в Prdm9 , характеризующиеся переменным количеством доменов цинкового пальца (ZF), были связаны с гибридной стерильностью у самцов домашних мышей через нарушение сперматогенности на стадии пахитены. Мул, классический пример гибридной стерильности у млекопитающих, также демонстрирует сходное нарушение сперматогенеза, что делает Prdm9 интересным кандидатом для оценки у гибридов лошадей. В этом исследовании мы охарактеризовали ген Prdm9 у всех видов непарнокопытных путем анализа вариации последовательности доменов ZF и оценки положительного отбора.Мы также оценили роль Prdm9 в стерильности гибридов путем оценки аллельных различий доменов ZF у гибридов лошадей. Мы обнаружили замечательные вариации в последовательности и количестве доменов ZF среди видов непарнокопытных, начиная от пяти доменов у тибетского кига и азиатского дикого осла до 14 у зебры Греви. Положительный отбор был обнаружен у всех видов на аминокислотных участках, которые, как известно, связаны со специфичностью связывания ДНК доменов ZF у мышей и людей. Гибриды лошадей, в частности квартетная родословная, состоящая из фертильного мула, показала мозаику последовательностей и количества доменов ZF, что позволяет предположить, что вариация Prdm9 сама по себе не способствует стерильности гибридов лошади.

    Введение

    Увлекательный нерешенный вопрос в эволюционной биологии сосредотачивается на механизмах образования новых видов и процессах, которые сохраняют виды как отдельные объекты. Виды сохраняют свою целостность за счет набора репродуктивных барьеров до и после спаривания. Среди них гибридная стерильность - один из самых ранних постзиготных изолирующих барьеров при скрещивании видов, обычно встречающихся у гетерогаметного пола (XY или ZW), закономерность, известная как правило Холдейна [1].Считается, что постзиготные репродуктивные барьеры возникают из-за приобретения генетической несовместимости в дивергентных популяциях, как это было предложено моделью Добжанского-Мюллера [2], в которой отрицательный эпистаз между аллелями / локусами вызывает бесплодие или инвазивность гибридов [3].

    Несколько генов были связаны с гибридной стерильностью у модельных видов [4], [5]. В Drosophila , некоторые примеры включают homeobox Odysseus-site [6], JYAlpha [7] и Overdrive [8] гены.Совсем недавно Prdm9 ( Meisetz) был идентифицирован как первый ген видообразования, обеспечивающий репродуктивную изоляцию у позвоночных [9]. Этот ген кодирует мейоз-специфичную гистоновую h4-метилтрансферазу, которая экспрессируется только в половых клетках, вступающих в профазу мейоза [10], [11]. Prdm9 содержит домены KRAB и SET, которые являются высококонсервативными среди многоклеточных животных [12], за которыми следует набор Cys 2 His 2 повторяющихся доменов цинкового пальца (ZF) в тандеме около карбоксиконцевой области [13].Домены ZF представляют собой ДНК-связывающие области, которые модульно придают специфичность гену. Структура доменов ZF хорошо известна и состоит из 21 остатка консервативных аминокислот, которые координируют и позиционируют высоко вариабельную контактную область нуклеотидов, и семи консервативных аминокислотных линкеров, которые соединяются с соседними цинковыми пальцами [14]. Prdm9 ZF-домены демонстрируют быструю эволюцию и положительный отбор в различных организмах, включая человека, мышей, крупный рогатый скот и лосося [12], [15].Однако у других видов этот ген отсутствует (птицы, ящерицы, змеи) или приобрел разрушающие мутации, такие как псевдоген у собак [16].

    Prdm9 у позвоночных отвечает за активацию и спецификацию горячих точек мейотической рекомбинации в масштабе всего генома [17] - [21]. Prdm9 -нулевые мыши обнаруживают остановку гаметогенеза в профазе I мейоза и нарушение репарации двухцепочечных разрывов [10]. Аллельные различия в количестве доменов ZF в Prdm9 были связаны с гибридной стерильностью при скрещивании домашних мышей из-за нарушения сперматогенеза.Например, аллель Prdm9 , кодирующий 13 доменов ZF (PRDM9 B6 ) в Mus musculus domesticus (Mmd), вызывает бесплодие у самцов-гибридов F1 в сочетании с другим аллелем Mmd, содержащим 14 доменов ZF (PRDM9 C3H ). [9]. Более того, у людей редкие доминантные несинонимичные мутации в Prdm9 связаны с азооспермией, что также указывает на наличие аллельной несовместимости [22].

    Мулы, гибрид лошади-самки и самца осла, также демонстрируют сходные нарушения сперматогенеза на стадии пахитены мейоза [23], [24], что делает Prdm9 интересным геном-кандидатом для оценки при межвидовых скрещиваниях лошадей.Современные лошадиные принадлежат к недавно возникшей группе млекопитающих, расходящихся от общего предка около четырех миллионов лет назад [25], [26]. Из-за относительно недавнего времени расхождения многие жизнеспособные, но обычно бесплодные гибридные комбинации могут быть получены не только посредством опосредованного человеком воспроизводства, но и естественным путем [27], [28]. Утверждается, что различия в количестве и структуре гаплоидных наборов хромосом составляют основу неспособности хромосомных пар к синапсу в мейозе, вызывая бесплодие у гибридов лошадей [29].Однако сообщения о случаях, когда самки мулов и других гибридов лошадей с нечетным числом хромосом давали совершенно жизнеспособное потомство [30] - [33], предполагают, что механизмы, помимо хромосомных различий, способствуют стерильности гибридов у непарнокопытных.

    В этом исследовании мы исследуем роль гена Prdm9 в стерильности гибридов лошадей путем оценки аллельных различий доменов ZF у гибридов, включая фертильную родословную мулов. С этой целью мы охарактеризовали Prdm9 у всех видов непарнокопытных путем определения паттернов изменения последовательности доменов ZF и оценки положительного отбора.Хотя этот подход выявил радикальные изменения в количестве доменов ZF и быструю эволюцию среди видов, аллельная вариация Prdm9 сама по себе не вызывает бесплодия у непарнокопытных.

    Методы

    Заявление об этике

    Все пробы были взяты у животных после смерти или в ходе медицинского осмотра в соответствии с номером IACUC 12-023. Это исследование было одобрено Зоологическим обществом Сан-Диего, Комитетом по институциональному уходу и использованию животных (N.H.I Assurance A3675-01).

    Выборка

    Всего мы изучили 14 особей непарнокопытных, принадлежащих к восьми видам: домашняя лошадь, Equus caballus (2 особи), лошадь Пржевальского, E. przewalskii (2), тибетский кианг, E. kiang. (1), азиатский дикий осел, E. hemionus с двумя подвидами (онагр и кулан; 3), африканский дикий осел, E. asinus (2), горная зебра, E. zebra (2), Зебра Берчелла, E. Burchelli (1), и зебра Греви, E.grevyi (1). Кроме того, были исследованы семь гибридов лошадей, соответствующих: E. hemionus kulan × E. kiang , E. przewalskii × E. caballus , E. grevyi × E. caballus , E . hemionus kulan × E. asinus , плодородный мул ( E. asinus × E. caballus ) и два ее потомка ( E. asinus × мул). Экстракцию ДНК проводили из биопсий крови, семенников, селезенки и кожи (таблица S1) с использованием фенол / хлороформного метода или набора DNeasy для крови и тканей (Qiagen).Образцы ДНК хранятся в Зоопарке Сан-Диего Института исследований по охране природы.

    Equid

    Prdm9 Последовательности

    Хорошо аннотированные последовательности Prdm9 от человека и мыши были получены из браузеров NCBI, Ensembl и UCSC. Эти последовательности были использованы для исследования генома домашней лошади (сентябрь 2007 г., Broad / equCab2) и предсказания гена Prdm9 с использованием TBLASTn. Лучшие совпадения показали идентичность последовательностей выше 75% для всех сравнений (лошадь-мышь, лошадь-человек).Последовательность ДНК лошади извлекали и использовали для конструирования праймеров в консервативных областях выравнивания последовательностей мыши, человека и лошади. В частности, были разработаны праймеры для амплификации окончательного экзона Prdm9 в equids, содержащих домены ZF: Prdm9 _I5F 5'CAGGCAGCCTTGTCAACATCTACCCT, Prdm9 _I6Rb 5 ' CGTTGGAGCTGGAGTATGGAGT , и Prdm9 _If 5' GAGGCTTCAATGACAGGGCAAGTCTTAT .

    Амплификации полимеразной цепной реакции (ПЦР) проводили в объеме 20 мкл с использованием термоциклеров Eppendorf Mastercycler Gradient.Каждая реакция включала 30 нг матричной ДНК, 10 мкл 1X буфера Taq с 1,5 мМ MgCl 2 (Applied Biosystems), 0,3 мкл 10 мМ дезоксинуклеозидтрифосфатов, 0,6 мкл 1М каждого праймера и 0,15 единиц ДНК-полимеразы Taq (Applied Biosystems). Биосистемы). Условия цикла ПЦР: 95 ° C в течение 6 мин, затем 34 цикла денатурации при 94 ° C в течение 1 мин, отжиг при 59–60 ° C в течение 1 мин и удлинение при 72 ° C в течение 1 мин с последующим продлением. при 72 ° C в течение 10 мин.

    Все продукты ПЦР очищали с использованием набора для очистки гелей Qiaquick (Qiagen) и клонировали с использованием набора для клонирования TOPO TA (Invitrogen), следуя инструкциям производителя.Клонирование было осуществлено благодаря обнаружению двух продуктов ПЦР одинакового размера на 2% агарозных гелях у некоторых видов и гибридов непарнокопытных. Прямой и обратный праймеры M13 плюс праймеры Prdm9 использовали для секвенирования минимум пяти положительных клонов на вид и гибрид. Последовательности ДНК редактировали и выравнивали с помощью Sequencher 3.1.1 (Gene Codes, Ann Arbor, MI) и Geneious v1.2.1 [34], а затем корректировали на глаз, сохраняя рамку считывания домена ZF. Все равнозначные последовательности были транслированы и протестированы на кодирование нескольких доменов ZF в кадре.Последовательности Equid Prdm9 были представлены в Genbank (номера доступа {"type": "entrez-nucleotide-range", "attrs": {"text": "KC209783-KC209813", "start_term": "KC209783", "end_term) ":" KC209813 "," start_term_id ":" 426202511 "," end_term_id ":" 426202571 "}} KC209783-KC209813).

    Equid

    Prdm9 кДНК

    Тотальную РНК экстрагировали из семенников азиатского дикого осла (онагра) с использованием тризольного реагента. RT-PCR была настроена для отбора поли (A) РНК (мРНК) с олиго (dT) в соответствии с системой синтеза первой цепи с надстрочным индексом III (Invitrogen).Амплификацию целевой кДНК проводили с использованием специфических праймеров, которые также использовали для секвенирования: Prdm9 _E6F_cDNA 5 ′ AGCTAGAGATCCATCCATGTC и Prdm9 _I6R_cDNA 5 ′ GTCCTCTAGGGTGCTG. КДНК онагра секвенировали для подтверждения экспрессии Prdm9 в семенниках лошадиных и проверки последовательностей Prdm9 , полученных из геномной ДНК. Последовательности редактировали и выравнивали, как описано ранее.

    Prdm9 Идентификация ортолога и отображение символов

    Ортология последовательностей equid Prdm9 была первоначально проверена с помощью TBLASTn.Во всех случаях лучшие совпадения (e <10 −6 ) всегда соответствовали последовательностям Prdm9 из других видов (например, Mus , Homo , Peromyscus , Apodemus ) со средней идентичностью последовательностей выше, чем 75%. Известные паралоги Prdm9 , такие как Prdm7 , никогда не считались лучшими. Последовательности Prdm9 с наивысшим баллом из Genbank были взяты для взаимного лучшего BLAST против равных последовательностей для проверки предполагаемых ортологов.Чтобы проверить идентичность последовательностей, последовательности equid Prdm9 были обработаны против генома домашней лошади с использованием BLAT (браузер UCSC).

    Наличие / отсутствие доменов ZF было отображено на байесовском филогенетическом дереве семейства Equidae [35] с использованием MacClade 4.08 [36] для проверки закономерностей эволюции доменов ZF среди клонов лошадей. Предполагалось, что все символы неупорядочены и имеют одинаковый вес, а при расчетах учитывались только однозначные изменения.

    dN / dS Анализирует

    Из-за высокой степени согласованной эволюции, которая может происходить среди ZF-доменов, попарный анализ несинонимичного и синонимичного соотношения скоростей (dN / dS) последовательностей Prdm9 разных видов может вводить в заблуждение. [15].Учитывая это, положительный анализ отбора проводился только для доменов ZF, состоящих из 28 аминокислот с двумя остатками цистеина и двумя остатками гистидина. ZF домены сравнивали внутри и среди видов непарнокопытных. Кодоны выравнивали с помощью выравнивания белков ClustalW [37] (параметры по умолчанию). Филогенетические деревья из каждого выравнивания были построены с использованием максимальной экономии в PAUP * версии 4.0b10 [38] и PhyML 3.0 [39]. Топологии принимались, если не наблюдалось серьезных расхождений между методами и деревья поддерживались 1000 повторениями начальной загрузки (> 80%) [40].Программа codeml из PAML [41] использовалась для выявления значительных различий в значениях правдоподобия между почти нейтральными (модель 7) и позитивными моделями отбора с неограниченной омегой (модель 8) и омегой, ограниченной до 1.0 (8a). Пороговые значения P были скорректированы для нескольких тестов (поправка Бонферрони). Аминокислотные сайты при положительном отборе и P-значения были выведены с использованием подхода Bayes-Empirical-Bayes dN / dS в неограниченной модели 8.

    Результаты

    Equid

    Prdm9 Последовательности и положительный отбор

    Мы секвенировали последний экзон Prdm9, , который содержит домены ZF, у 14 непарнокопытных особей.Эти последовательности варьировались от 1074 до 1830 п.н. в зависимости от вида. При использовании против генома домашней лошади последовательности лошадей соответствовали неаннотированной области в хромосоме 3 (положение 6378542–36379363) со средней идентичностью 96%. В частности, совпадения, полученные из браузеров NCBI, UCSC и Ensembl, характеризовались наличием ранних стоп-кодонов после третьего домена ZF по сравнению с сгенерированной нами последовательностью домашней лошади (), которая показывала большее количество доменов ZF. Попытки последовательности UCSC и NCBI были идентичны частичной последовательности из Ensembl, аннотированной как Prdm7 , гену паралога Prdm9 , обнаруженному у других видов позвоночных.Этот результат предполагает, что у лошадиных может быть по крайней мере два гена Prdm , одна более короткая копия, аннотированная как Prdm7 , и вторая еще не аннотированная копия, соответствующая Prdm9 , которые различаются по последовательности и количеству доменов ZF.

    Выравнивание домашней лошадки Prdm9 ZF доменов.

    Последовательность, подтвержденная как Prdm9 у домашней лошади (жирный шрифт), была обработана против генома лошади с использованием браузеров NCBI, UCSC и Ensemble. Аминокислотная вариация последовательной домашней лошади выделена синими открытыми прямоугольниками.Линкеры между доменами ZF обозначены серыми столбиками, начало доменов ZF - пунктирными линиями, стоп-кодоны - звездочками, а остатки Cys 2 His 2 - красными буквами.

    В последовательностях equid Prdm9 мы идентифицировали 13 различных доменов ZF, характеризующихся изменением аминокислот в конкретных положениях -5, -2, -1, 3 и 6 (). Все виды показали конечный экзон Prdm9 , содержащий смесь доменов ZF, некоторые из которых появляются в видоспецифичных клонах. Например, домены ZF A, D, I и K были идентифицированы только у лошадей кабаллин, родословная которых состояла из домашней лошади и лошади Пржевальского ().У лошадей сильно варьировало количество доменов ZF: от пяти в тибетском кианге ( E. kiang ) до 14 доменов ZF в зебре Греви (). Внутривидовые вариации в количестве доменов ZF также наблюдались у таких видов, как лошадь Пржевальского, варьируя от 8 до 11, онагра от 7 до 8 и горная зебра от 6 до 7 доменов ZF. Гетерогенность между парами хромосом была обнаружена у африканского дикого осла, домашнего осла, онагра и горной зебры, различающихся одним или двумя доменами ZF, или до семи у зебры Берчелла.Более того, повторяющиеся домены ZF были распознаны у всех исследованных индивидуумов, что позволяет предположить, что Prdm9 , возможно, претерпел согласованную эволюцию у непарнокопытных; то есть некоторые домены ZF имеют идентичные последовательности, причем внутривидовые вариации меньше, чем между видами. В частности, зебра Греви показала наибольшее количество идентичных повторяющихся доменов с пятью копиями ZF-домена H и шестью копиями C в обеих хромосомах.

    Prdm9 доменов ZF, идентифицированных у видов непарнокопытных.

    Каждый домен ZF закодирован цветом / буквой, а аминокислотные вариации указаны в положениях -5, -2, -1, 3 и 6 (серые пустые прямоугольники). Домены ZF под пунктирными линиями - это те, которые идентифицированы только у гибридов лошадей, но не у видов непарнокопытных. Линкер из семи аминокислот обозначен серыми столбиками, а остатки Cys 2 His 2 красными буквами.

    Диплоидная структура доменов Prdm9 ZF у эквидов.

    Отображается количество и последовательность доменов ZF с указанием пола человека.Домены ZF с цветовой / буквенной кодировкой соответствуют доменам. Специфичные для клонов домены ZF картированы в филогенезе непарнокопытных согласно [33]. Домашние лошади демонстрировали ту же последовательность Prdm9 для последнего экзона, таким образом, изображена только одна последовательность. Последовательность onager Prdm9 , полученная из кДНК, обозначена звездочкой.

    Положительный отбор оценивался в доменах ZF каждого вида и вида вместе взятых. Значения –2 δ ln L между моделями M8 и M8a варьировались от 7.35 (P = 0,0258) у азиатского дикого осла до 15,05 (P = 0,0005) у горной зебры, что свидетельствует о наличии положительного отбора у всех видов независимо (P <0,05; Таблица S2). Подход Байеса-эмпирического-байесовского dN / dS выявил положительно выбранные сайты, соответствующие положениям аминокислот -5, -2, -1, 3 и 6 (). Анализ всех видов вместе взятых также обнаружил положительный отбор в доменах ZF после поправки на множественные сравнения (P <0,0063). Меньшее количество аминокислотных положений показало признак положительного отбора, соответствующий сайтам -1 и 6, со значениями dN / dS, превышающими нейтральную скорость, в 8 раз или более ().

    dN / dS оценки вариабельных аминокислотных участков всех непарнокопытных.

    доменов ZF всех видов вместе взятых были протестированы на положительный отбор, при этом значимые сайты отмечены двумя звездочками (P <0,01).

    Таблица 1

    Положительно выбранные аминокислотные сайты в доменах ZF у непарнокопытных на вид.

    E.caballus
    Аминокислотные центры
    Виды −5 −2 −1 3 6
    ** ** ** **
    Пржевальский Е. ** ** ** **
    E. asinus * * * **
    E.гемион * * * *
    Э. Кианг * ** ** **
    E. зебра * ** ** ** **
    E.бурчелли ** ** ** ** **
    Е. Гревый * ** ** ** **

    Prdm9 Вариация последовательности у гибридов лошадей

    Мы также секвенировали последний экзон Prdm9 семи гибридов лошадей.Сходные домены ZF были идентифицированы у гибридов относительно видов непарнокопытных. Некоторые последовательности не были обнаружены, в том числе ZF-домены E и J. Четыре домена были отмечены только у гибрида лошадь × домашняя лошадь Пржевальского и фертильного мула (). Все гибриды показали химерный состав и различное количество доменов ZF между парами хромосом. Prdm9 различается между гибридными хромосомами одним доменом у азиатского дикого осла (кулан) × тибетского кианга (5 и 6 ZF) и азиатского дикого осла (кулан) × африканского дикого осла (6 и 7), до трех доменов (8 и 6 ZF). 11) у гибридов зебра Греви × домашняя лошадь и лошадь Пржевальского × домашняя лошадь ().

    Prdm9 доменов ZF у гибридов лошадей.

    (A) Вариация последовательности и количество доменов ZF у гибридов с родительским вкладом, предполагаемым в соответствии с. (B) Сегрегация доменов ZF в родословной фертильного мула с указанием количества и последовательности доменов ZF для родителей (мула-самца и осла-производителя) и двух потомков. Открытые красные прямоугольники указывают на хромосому, полученную от матери, а синие прямоугольники - от производителя. Число диплоидных хромосом (2n) и пол указаны для всех особей в родословной.

    Репродуктивный статус исследованных гибридов лошадей неизвестен, за исключением одной фертильной самки мула, родословная которой была известна. Мы исследовали квартет, состоящий из фертильного мула (мать, 2n = 63), осла (отец, 2n = 62) и двух потомков F1 (самцы, 2n = 63). Мы использовали эту родословную информацию для оценки роли различий аллелей Prdm9 в гибридной стерильности непарнокопытных. Было обнаружено, что у обоих родителей одинаковое количество доменов ZF, причем одна хромосома содержит 10, а остальные восемь доменов ().Последовательности между парами хромосом были подобны у осла, но химерны у плотиного мула, показывая характеристики домашнего осла и лошади. Родительские хромосомы, содержащие 8 доменов ZF, отделены от мулов F1, в результате чего образуются две хромосомы с равным количеством доменов ZF. Мулы F1 демонстрировали химерный состав доменов ZF, наблюдаемый у самок, и вариации последовательности в аминокислотных сайтах -2, -1, 3 и 6. Эти результаты предполагают, что ни нечетное число хромосом (2n = 63), ни аллельные различия в числе ZF-доменов Prdm9 вызывает бесплодие у самки мула.

    Обсуждение

    Генетическая изменчивость и положительный отбор

    В этом исследовании мы сгенерировали частичные последовательности, проверенные как ортологи Prdm9 для 14 особей всех видов непарнокопытных и семи гибридов лошадей. Последовательности равных, расходящиеся с геномом лошади, лучше всего подходят таким образом, чтобы можно было предположить, что копии генов Prdm еще не аннотированы в геноме лошади. Дупликация генов Prdm не является чем-то необычным и была описана у других позвоночных, по крайней мере, у людей известно 17 членов семейства Prdm [42].У приматов Prdm7 является известным паралогом Prdm9 , который претерпел серьезные структурные перестройки, уменьшающие количество кодируемых цинковых пальцев и модифицирующие сплайсинг генов [43]. Отсутствие аннотированных генов Prdm в геноме лошади может быть результатом ограничений, связанных с текущими методами сборки генома при идентификации дублированных геномных областей или сателлитной ДНК [44].

    Prdm9 ZF доменов у непарнокопытных демонстрировали резкое изменение численного и аминокислотного состава.Эта высокая вариабельность расширяет находки у других организмов, демонстрируя быструю эволюцию этих доменов [14], [15]. Prdm9 Домены ZF предположительно быстро эволюционируют из-за нестабильности, происходящей из минисателлитной структуры массива ZF [16]. Кроме того, Оливер и др. [15] предположили, что Prdm9 может функционировать путем связывания с повторяющимися последовательностями ДНК, обнаруженными в перицентрических и центромерных областях, которые состоят из быстро развивающихся повторяющихся мотивов [45]. In vitro , PRDM9, как было показано, связывает ДНК в горячих точках рекомбинации через свои домены ZF, а генетические манипуляции с доменами ZF изменяют локализацию горячих точек [11], [18].

    Множественные исследования подтвердили, что Prdm9 ZF доменов подверглись сильному положительному отбору, хотя этот паттерн может не охватывать всех многоклеточных животных [14], [15]. У грызунов и приматов положительный отбор в определенных позициях связывания ДНК (-1, 3, 6) привел к дивергентной эволюции [15].У непарнокопытных положительный отбор ограничивался положениями аминокислот -1 и 6, которые соответствуют сайтам, ответственным за определение специфичности связывания ДНК Prdm9 . Структурные исследования показали, что аминокислоты внутри α-спирали ZF в положениях -1, 3 и 6 взаимодействуют с основаниями 3, 2 и 1 соответственно в первичной цепи ДНК [46]. Отбор, действующий на остатки -1 и 6 равных ZF-доменов, может изменять предпочтения связывания ДНК, кодируемые Prdm9 среди этих видов.

    Гибридная стерильность у лошадиных

    Аллельная несовместимость в гене Prdm9 , описанная у домовой мыши [9], [47], представляет собой вероятный генетический механизм, объясняющий гибридную стерильность у непарнокопытных. Однако у фертильной самки мула изменение количества доменов ZF, по-видимому, не приводит к аллельной несовместимости в пределах Prdm9 , а затем к бесплодию. Этот результат не является неожиданным, учитывая, что фертильность самок гибридных домовых мышей никогда не нарушается из-за аллельных различий Prdm9 , учитывая, что бесплодие обусловлено самцами (гетерогаметный пол) в соответствии с правилом Холдейна [9].

    На основании наших результатов нельзя сделать четкий вывод о роли Prdm9 в стерильности гибридов лошадей, за исключением того, что вариация Prdm9 доменов ZF сама по себе не способствует стерильности. Это предположение подтверждается единственным фертильным самцом непарнокопытных в этом исследовании, который также показывает вариации в количестве доменов ZF, домашняя осла. Prdm9 Ген все еще может быть важным геном видообразования у непарнокопытных из-за генетической несовместимости с другими локусами (эпистатические эффекты) [47].В частности, известно, что Prdm9 взаимодействует с хромосомой X (область DXSr62) у домашней мыши, и известно, что оба локуса необходимы для обеспечения стерильности F1 [48]. Незначительные QTL на хромосомах 13 и 14 также играют роль в стерильности гибридов, будучи достаточными для активации генетической несовместимости у гибридов мышей-самцов [48]. Гибридная стерильность у домашних мышей, по-видимому, имеет олигогенную природу, что указывает на важность учета генетических взаимодействий Prdm9 .

    Несомненно, Prdm9 не единственный ген, связанный с гибридной стерильностью у позвоночных, поскольку этот ген отсутствует у многих видов, таких как Xenopus , Anolis и Gallus . [12] или стал псевдогеном, что подтверждено на собаках [16].Тем не менее, наши открытия быстрой эволюции Prdm9 ZF доменов в дополнение к известной функции этого гена в определении горячих точек мейотической рекомбинации, подтверждают его важную роль в гаметогенезе у непарнокопытных. Дальнейшие исследования с рассмотрением дополнительных гибридов лошадиных и изучение генетических взаимодействий Prdm9 с другими локусами внесут вклад в прояснение роли этого гена в создании барьеров репродуктивной изоляции у этой группы млекопитающих, находящихся под угрозой исчезновения.

    Ссылки

    2.Muller H (1942) Изолирующие механизмы, эволюция и температура. В: Т Д, редактор. Биологические симпозиумы. Ланкастер, Пенсильвания: Jaques Cattell Press. С. 71–125.

    3. Койн Дж., Орр Х. (2004) Видообразование. Сандерленд, Массачусетс: Sinauer Associates, Inc. 545 стр.

    4. Пресгрейвс Д. (2010) Молекулярная эволюционная основа видообразования. Природа Обзоры Генетика 11: 175–180. [PubMed] [Google Scholar] 5. Джонсон Н.А. (2010) Гены гибридной несовместимости: остатки геномного поля битвы? Тенденции в генетике 26: 317–325.[PubMed] [Google Scholar] 6. Perez D, Wu C (1995) Дальнейшая характеристика локуса Odysseus гибридной стерильности у Drosophila: одного гена недостаточно. Генетика 140: 201–206. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Masly J, Jones C, Noor M, Locke J, Orr H (2006) Транспозиция гена как причина гибридной стерильности у Drosophila. Наука 313: 1448–1450. [PubMed] [Google Scholar] 8. Phadnis N, Orr H (2009) Один ген вызывает как мужскую стерильность, так и нарушение сегрегации у гибридов Drosophila.Наука 323: 376–379. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Mihola O, Trachtulec Z, Vlcek C, Schimenti JC, Forejt J (2009) Ген видообразования мыши кодирует мейотическую метилтрансферазу гистона h4. Наука 323: 373–375. [PubMed] [Google Scholar] 10. Hayashi K, Yoshida K, Yasuhisa M (2005) Метилтрансфераза гистона h4 контролирует эпигенетические события, необходимые для профазы мейоза. Природа 438: 374–378. [PubMed] [Google Scholar] 11. Gray C, Barthes P, Chauveau-Le Friec G, Langa F, Baudat F, et al.(2011) ДНК-связывающая специфичность мышиного PRDM9 определяет сайты триметилирования гистона h4 лизина 4 для инициации мейотической рекомбинации. PLoS Биология 9: e1001176. [Бесплатная статья PMC] [PubMed] [Google Scholar] 12. Ponting CP (2011) Каковы геномные движущие силы быстрой эволюции PRDM9? Тенденции в генетике 27: 165–171. [PubMed] [Google Scholar] 13. Hayashi K, Matsui Y (2006) Meisetz, новая гистон-триметилтрансфераза, регулирует мейоз-специфический эпигенез. Клеточный цикл 5: 615–620. [PubMed] [Google Scholar] 15.Оливер П.Л., Гудштадт Л., Байес Дж. Дж., Биртл З., Роуч К.С. и др. (2009) Ускоренная эволюция гена видообразования Prdm9 в различных таксонах многоклеточных животных. PLoS Genetics 5: e1000753. [Бесплатная статья PMC] [PubMed] [Google Scholar] 16. Муньос-Фуэнтес V, Ди Риенцо A, Вилла C (2011) Prdm9 , главный детерминант горячих точек мейотической рекомбинации, не действует у собак и их диких родственников, волков и койотов. PLoS один 6: e25498. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17.Майерс С., Боуден Р., Тумиан А., Бонтроп Р. Э., Фриман С. и др. (2009) Стремление против мотивов горячих точек у приматов предполагает участие гена PRDM9 в мейотической рекомбинации. Наука 327: 876–879. [Бесплатная статья PMC] [PubMed] [Google Scholar] 20. Берг И.Л., Нойман Р., Сарбайна С., Оденталь-Гессе Л., Батлер Н.Дж. и др. (2011) Варианты белка PRDM9 по-разному регулируют набор горячих точек мейотической рекомбинации человека, высокоактивных в африканских популяциях. Труды Национальной академии наук Соединенных Штатов Америки 108: 12378–12383.[Бесплатная статья PMC] [PubMed] [Google Scholar] 21. Segurel L, Leffler EM, Przeworski M (2011) Случай непостоянных пальцев: как белок цинкового пальца PRDM9 определяет горячие точки мейотической рекомбинации у людей. PLoS Биология 9: e1001211. [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Миямото Т., Ко Э., Сакугава Н., Сато Х., Хаяси Х. и др. (2008) Два однонуклеотидных полиморфизма в гене PRDM9 (MEISETZ) могут быть генетическим фактором риска для японских пациентов с азооспермией из-за ареста мейоза. Журнал вспомогательной репродукции и генетики 25: 553–557.[Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Chandley AC, Jones RC, Dott HM, Allen WR, Short RV (1974) Мейоз у межвидовых гибридов лошадей: самец мула и лошка. Цитогенетика и клеточная генетика 13: 330–341. [PubMed] [Google Scholar] 24. Хорие Т., Нисикава Ю. (1959) Исследования репродуктивной способности мулов II. О функциях яичек. Бюллетень Национального института сельскохозяйственных наук, серия G 8: 143–149. [Google Scholar] 25. Линдси Э., Опдайк Н., Джонсон Н. (1980) Расселение лошади Equus в плиоцене и расселение млекопитающих в позднем кайнозое.Природа 287: 135–138. [Google Scholar]

    26. Hulbert RJ (1996) Происхождение лошади. В: Olsen S, редактор. Лошади сквозь время. Боулдер, Колорадо: Робертс Ринчарт. С. 11–34.

    27. Allen WR, Short RV (1997) Межвидовая и внеспецифическая беременность у непарнокопытных: все идет. Журнал наследственности 88: 384–392. [PubMed] [Google Scholar] 28. Кордингли Дж. Э., Сундаресан С., Фишхофф И., Шапиро Б., Раски Дж. И др. (2009) Угрожает ли зебра Греви, находящаяся под угрозой исчезновения, гибридизация? Сохранение животных 12: 505–513.[Google Scholar] 29. Benirschke K, Low RJ, Sullivan MM, Carter RM (1964) Хромосомное исследование предполагаемого фертильного мула-кобылы. Журнал наследственности 55: 31-. [PubMed] 30. Short RV, Chandley AC, Jones RC, Allen WR (1974) Мейоз у межвидовых гибридов лошадей: гибрид лошади Пржевальского / домашней лошади. Цитогенетика и клеточная генетика 13: 465–478. [PubMed] [Google Scholar] 31. Райдер О.А., Хемнлк Л.Г., Боулинг А.Т., Бениршке К. (1985) Жеребенок самца мула считается потомком самки мула и ослицы.Журнал наследственности 76: 379–381. [PubMed] [Google Scholar] 32. Rong R, Chandley AC, Song J, McBeath S, Tan PP и др. (1988) Плодовитый мул и лошак в Китае. Цитогенетика и клеточная генетика 47: 134–139. [PubMed] [Google Scholar] 33. Генри М., Гастал Э.Л., Пинейро ЛЕЛ, Гимармес СЭФ (1995) Образец спаривания и анализ хромосом мула и ее потомства. Серия монографий по биологии репродукции 1: 273–279. [Google Scholar] 34. Драммонд А., Кирс М., Хелед Дж., Мойр Р., Тирер Т. и др. (2006) Geneious v1.2.1, Доступно: http://www.geneious.com/.35. Steiner C, Mitelberg A, Tursi R, Ryder O (2012) Молекулярная филогения современных непарнокопытных и эффекты предкового полиморфизма в разрешении филогении на уровне видов. Молекулярная филогенетика и эволюция 65: 573–581. [PubMed] [Google Scholar]

    36. Мэддисон Д., Мэддисон В. (2005) MacClade 4.08. Сандерленд, Массачусетс: Sinauer Associates, Inc.

    37. Томпсон Дж., Хиггинс Д., Гибсон Т. (1994) CLUSTAL W: повышение чувствительности последовательного последовательного выравнивания с помощью взвешивания последовательностей, штрафов за пропуски для конкретных позиций и выбора матрицы весов.Исследования нуклеиновых кислот 22: 4673–4680. [Бесплатная статья PMC] [PubMed] [Google Scholar]

    38. Swofford D (2002) PAUP *: Филогенетический анализ с использованием экономичности (и других методов) 4.0 Beta. Sinauer Associates, Inc: Сандерленд, Массачусетс.

    39. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W. и др. (2010) Новые алгоритмы и методы оценки филогении максимального правдоподобия: оценка производительности PhyML 3.0. Систематическая биология 59: 307–321. [PubMed] [Google Scholar] 40. Felsenstein J (1985) Пределы уверенности в филогении: подход, использующий бутстрап.Эволюция 39: 783–791. [PubMed] [Google Scholar] 41. Yang Z (1997) PAML: программный пакет для филогенетического анализа методом максимального правдоподобия. Компьютерные приложения в биологических науках 13: 555–556. [PubMed] [Google Scholar] 42. Fog C, Galli G, Lund A (2011) Белки PRDM: важные игроки в дифференциации и болезни. BioEssays 34: 50–60. [PubMed] [Google Scholar] 43. Фумасони И., Мани Н., Рамбальди Д., Скафетта Г., Алкалай М. и др. (2007) Расширение семьи и генные перестройки способствовали функциональной специализации генов PRDM у позвоночных.BMC Эволюционная биология 7: 187. [Бесплатная статья PMC] [PubMed] [Google Scholar] 45. Смит Г.П. (1976) Эволюция повторяющихся последовательностей ДНК путем неравного кроссовера. Наука 191: 528–535. [PubMed] [Google Scholar] 46. Choo Y, Klug A (1994) Выбор участков связывания ДНК для цинковых пальцев с использованием рационально рандомизированной ДНК выявляет закодированные взаимодействия. Труды Национальной академии наук Соединенных Штатов Америки 91: 11168–11172. [Бесплатная статья PMC] [PubMed] [Google Scholar] 47. Flachs P, Mihola O, Šimeček P, Gregorová S, Schimenti JC, et al.(2010) Интерактивная и межгенная несовместимость гена Prdm9 ( Hst1 ) при стерильности гибридов мышей. PLoS Genetics 8 (11): e1003044. [Бесплатная статья PMC] [PubMed] [Google Scholar] 48. Дзур-Гейдосова М., Симечек П., Грегорова С., Бхаттачарья Т., Фореджт Дж. (2012) Анализ генетической архитектуры гибридной стерильности F1 у домашних мышей. Эволюция 66: 3321–3335. [PubMed] [Google Scholar]

    тибетских мастифов | Лаборатория ветеринарной генетики

    Ключевые слова поиска

    Разновидность - любой

    Порода - Любой -AbyssinianAfghan HoundAfrican PygmyAfrican ShorthairAfricanisAfrikanerAidiAinu DogAiredale TerrierAkbash DogAkhal TekeAkita: Американский typeAkita: Смесь, OtherAkita: Японский typeAkita: UnregisteredAlaskan HuskyAlaskan Кли KaiAlaskan MalamuteAlaskan Sled DogAlpineAlpine DachsbrackeAlpine IbexAlpine LynxAlpine, MiniatureAMB / AMBORAmerican Bandogge MastiffAmerican голубой гасконец HoundAmerican BobtailAmerican BulldogAmerican BullyAmerican CurlAmerican DuallyAmerican Эскимо, Эскимо MiniatureAmerican , СтандартАмериканский эскимос, ТойАмериканский фоксхаундАмериканская морская свиньяАмериканский голый терьерАмериканский хайлендАмериканский лайнбекNubianAnglo-Francais де Moyen VenerieAnglo-Francais де Петит VenerieAngoraAngusAngus, LowlineAngus, MidlineAnkole-WatusiAppalachian SinglefootAppaloosaAppendixAppenzellerArabianArdennesAriegeoisArmantArriadorAryan MolossusAsian Leopard CatAsian ShorthairAubracAussiedoodleAustralian Браун GoatAustralian крупного рогатого скота DogAustralian CobberdogAustralian Внутренние DogAustralian KelpieAustralian LabradoodleAustralian Melaan Австралийский Миниатюрный GoatAustralian MistAustralian ShepherdAustralian Пастыря, MiniatureAustralian Stock HorseAustralian TerrierAustrian Black & Tan HoundAustrian PinscherAustrian Shorthaired PinscherAustrian Smoothhaired HoundAyrshireAyrshire CrossAzawakhAztecaAzulBabydoll SouthdownBaden-WurttembergBalancerBali Улица DogBalineseBambinoBarbados Blackbelly SheepBarbetBarockpintoBaroque PintoBasenjiBashkir CurlyBasque SheepdogBasset Артезианская NormandBasset Bleu де GascogneBasset фовизма де BretagneBasset HoundBavarianBavarian Mountain HoundBeagleBeagle HarrierBearded CollieBeaucero nBedlington TerrierBeefmasterBelgianBelgian BlueBelgian GriffonBelgian LaekenoisBelgian MalinoisBelgian MastiffBelgian SheepdogBelgian Спорт HorseBelgian TervurenBelgian WarmbloodBelted GallowayBengalBergamascoBerger де Пиренеи, Smooth MuzzledBerger дю LanguedocBerger PicardBerner LaufhundBerner NeiderlaufhundBernese гора Кизил BlackBichon FriseBiewerBiewer TerrierBiewer Йоркширский TerrierBiewer, BiroBig HornBillyBirmanBisonBlack & Tan CoonhoundBlack Forest HoundBlack HerefordBlack MaximizerBlack Рот CurBlack Русский TerrierBlack Welsh MtBlonde d'AquitaineBloodhoundBlue LacyBluetick CoonhoundBoerBologneseBombayBorder CollieBorder колли Приграничное LeicesterBorder TerrierBorzoiBosnian Roughhaired HoundBoston TerrierBourbonnaisBouvier Des ArdennesBouvier Des FlandresBoxerBoykin SpanielBracco ItalianoBrahmanBrandenburgBrangusBraque d'AuvergneBraque де l'AriègeBraque дю BourbonnaisBraque DupuyBraque Francais де Гранде TailleBraque Francais де Петит TailleBraque Сен-GermainBr aunviehBrazilian TerrierBretonBriardBriquet Griffon VendeenBristolBritish длинношерстная ShorthairBritish Спорт HorseBritish Пятнистый PonyBritish WhiteBrittanyBroholmerBrown SwissBrown Швейцарский CrossBruno Jura LaufhundBrussels GriffonBucking HorseBueLingoBull TerrierBulldogBullmastiffBurchell в ZebraBurmeseBurmillaCa Де BestierCaballo Депортиво ла SillaCairn TerrierCalifornia RedCalifornia SpangledCamarillo WhiteCanaan DogCanadian CurCanadian Eskimo DogCanadian HorseCanadian WarmbloodCanadienneCanadienne CrossCane CorsoCanis lupusCardigan Welsh CorgiCarolina DogCaspian HorseCatahoula Leopard DogCatalan SheepdogCaucasian OvcharkaCavalier Кинг Чарльз SpanielCB Romanesc КарпатинСреднеазиатская овчаркаCesky FousekCesky TerrierCeylonChantillyChapman's ZebraCharolaisCharolais CrossChart PolskiChartreuxChaussieCheetohChesapeake Bay RetrieverCheviotChianinaChianina CrossChien d'Artoisan BlahcienChien d'Artoisan BlahcienChien d'Artoisan BlahcienChien d'Artoisan BlahcienChien d'Artoisan Blahcien hinese CrestedChinese Foo DogChinookChortajChow ChowCimarron UruguayoCirneco dell'EtnaCleveland BayClumber SpanielClun ForestClydesdaleCob NormandCockapooCocker спаниель, AmericanCocker спаниель, Неизвестный VarietyColdblooded TrotterCollieColorado RangerColorpoint ShorthairColumbiaComtoisConnemara PonyContinental WarmbloodCook Остров Feral DogCoopworthCormoCornish RexCorridaleCorrienteCosta риканского Пасо-де-HorseCotentinCoton TulearCotswoldCoyoteCream DraftCriolloCroatian SheepdogCrossbredCurlyCurly покрытием RetrieverCymricCzech WolfdogCzechoslovakian VlcakDachshundDahomeyDales PonyDalmatianDandie динмонт TerrierDanish BroholmerDanish WarmbloodDanish / Swedish FarmdogDenmark FeistDeutsch Deutsch-DrahthaarDeutsch-DrahthaarDeutsche BrackeDeutscher WachtelhundDeutsches ReitponyDeutsches SportpferdДевон Рекс DreverDunkerDutch Belted CattleDutch Belted CrossDutch Harness HorseDutch MalinoisDutch Shepherd, LonghairedDutch овчарка, RoughhairedDutch овчарка, ShorthairedDutch SmoushondDutch WarmbloodEast Европейский ShepherdEast Сибирский LaikaEgyptian MauEnglish BulldogEnglish Кокер SpanielEnglish CoonhoundEnglish FoxhoundEnglish MastiffEnglish SetterEnglish ShepherdEnglish Springer SpanielEnglish Игрушка SpanielEnglish Игрушка TerrierEntlebucherEpagneul Bleu де PicardieEpagneul BretonEpagneul FrancaisEpagneul PicardEpagneul Pont-AudemerEstonian HoundEstrela Mountain DogEurasianEuropean BurmeseEuropean ShorthairExmoor PonyExotic LonghairExotic ShorthairExperimentalFalabellaFarm CollieFaux FriesianFell HoundFell PonyFell SheepdogField SpanielFila BrasileiroFinnFinnhorseFinnish HoundFinnish LapphundFinnish SpitzFire FriesianFlat покрытием RetrieverFleckviehFlorida CrackerFoldexFoxFox терьер, SmoothFox терьер, WireFrederiksborgFrench BulldogFrench Warmblood "Selle Francais" FriesianFriesian CrossFriesian Sp orthorseGalgo EspanolGallowayGasconGelbviehGeoffroy CatGeorgian GrandeGerman DrahthaarGerman Hunt TerrierGerman LonghairGerman длинноволосого PointerGerman PinscherGerman RexGerman езда PonyGerman SheeppoodleGerman ShepherdGerman короткошерстная PointerGerman Wirehaired PointerGerman WolfspitzGiant Немецкий SpitzGiant SchnauzerGirGlen из Imaal TerrierGloucestershire Старый SpotsGolden GuernseyGolden RetrieverGoldendoodleGordon SetterGotland PonyGr Ang-Fr Триколор HoundGr Ang-Fr W & B HoundGr Ang-Fr W & O HoundGrade LaManchaGrade SaanenGrand англо-FrancaisGrand Бассет гриффон VendeenGrand Bleu де GascogneGrand гасконец-SaintongeoisGrand Griffon VendeenGreat DaneGreat PyreneesGreater Swiss Mountain DogGreek HarehoundGreek SheepdogGreenland DogGrevy в ZebraGreyhoundGriffon Bleu De GascogneGriffon фовизма де BretagneGriffon NivernaisGuernseyGuernsey CrossGulf побережье NativeGypsianGypsy CobGypsy VannerHackney HorseHackney PonyHaflingerHaldenstovareHalf AndalusianHalf ArabianHalf-MarchadorHamiltonstovareHamp shireHanoverianHanoverian HoundHarlequin PinscherHarrierHartmann в ZebraHavana BrownHavana SilkHavaneseHawaiian Пои DogHeading DogHeck TarpanHerefordHertha PointerHessenHibridoHighland FoldHighland LynxHighland PonyHighland StraightHighlanderHimalayanHog IslandHolsteinHolstein CrossHolsteinerHorned DorsetHovawartHuntawayHygenhundIberian WarmbloodIbizan HoundIceland DogIceland PonyIcelandicIcelandicIcelandic HorseIdaho пастбищами PigIle де FranceImperial наследия HorseInca Голая DogInternational Спорт PonyInuit Sled DogInuit ездовая MixIrish DraughtIrish HunterIrish Red & White SetterIrish SetterIrish TerrierIrish воды SpanielIrish WolfhoundIslandsk FarehundIstrian Гончая, ГладкошерстнаяИстрийская гончая, ЖесткошерстнаяИтальянская борзая вот-финский LaikaKatahdinKayo InuKeeshondKentucky Mountain HorseKerryKerry BeagleKerry Синий TerrierKerry Bog PonyKerry CrossKhao ManeeKiangKiger MustangKikoKinderKing ShepherdKintamani DogsKishuKnabstrupperKomondorKooikerhondjeKoolieKoratKorean Немецкий ShepherdKraski OvcarKromfohrlanderKulanKunekuneKurilean бобтейл LonghairKurilean бобтейл ShorthairKuvaszKyi ЛЕОЛА ManchaLa Манча, MiniatureLa PermLabradoodleLabrador RetrieverLabxGoldenLaekenseLagotto RomagnoloLakeland TerrierLamaleseLancashire HeelerLandseerLapinporokoiraLapponian HerderLarge Черный HogLarge MunsterlanderLarge Испанский HoundLatvian HoundLatvian WarmbloodLeicester LongwoolLeonbergerLeopard CurLeopard HoundLevesqueLhasa ApsoLimousin LincolnLionLipizzanerLithuanian HoundLlewellin SetterLonghornLowchenLundehundLurcherLusitanoLuzerner LaufhundLuzerner NeiderlaufhundLykoiMagyar AgarМейн-кунMaine-AnjouMajestic Tree HoundМальтезеМанчестер терьерМанчестер терьер, тойМандалайМангаларгаMangalarga MarchadorMangalitsaManxMarchigia naMaremma SheepdogMaremma SheepdogMarkhorMarotaMastiffMatthes Lion HoundMcNabMeishanMexican Спорт HorseMi-KiMiddle Азиатского OwtcharkaMilking Девон CrossMilking ShorthornMilking Shorthorn CrossMini HerefordMini-Mid JerseysMiniature American ShepherdMiniature Bull TerrierMiniature GoldendoodleMiniature HighlandMiniature HorseMiniature JerseyMiniature PinscherMiniature Silky Обморок GoatMiniature ZebuMissouri Fox TrotterMohave BobMongolian Внутреннего HorseMontbeliardeMontdaleMontenegrin Mountain HoundMorabMorgan HorseMoriesianMoroccan BarbMoscow длинноволосой Игрушка TerrierMoscow WatchdogMountain CurMudiMuleMullins FeistMunchkinMurray GreyMustangMyotonicNambiNapoleonNational Показать ЛошадьИндейская Индийская СобакаТайский котНавахо-ЧурроНеаполитанский мастифNebelungNeva MasqueradeNew Forest PonyНовая гвинейская поющая собакаНьюфаундлендНьюфаундлендский пониНигерийский карликNokotaNorfolk TerrierNorikerNormandNormandeulingNorrbottensnerdetsNort American Sheriff hundNorwegian ElkhoundNorwegian Elkhound, BlackNorwegian Fjord HorseNorwegian лес CatNorwegian LundehundNorwegian NordlandNorwegian RedNorwegian Красный CrossNorwich TerrierNova Scotia Duck Толлинговая RetrieverNubianNubian IbexNubian, MiniatureNuwbyOberhasliOberhasli, MiniatureOcicatOjos AzulesOld Датский Bird DogOld Английский SheepdogOlde Английский BulldoggeOldenburgOnagerOriental LonghairOriental ShorthairOtherOtterhoundOuessantOwczarek PodhalanskiOxfordPaint HorsePallas в CatPapillonParson Рассел TerrierPaso FinoPatterdale TerrierPekingesePembroke Welsh CorgiPercheronPerdiguero де BurgosPerdiguero NavarroPerdiguero PortuguesoPerformance Horse Int» lPerro де пастор MallorquinPerro де преса CanarioPerro де преса MallorquinPersianPersian CrossPersian IbexPeruvian голая DogPeruvian Inca OrchidPeruvian PasoPeterbaldPetit Бассет гриффон VendeenPetit Bleu де GascognePetit BrabanconPetit гасконец-SaintongeoisPetit Griffon Bleu де GascognePhalenePharaoh HoundPiedmontesePintoPinzgauerPit BullPixie Бо bPlott HoundPodenco CanarioPodengo Portugueso GrandePodengo Portugueso MedioPodengo Portugueso Pequeno, SmoothPodengo Portugueso Pequeno, WirehairedPointerPoitevinPoitouPolish HoundPolish низменность SheepdogPolish Owczarek PodhalanskiPolish WarmbloodPoll HighlandPolled HerefordPolski Owczarek NizinnyPolypayPomeranianPomskyPony из AmericasPoodle, MiniaturePoodle, StandardPoodle, ToyPoongsan DogPorcelainePortuguese Крупный рогатый скот DogPortuguese PointerPortuguese SheepdogPortuguese воды DogPosavac HoundPrager RatterProvencePrzewalskiPudelpointerPugPuliPumiPura Раза EspañolaPygmyPygoraPyreneanPyrenean MastiffPyrenean ShepherdQuarter HorseRacking HorseRafeiro сделать АлентежуРагамаффинРэгдоллРамбуйеРэндалл ЛайнбекРэттерьерКрасно-белыйРыжий сеттерРыжий ангус ола CrossRomeldale / CVMRomneyRottweilerRumanian SheepdogRussell TerrierRussian BlueRussian Арлекин HoundRussian HoundRussian OrloffRussian самоед LaikaRussian SpanielRussian WarmbloodRussian WhiteRusskiy ToyRusso-Европейский LaikaSaanenSaanen, MiniatureSaarlooswolfhondSableSable, MiniatureSabuesos Espanol де MonteSabuesos Espanol LebreroSaddlebredSafariSaint BernardSaint Hubert Jura LaufhundSaint Использование SpanielSalersSaltilloSalukiSamoyedSan Клементе IslandSanshu DogSanta CruzSantal HoundSapsareeSarplaninacSavannaSavannah CatSaxon-Тюрингии ColdbloodSchapendoesSchillerstovareSchipperkeSchnauzer, MiniatureSchnauzer, StandardSchweizer LaufhundSchweizer NeiderlaufhundScottish BlackfaceШотландский коллиШотландский дирхаундШоттиш-фолдШотландский высокогорный пониШотландский страйтШотландский терьерСилихем терьерSegugio Italiano a Pelo ForteSegugio Italiano a Pelo Raso ogShiba InuShih TzuShikokuShiloh Shepherd DogShiloh Shepherd, ISSAShireShire CrossbredShorthornShropshireSiameseSiberian CatSiberian HuskySilken WindhoundSilky TerrierSillo ArgentinoSimbrahSimmentalSingapuraSingle-Footing HorseSkye TerrierSloughiSlovak CuvacSlovakian WH Указывая DogSmalandsstovareSmall немецкого SpitzSmall MunsterlanderSnowshoeSoaySoft Мелованного пшеничного TerrierSomaliSouth Африканского бурбуль MastiffSouth Немецкого ColdbloodSouth Русского OvcharkaSouth Россия Степной HoundSouthdownSpanishSpanish AlanoSpanish BarbSpanish Heritage HorseSpanish MastiffSpanish MustangSpanish воду DogSphynxSpinone ItalianoSporthorseSporting Lucas TerrierSpotted Седло Лошадь-спрингер-спаниельШри-ланкийская собакаSt.CroixStabyhounStaffordshire Bull TerrierStandard Немецкий SpitzStandardbredStephens StockStichelhaarStrellufstoverStumpy хвост крупного рогатого скота DogStyrian Roughhaired Горный HoundSudanese DogSuffolkSuffolk PunchSuiz BuSuphalakSussex SpanielSwedish ElkhoundSwedish LapphundSwedish VallhundSwedish WarmbloodTahltan Медведь DogTaiganTamaskanTargheeTarpanTasyTeddy Рузвельт TerrierTelomianTengger DogTennessee RexTennessee Walking HorseTenterfield TerrierTexelThaiThai BurmeseThai RidgebackThailand PonyThornburg FeistThoroughbredTibetan MastiffTibetan SpanielTibetan TerrierTiffanyToggenburgTonkineseTosa InuTosa KenToy Fox TerrierToy Немецкий SpitzToybobToygerTrakehnerTranscaspian UrialTransylvanian гончая, LongTransylvanian гончая, ShortTreeing FeistTreeing Tennessee BrindleTreeing Walker CoonhoundTrocha y GalopeTrote y GalopeTunisTurbo FriesianТурецкая ангораТурецкая одичавшая собакаТурецкая борзаяТурецкий ванТирольская гончая Volpino ItalianoWagyuWalker CoonhoundWarlanderWeimaranerWelsh HoundWelsh PonyWelsh PonyWelsh SheepdogWelsh Springer SpanielWelsh TerrierWeser Эмс PoniesWest хайленд уайт TerrierWest сибирская LaikaWestfalenWestphalian DachsbrackeWetterhounWhippetWhippet, LonghairedWhippet, длинноволосого CrossWhite ParkWhite ShepherdWild HorseWiltshire HornWirehaired Указывая GriffonWirehaired VizslaWolfWolf HybridWorking DogX-Bred CoonhoundXoloitzcuintliXoloitzcuintli, ToyYork ChocolateYorkshire TerrierZangersheide

    Тип теста - Любой - Цвет шерсти и / или Тип Здоровье / Производительность Признак Родительство / Генетический маркер Другое

    .

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *