Лимфадениты: причины, симптомы, лечение и профилактика

Содержание

Блог

Вопрос, который всегда стоит перед стоматологом: что делать с зубом, сохранять или удалять? Доктора клиники «Эстедент» работают по единым согласованным стандартам: у нас четко прописано, какой зуб можно сохранить, а какой нужно удалять.

Показания для удаления зубов

1. Хронический периодонтит в стадии обострения, когда без удаления нельзя ликвидировать воспалительный очаг у верхушки зуба. Непроходимость корневых каналов, выраженная подвижность зубов III и IV степени, гнойное воспаление в периодонте.

2. Острая стадия одонтогенного остеомиелита (как неотложная ситуация), одонтогенные гнойные периоститы, флегмоны, околочелюстные абсцессы, гнойные лимфадениты, гаймориты в острой стадии, гнойные лимфадениты, синуситы верхнечелюстных пазух.

3. Удаляют корни зубов, если их нельзя использовать при протезировании, поскольку они могут рассматриваться как хронический очаг одонтогенной инфекции.

4. Образование кист и гранулем на корнях зубов при осложнении кариозного процесса.

5. Удаляют зубы, атипично расположенные и сверхкомплектные, значительно выдвинутые из лунки с обнажением корней, а также зубы, сильно разрушенные, которые нельзя использовать в качестве опоры при протезировании.

6. Удаляют зубы, постоянно вызывающие травму языка и слизистой полости рта (если это нельзя устранить механическим подтачиванием).

7. При ортодонтическом лечении неправильного прикуса в целях освобождения места для перемещения зубов.

8. Безуспешность лечения многокорневого зуба, осложненного острым воспалением периодонта.

9. Зубы, находящиеся в области перелома челюсти или альвеолярного отростка, которые являются проводниками инфекции и препятствуют репозиции обломков.

10. У детей удаляют молочные зубы, разрушенные при периодически обостряющемся воспалительном процессе (молочный зуб, который вызывает обострение при его герметическом закрытии; зубы у ребенка, родившегося с зубами). Все показания к удалению зуба, когда имеются нарастания симптомов воспаления в периодонте и костях, являются абсолютными, остальные – относительными.

Противопоказания к удалению зубов

1. Сердечно-сосудистые заболевания в период обострения. Хроническая сердечная недостаточность с частыми приступами стенокардии и сердечной астмы. Первые дни после инфаркта миокарда, а также последующие дни с повторяющимися приступами стенокардии. Хроническая аневризма желудочка сердца. Подострый септический эндокардит с наклонностью к тромбоэмболиям.

2. Острые респираторные вирусные заболевания, грипп, острые инфекционные заболевания другой этиологии.

3. Злокачественные опухоли, гемангиомы.

4. Стоматиты, язвенные поражения слизистой полости рта.

5. Органические или функциональные поражения центральной нервной системы (эпилепсия, психозы, истерия и т.п.).

6. Перед менструацией, во время и через 2-3 дня после менструации. На 1-2 и 8-9 месяцах беременности.

7. Не удаляют молочные зубы у взрослых людей, если на рентгенограмме нет смены их постоянными.

8. Особая подготовка к удалению зубов необходима больным гемофилией. Накануне операции и за 1-1,5 часа перед операцией необходимо переливание гемофильной плазмы, а также ежедневно проводить контроль за свертываемостью крови.

9. Острая почечная недостаточность, острый инфекционный гепатит, острый лейкоз, гемморагические диатезы, острые нарушения кровообращения, обморок, коллапс, шок, гипертонический криз.

О чем вы еще должны знать?

Очень важно понимать, что за удалением зуба должны последовать реставрационные мероприятия: протезирование, имплантация. Помните, что, не получая нагрузки, костная ткань под удаленным зубом начнет страдать от недостатка питания и будет разрушаться, соседние зубы станут подвижными, зуб на противоположной челюсти (зуб-антагонист) также не сможет нормально функционировать без своего «собрата». Только из-за одного отсутствующего зуба человек может потерять три соседних — один сверху и два по бокам. Именно поэтому полное восстановление жевательных функций, реставрация всего зубного ряда очень важны. На приеме врач-стоматолог оценит клиническую ситуацию и даст свое видение и прогноз ее течения. Совместно с пациентом будет принято оптимальное решение.

лечение и профилактика в Краснодаре

Вы можете получить бесплатную консультацию по телефонам: +7 (918) 417-95-99 Или заполните форму и с вами свяжется наш специалист.

От лимфаденитов спасет фитотерапия и не только

Медицинский центр «Травы Кавказа» специализируется на помощи пациентам в избавлении от любой патологии фитотерапией. Однако это далеко не единственный метод лечения, специалисты используют комплексный подход к устранению симптоматики лимфаденита или бронхиальной астмы, общему укреплению и восстановлению организма. Заметили шарообразные уплотнения на шее, за ушами или в паху? Они болят, а кожа покрылась сыпью? Немедленно обратитесь за помощью, возможно у вас лимфаденит, несущий массу проблем при некачественной терапии.

Симптоматика и опасность лимфаденита

Клиника «Травы Кавказа» работает для вас ежедневно. Записаться на прием к специалистам, пройти обследование можно в любое удобное для вас время. Получить консультацию возможно по телефону или прямо на сайте, заполнив специальную форму. Мы обязательно свяжемся с вами и предоставим полезную информацию.

Лимфаденитом называют воспалительный процесс, развивающийся в лимфатических узлах. Поскольку главная функция системы, в которую входят эти узлы – транспортировка клеток иммунной системы, отклонение от нормы приводит к неприятностям.

Причины патологии бывают инфекционного и неинфекционного характера, обычно воспаление происходит в области поражения какого-либо органа. К примеру, при заболеваниях ЛОР-органов, воспаляется рядом расположенные узлы.

Различают формы патологии – острую и хроническую. Острый лимфаденит развивается за три стадии: отек – увеличение и накопление экссудата – нагноение образование гнойника. При хроническом недуге симптоматика смазанная.

Общая симптоматика болезни такова:

  • Увеличение узла, покраснение кожи;
  • Болезненные ощущения в области увеличения;
  • Повышение температуры.

При развитии появляется слабость, гипертермия более значительная, вплоть до лихорадки. Также возможны головные боли и потеря аппетита, общая слабость.

Если вовремя не начать лечение, особенно на стадии нагноения, гной может попасть в окружающие ткани, чем вызвать интоксикацию организма или распространение гнойников на большую площадь.

Осложнения лимфаденита достаточно опасны:

  • Тромбофлебит;
  • Лимфатические свищи;
  • Сепсис;
  • Воспаление клетчатки.

При хронической форме происходит постепенное замещение лимфоидной ткани на соединительную, чем нарушается циркуляция лимфы. Последствием хронического лимфаденита становится так называемая слоновость, лимфостаз, при которых появляется отечность, конечности (другие части тела) увеличиваются в размерах в несколько раз, на кожном покрове появляются сыпь, язвочки.

Как правильно лечить?

Команда врачей «Травы Кавказа» работает сплоченно, сначала собирают полный анамнез состояния здоровья пациента, с помощью высокоточного диагностического оборудования. Затем составляют индивидуальную программу лечения. Курс терапии составлен таким образом, чтобы организм полностью восстановился, а сопутствующие заболевания самоустранились.

Мы предлагаем для лечения:

  • Фитотерапию. Основной метод лечения, избавляющий от таких неприятностей, как привыкание к медикаментам, побочные реакции, аллергия или непереносимость компонентов. Травяной сбор составляют в зависимости от индивидуальных особенностей организма, исключая вероятность смежных проблем. Минимальные дозы воздействия и полная безопасность средств позволяет применять их в профилактических целях, а воздействие на все внутренние системы организма лечить сразу несколько заболеваний.
  • Психотерапию. Психолог мягко, но уверенно скорректирует эмоциональный настрой пациента, избавит от возможных волнений или недоверия к врачам.
  • Гидроколоноскопия. Очистка кишечника – основной метод восстановления иммунитета. Удаление вредоносных веществ и микроорганизмов приведет к устранению проблем с желудком, пациент забудет о бессоннице.
  • Разработку индивидуальной диеты. Правильно подобранные продукты способствуют эффективности фитотерапии и других методик, избавляя организм от воспаления, и наполняя полезными веществами.
  • Массаж. Массаж поможет при осложнениях лимфаденита, когда произошло уже замещение тканей и появилась сильная отечность.

Для того чтобы не отрываться от всестороннего лечения, для пациентов предусмотрены комфортабельные номера, есть вариант проживать вместе с членами семьи или отдельно.

Доверьте здоровье профессионалам! Дополнительную информацию можно узнать по телефону или непосредственно на приеме у врача.

 

71. Лимфадениты: классификация и патоморфологические изменения.

Лимфаденит— воспаление лимфатического узла.

Этиология и патогенез. Воспаление вызывают возбудители многий острых и хронических инфекционных болезней. Проникая лимфогенным или гематогенным путем, в лимфатическом узле развивается защитная воспалительная реакция, которая характеризуется альтерацией, гиперемией сосудов микроциркуляторного русла, экссудацией, фагоцитозом, пролиферацией Т – и В-лимфоцитов с последующей их трансформацией в клетки-эффекторы (плазмоциты, лимфоциты-киллеры и др.).

Патологоанатомические изменения.Различают альтеративное, экссудативное и продуктивное воспаление, а по течению — острое и хроническое.

Альтеративный лимфаденитсопровождаетсянекрозами паренхимы, в то время как экссудативные и: продуктивные процессы выражены относительно слабо. Примером может служить казеозный лимфаденит при первичном туберкулезе у телят. Поражаются чаще бронхиальные, средостенные и брыжеечные лимфоузлы. Они сильно увеличены, плотные, на разрезе видны серо-белые очаги казеозного некроза, между которыми располагаются островки и полоски живой ткани серовато-красного цвета. При гистоисследовании выявляют казеозный некроз лимфоидной ткани, серозный отек вокруг него, пролиферацию лимфоцитов, эпителиоидных и гигантских: клеток в живой ткани.

Среди экссудативных лимфаденитов доминируют серозные, геморрагические и гнойные воспаления лимфатических узлов.

Серозный лимфаденитхарактеризуется увеличением узла, поверхность разреза его покрасневшая, сочная, с нее стекает мутная жидкость, рисунок фолликулов усилен. Под микроскопом отмечают гиперемию, серозный отек синусов и паренхимы, увеличение в размере фолликулов,, накопление в корковом и мозговом веществе плазмоцитов,. макрофагов, лимфоцитов. Встречается при пастереллезе, колибактериозе и других инфекционных болезнях.

При геморрагическом лимфаденитеорган увеличен, окрашен в красный цвет, поверхность разреза влажная, блестящая. Гистоисследованием наблюдают геморрагическую инфильтрацию синусов, коркового и мозгового вещества, микронекрозы и опустошение лимфоидной ткани. Встречается при сибирской язве, чуме, пастереллезе.

Гнойный лимфаденитвызывается гноеродными бактериями. В узле заметны разной величины абсцессы с гноем. При остром течении они окружены красной каймой,, при хроническом — соединительнотканной капсулой. Если воспаляются подкожные лимфоузлы, то развиваются свищи. Гистологически отмечают гнойный экссудат, пиогенную зону или соединительнотканную капсулу вокруг абсцесса.

Продуктивный лимфаденит.Лимфоузлы увеличены, плотные, серо-белого цвета, суховатые или слегка сочные, рисунок фолликулов стерт. Под микроскопом очаговые (гранулемы) или диффузные размножения лимфодитов, плазмоцитов, эпителиоидных и гигантских клеток. Возможны очаговые некрозы. Встречается при сальмонеллезе телят в брыжеечных лимфоузлах (мозговидное набухание, гиперпластическое воспаление), при туберкулезе, паратуберкулезе и других болезнях.

Фиброзный лимфаденитхронич., исход экссудативных, альтеративпых и продуктивных форм лимфаденитов. Узлы плотные, бугристые, серо-белого цвета, на разрезе видны разросты соединительной ткани. При гистоисследовании – разраст-е волокнист. соединит.ткани, склероз и гиалиноз стромы и стенки сосудов, атрофию лимфоид.ткани.

Казеозный лимфаденит

Казеозный лимфаденит — это контагиозное заболевание, которое быстро распространяется по стаду и без надлежащих мер борьбы приводит к гибели животных, загрязнению возбудителем окружающей среды и последующему инфицированию новых животных. Поэтому наилучший способ предупредить заболевание – заботиться о чистоте стада. А если было выявлено инфицированное животное, необходимо как можно скорее изъять его из стада, чтобы не допустить вскрытия абсцессов и распространения заболевания.

Заболевание поражает чаще всего овец и коз, и вызывается бактерией Corynebacterium pseudotuberculosis. Случаи заболевания регистрируются по всему миру. Казеозный лимфаденит приносит значительный экономический ущерб козоводческой и овцеводческой отраслям, вызывая снижение массы тела, падение удоев и оплодотворяемости у восприимчивых животных, также становясь причиной их выбраковки. Заболеваемость увеличивается с возрастом и может достигать в стаде 60-70%. Описаны случаи заражения человека.

Начальная стадия болезни

Возбудитель представляет собой грампозитивную неподвижную палочку овоидной формы, не образующую спор. Выделяют два основных биотипа в зависимости от их способности превращать нитраты: нитрат-негативные, инфицирующие в основном овец и коз, и нитрат-позитивные, инфицирующие лошадей. Комбинация этих биотипов вызывает заболевание у крупного рогатого скота.

Заражение происходит через поврежденную кожу и слизистые оболочки. Источником возбудителя являются больные животные, выделяющие бактерии во внешнюю среду с содержимым вскрывшихся абсцессов, истечениями из носа, молоком, фекалиями. Возбудитель может долгое время сохранять свою жизнеспособность в окружающей среде: в навозе, сене, подстилке, воде; имеет стойкость к высыханию. Микроорганизм чувствителен к повышению температуры, поэтому на поверхностях объектов его жизнеспособность уменьшается с повышением температуры окружающей среды.

Содержание абсцесса на разрезе при висцеральной форме

Существует две формы течения болезни: наружная – лимфаденитная (т.н. «нарывы»), и внутренняя – висцеральная. При наружной форме наиболее часто поражаются подчелюстные, околоушные, предлопаточные, надвыменные лимфоузлы и лимфоузлы коленной складки. Реже могут вовлекаться внутренние лимфоузлы грудной и брюшной полостей. Внешне лимфаденитная форма характеризуется появлением безболезненных бугорков (абсцессов) в местах локализации регионарных лимфоузлов и распространяется по ходу лимфатических сосудов. Содержимое абсцессов у коз представляет собой мягкую пастообразную массу бело-зеленоватого цвета без запаха. У овец зачастую это плотная творожистая масса.

Висцеральная форма чаще встречается у овец и была названа «синдром худой овцы» (англ. “thin ewe syndrome”). Очаги поражения локализируются в легких, сердце, почках, реже в печени, спинном и головном мозге. Клинические признаки зависят от пораженного органа и могут проявляться в виде кашля, учащенного дыхания, хронического истощения, неврологических симптомов. Клинические признаки зависят от пораженного органа и могут проявляться в виде кашля, ускоренного дыхания, хронического истощения, неврологических симптомов. В некоторых случаях может наблюдаться спонтанный падеж животных без каких-либо предшествующих признаков.

Симптомы казеозного лимфаденита также могут отсутствовать, т.к. часто заболевание протекает латентно. 

Прогрессирование болезней

Диагноз ставится на основании эпизоотической ситуации, клинических признаков, лабораторных и патологоанатомических исследований. Следует учитывать, что появление абсцессов может быть вызвано и другими гноеродными бактериями, такими как Staphylococcus aureus, Pasteurella multocida, или анаэробными бактериями Fusobacterium necrophorum, поэтому животные с признаками нарывов должны быть изолированы до получения результатов бактериологического исследования. При висцеральной форме необходимо исключить такие причины хронического истощения как паразиты, неполноценное питание, проблемы с зубами и т.п.

Для исследования в лабораторию направляют: прижизненно — сыворотки крови, стерильно взятое содержимое из невскрывшихся абсцессов, посмертно — инкапсулированные абсцессы из внутренних органов и лимфоузлов. 

Лечение не разработано. В промышленном животноводстве больных животных выбраковывают, туши утилизируют. В случае, если животное представляет эмоциональную или генетическую ценность, его изолируют и проводят системную и местную антибиотикотерапию с целью снижения его степени инфицированности (заразности) для остального стада.  Но необходимо понимать, что заболевание определяется как неизлечимое. Инкапсулированные абсцессы удаляют хирургически, вскрывшиеся – очищают от содержимого, которое затем обеззараживают; образовавшуюся полость промывают раствором йода.

Основные места локализации абсцессов

В качестве профилактики не следует приобретать животных в хозяйствах с непроверенным инфекционным статусом; помещать вновь прибывших животных на 30-дневный карантин. Кроме того, необходимо проводить регулярный серологический мониторинг животных хозяйства и регулярную дезинфекцию животноводческих помещений, инвентаря и средств ухода за животными, регулярно менять подстилку; убрать из животноводческих помещений и пастбищ острые ранящие предметы, которые могут нанести животным травму.

Автор: Анастасия Тимкович, врач вет. медицины, ООО «СмартБиоЛаб»​
Соавтор: Виктория Кучерявенко, директор ООО «Смартбиолаб», канд. вет. наук​
Опубликовано: журнал Farmer №2 февраль 2018

Бактериальный лимфаденит в крупной специализированной больнице во Франции с 2008 по 2012 год

Резюме

Увеличение лимфатических узлов — распространенная медицинская проблема, и у большого числа пациентов причины лимфаденопатии остаются невыявленными. Мы сообщаем о тщательном микробиологическом анализе 1688 образцов биопсии лимфатических узлов, собранных в нашем справочном центре по бартонеллезу. Мы изучили образцы биопсии лимфатических узлов от пациентов с подозрением на региональное инфекционное увеличение лимфатических узлов с января 2008 года по декабрь 2012 года.Чтобы оценить полезную стратегию диагностики инфекционного лимфаденита, образцы культивировали и подвергали молекулярным исследованиям. По возможности проводился гистологический анализ. В общей сложности 642 (38%) образца биопсии были инфицированы бактериальным агентом, и количественная ПЦР (кПЦР) была значительно лучше, чем ПЦР гена 16S рРНК ( rrs ) для обнаружения Bartonella henselae ( P = 0,05). ), Mycobacterium tuberculosis ( P = 0,05) и Mycobacterium avium ( P = 0.007). Молекулярные анализы были значительно лучше, чем бактериальные культуры для диагностики Francisella tularensis ( P = 0,017), но были менее эффективны для обнаружения M. tuberculosis ( P = 0,004) и M. avium ( P). = 0,001). Гистологический анализ был проведен для 412 лимфатических узлов, 20% из которых были совместимы с инфекционным лимфаденитом, тогда как новообразования были обнаружены в 29% этих лимфатических узлов. M. tuberculosis значительно чаще выявлялся у женщин, чем у мужчин ( P = 0.01), а пациенты с болезнью кошачьих царапин (CSD) были моложе пациентов с M. tuberculosis , Tropheryma whipplei и F. tularensis . Отрицательный rrs ПЦР не исключает диагноз инфекционный лимфаденит. Гистологический анализ биоптатов лимфатических узлов имеет решающее значение, поскольку диагноз инфекционного лимфаденита не исключает других сопутствующих заболеваний.

ВВЕДЕНИЕ

Увеличенные лимфатические узлы — частый симптом ряда инфекционных, аутоиммунных и злокачественных заболеваний (1).Клинические симптомы часто схожи или неспецифичны, и несколько этиологических агентов могут быть ответственны за увеличение лимфатических узлов (1). Разнообразные бактериальные, вирусные, грибковые и протозойные агенты могут служить в качестве координационного центра для последующего клинического исследования (2). Bartonella henselae , основной возбудитель болезни кошачьих царапин (CSD), является наиболее распространенным микроорганизмом, ответственным за инфекционную лимфаденопатию у взрослых и детей (2, 3). CSD — сезонное заболевание (4), и живут B.henselae был недавно обнаружен в местах первичной инокуляции пациентов после кошачьей царапины (5). Микобактерии обычно вызывают лимфаденопатию, а на периферический туберкулезный лимфаденит приходится примерно 10% случаев туберкулеза в США (6). Заболеваемость лимфаденитом, вызванным нетуберкулезными микобактериями, в последние десятилетия увеличилась, в первую очередь у детей (7). Staphylococcus aureus и Streptococcus pyogenes являются причиной примерно от 40 до 80% случаев острого одностороннего шейного лимфаденита у детей (8).Менее распространенными источниками инфекционной лимфаденопатии являются Francisella tularensis , возбудитель туляремии, и Tropheryma whipplei , возбудитель болезни Уиппла (2, 3).

Образцы эксцизионной биопсии обычно выполняются для получения материала лимфатических узлов для соответствующих лабораторных исследований и гистологического исследования, и такие образцы биопсии обычно требуются для окончательного диагноза (9). Посевы обычно заказываются на биоптатах лимфатических узлов, но у этого метода есть общепризнанные ограничения.Более того, некоторые этиологические агенты нелегко выделить с помощью обычных методов и требуют специализированных систем культивирования клеток. Недавно мы предложили молекулярную стратегию, основанную на количественной ПЦР в реальном времени (КПЦР) для обнаружения наиболее часто встречающихся возбудителей инфекционной лимфаденопатии (3). Этот анализ кПЦР значительно более чувствителен, чем ПЦР-амплификация и секвенирование гена 16S рРНК, для обнаружения B. henselae , F. tularensis и микобактерий (3).ПЦР гена 16S рРНК по-прежнему важна для обнаружения других новых или появляющихся бактериальных агентов (10). В этом исследовании мы проанализировали большую коллекцию лимфатических узлов с помощью молекулярных методов и бактериальных культур. Наша цель состояла в том, чтобы оценить полезную стратегию диагностики инфекционного лимфаденита.

МАТЕРИАЛЫ И МЕТОДЫ

Образцы.

Мы изучили образцы биопсии лимфатических узлов пациентов с подозрением на региональное инфекционное увеличение лимфатических узлов, которые были отправлены в нашу лабораторию с января 2008 года по декабрь 2012 года.Как национальный справочный центр по риккетсиозу и бартонеллезу, мы регулярно получаем образцы биопсии лимфатических узлов от пациентов с подозрением на CSD по всей Франции. Кроме того, мы получаем образцы биопсии лимфатических узлов от госпитализированных пациентов и амбулаторных пациентов с подозрением на регионарный инфекционный лимфаденит нашей больницы. Получили фрагмент или весь лимфатический узел. Образцы были отправлены в нашу лабораторию в стерильных условиях, замороженных (-20 ° C) или на сухом льду (-80 ° C). В нашей лаборатории все образцы обрабатывались в стерильных условиях при -20 ° C, чтобы избежать перекрестного загрязнения, и были проанализированы в течение 12 часов после получения.Лимфатические узлы, зафиксированные в формалине, также были взяты для гистологического анализа у некоторых пациентов. Обычно для каждого лимфатического узла получали стандартизированный опросник с указанием пола и возраста пациентов и предполагаемой инфекции.

Стратегия.

Качество экстракции ДНК из образцов было подтверждено геном домашнего хозяйства, кодирующим бета-актин (11). Все образцы были протестированы методом количественной ПЦР на наличие видов F. tularensis , T. whipplei и Coxiella burnetii на уровне видов и видов Bartonella и микобактерий на уровне рода.Второй анализ количественной ПЦР для характеристики видового уровня использовался в случаях положительных результатов для Bartonella sp. или микобактерии. Независимо, все лимфатические узлы были проверены на наличие бактерий с помощью ПЦР-амплификации и секвенирования, нацеленного на ген 16S рРНК ( rrs ). Лимфатические узлы культивировали по эпидемиологическим причинам при подозрении на F. tularensis или T. whipplei на основании клинических проявлений у пациента или при положительных результатах молекулярных анализов на эти агенты.Точно так же из-за очень низкой скорости изоляции, опубликованной ранее, лимфатические узлы, инфицированные видов Bartonella , не культивировались систематически (2, 12). Лимфатические узлы обычно культивировали при подозрении на микобактерии или при положительных результатах молекулярных анализов. Более того, лимфатические узлы культивировали в случае отрицательных молекулярных анализов и некачественной экстракции ДНК. Пациенты классифицировались как имеющие определенно инфицированный лимфатический узел, если имелись прямые доказательства инфекции с использованием культуральных или молекулярных анализов или когда специфический агент был обнаружен с помощью гистопатологии.

Молекулярные анализы.

Полную геномную ДНК экстрагировали из образцов с использованием набора тканей QIAamp (Qiagen, Hilden, Германия). Образцы обрабатывались в стерильных условиях, чтобы избежать перекрестного загрязнения. Геномную ДНК хранили при 4 ° C и использовали в качестве матрицы в анализах qPCR. Для обнаружения видов Bartonella мы использовали праймеры и зонды, нацеленные на межгенную область (ITS) 16S-23S РНК, для B. henselae мы использовали праймеры и зонды, нацеленные на ген pap31 , а для F.tularensis , мы использовали праймеры и зонды, нацеленные на ген yqaB , как описано ранее (3). Для лимфатических узлов, положительных только на уровне рода на Bartonella (ITS-положительный; pap31 отрицательный), образцы были протестированы с помощью кПЦР на Bartonella quintana и Bartonella alsatica , как описано ранее (13).

ТАБЛИЦА 1

9013 9013 9013 9013 9013 9013 9013 90CATG13 9013 90CATG13 90CC7 37 Barto ITS3 P papХенсели РАР 396R pap31 Это исследование yopP tularensis IS30a 3R GGATC7 0138
Название праймера или зонда Gene Target Sequence Amplicon (no.базисов) Ссылка или источник
КПЦР
Actine_F CATGTC7 CATG13 Actine_R человеческих бета-актин CCGTGGCCATCTCTTGCTCG 11
Actine_P человеческих бета-актин FAM-CGGGAAATCGTGCGTGACATTAAG 11
Барто ITS3 F 16S-23S рРНК Bartonella GATGCCGGGGAAGGTTTTC 104 Настоящее исследование
Barto ITS3 R 16S-23S rRNA 16S-23S rRNA BGAC3 16S-23S рРНК Bartonella FAM-GCGCGCGCTTGATAAGCGTG Это исследование
PAP 246F 9138 TATGCCTTATGTTGCTGGTGGT 151 Данное исследование
В. Хенсели ACCACCGCCAAGAGTGAAAC
PAP246 / 396_MBP pap31 B. henselae FAM-CAAGCAGCAGATGATGCAGAAATCGC Это исследование
B qui 11580F лет назад B.Кинтана TAAACCTCGGGGGAAGCAGA 134 13
Б квинкиес 11580R В. Кинтана TTTCGTCCTCAACCCCATCA 13
Б квинкиес 11580P yopP B. quintana FAM- CGTTGCCGACAAGACGTCCTTGC 13
B_alsa_hsp60_F hsp60 B.alsatica TGCTAACGCTATGGAAAAAGTTG 108 19
B_alsa_hsp60_R HSP60 В. alsatica CCACGATCAAACTGCATTCC 19
B_alsa_hsp60_P HSP60 Б alsatica FAM-GTCGAAGAAGCAAAAACGGCTGAAACC 19
T_whi2_F ген, кодирующий белок семейства WiSP T.whipplei TGAGGATGTATCTGTGTATGGGACA 100 28
T_whi2_R WISP белок семейства ген, кодирующий Т. whipplei TCCTGTTACAAGCAGTACAAAACAAA 28
T_whi2_P WISP семьи белково кодирующий ген T. whipplei FAM- GAGAGATGGGGTGCAGGACAGGG 28
F_tul1728_F nhAd GGCCTTGGGGGTAGCTTATT 120 Это исследование
F_tul1728_R Nhad F. tularensis CCCTAGTGCAATTACCCAAGTCC Это исследование
F_tul1728_P Nhad F. tularensis FAM-GCAGCTGGAGTTGCCGTGATGG Это исследование
IS30a 3F Гипотетический ген, кодирующий белок C.burnetii CGCTGACCTACAGAAATATGTCC 164 29
гипотетический белок-кодирующий ген С. burnetii GGGGTAAGTAAATAATACCTTCTGG 29
IS30a F3-R 3 Р Гипотетический белок-кодирующий ген С. burnetii FAM-CATGAAGCGATTTATCAATACGTGTATGC 29
ITSD 16S-23S рРНК микобактерий GGGTGGGGTGTGGTGTTTGA 144 14
ITSr 16S-23S рРНК Mycobacteria CAAGGCATCCACCATGCGC 14
Туберкулезный зонд 16S-23S рРНК M.tuberculosis FAM- GCTAGCCGGCAGCGTATCCAT 14
Зонд Avium 16S-23S рРНК M. avium амплификация M. avium FGAMC7 FGAMGATC7 секвенирование
MycoF гр Микобактерии GGCAAGGTCACCCCGAAGGG 751 14
MycoR гр Микобактерия AGCGGCTGCTGGGTGATCATC 14
536F 16S РНК Микобактерии CAGCAGCCGCGGTAATAC 994 10
Rp2 10

Мы использовали праймеры и зонды, нацеленные на область ITS, для обнаружения микобактерий (14).В случае положительного результата характеристику на уровне видов проводили с помощью зонда на M. tuberculosis sp. комплекс и другой зонд для комплекса M. avium , как описано ранее (14). Для нимфатических узлов положительно на уровне рода, но отрицательно для M. tuberculosis sp. комплекса и комплекса M. avium , амплификацию ПЦР и секвенирование, нацеленное на область ITS, выполняли, как описано ранее.

ПЦР-амплификация и секвенирование гена rrs были выполнены с использованием ранее описанных методов (15).Все последовательности сравнивали с последовательностями, доступными в базах данных GenBank, EMBL и DJB, используя программу BLASTN 2.0.5 с пропусками через сервер Национального центра биотехнологической информации. Качество экстракции ДНК было подтверждено методом обратной транскрипции (RT) -PCR для гена домашнего хозяйства, кодирующего бета-актин (11).

Культура.

Для выделения B. henselae или T. whipplei образцы культивировали в фибробластах эмбрионального легкого человека (HEL) для получения сливающегося монослоя.Для культивирования использовали технику центрифугирования во флаконах с оболочкой (Sterilin, Feltham, England; 3,7 мл) с круглыми покровными стеклами диаметром 12 мм, засеянными 1 мл среды, содержащей 50000 клеток, и инкубацией в инкубаторе с 5% CO 2 при 37 °. C в течение 3 дней. Культуры исследовали, и каждые 7 дней оценивали рост бактерий на покровных стеклах непосредственно внутри флакона с оболочкой с использованием окрашивания по Гименезу и иммунофлуоресценции (11). Когда метод окрашивания был положительным, изоляты идентифицировали с помощью ПЦР и секвенирования, как описано выше.Для выделения обычных бактерий образцы помещали в 5% овечью кровь, шоколад, агар Мюллера-Хинтона, триптиказо-соевую среду и агар МакКонки (bioMérieux, Франция) и инкубировали при 37 ° C в аэробной, микроаэрофильной и анаэробной атмосфере. Изоляты были идентифицированы с использованием матричной лазерной десорбционной ионизации-времени пролета (MALDI-TOF), как описано ранее (16). Для выделения микобактерий образцы культивировали в пробирках MGIT (Becton, Dickinson, Pont-De-Claix, Франция) или на домашнем агаре с 5% овечьей кровью (bioMérieux, La Balme-les-Grottes, Франция) от 2 до 45 дней при 32 ° C или 37 ° C, как описано ранее (17).Окрашивание по Граму использовалось, чтобы убедиться в отсутствии каких-либо загрязняющих организмов в культуре, а стандартная идентификация микобактерий проводилась с использованием MALDI-TOF, как описано ранее (18). Для выделения F. tularensis образцы культивировали в шоколадном агаре.

Гистологический анализ.

Лимфатические узлы, зафиксированные в формалине, исследованы на гистологический анализ. Используемые красители включали грамм, гематоксилин и эозин, периодическую кислоту-Шиффа, Циля-Нильсена и Вартин-Старри.

Статистический анализ.

Когда распределение не было нормальным, для сравнения групп лимфатических узлов использовали односторонний дисперсионный анализ (ANOVA) и тест Краскела-Уоллиса. Линейная регрессия с прямым отбором использовалась для оценки связи бактериальных агентов лимфаденита с полом и возрастом. Анализы выполняли с использованием программного обеспечения SPSS v20.0 (IBM, Париж, Франция) и XLSTAT v12 (Addinsoft, Париж, Франция). Для сравнения данных между различными анализами с использованием EpiInfo версии 6 был проведен тест Стьюдента t или тест χ 2 .0 (Центры по контролю и профилактике заболеваний, Атланта, Джорджия, США). Значение P <0,05 считалось значимым.

РЕЗУЛЬТАТЫ

Мы протестировали 1688 образцов биопсии лимфатических узлов от 1688 пациентов за 5 лет. Средний возраст ± внутриквартильный размах (IR) составлял 30 ± 21 год (диапазон от 2 дней до 95 лет), при этом 965 (57%) были мужчинами и 723 (43%) женщинами. Всего 642 (38%) лимфатических узла были классифицированы как инфицированные бактериальным агентом, 389 (60%) были от мужчин и 253 (40%) от женщин.Средний возраст ± IR пациентов с инфицированными лимфатическими узлами составлял 28 ± 22 года (диапазон от 2 месяцев до 90 лет).

Молекулярные анализы.

Методом количественной ПЦР мы обнаружили 340 лимфатических узлов (53%), инфицированных B. henselae . Один лимфатический узел был ITS-положительным, а pap31 отрицательным и был идентифицирован как B. alsatica (19). M. tuberculosis обнаружен у 42 (6%) больных, M. avium — у 27 (4%) больных, Mycobacterium genavense в 2 (0.3%) пациентов и Mycobacterium bolletti у 2 (0,3%) пациентов. Обнаружено 23 лимфатических узла (4%), инфицированных F. tularensis и 7 (1%) инфицированных T. whipplei . Всего с помощью КПЦР было обнаружено 98% из видов Bartonella , 44% микобактерий, 100% F. tularensis — и 100% T. whipplei -инфицированных лимфатических узлов.

Амплификация гена rrs была положительной у 324 пациентов (50%;) и B.henselae была наиболее часто амплифицируемой бактерией (189 случаев, 58%). Другими распространенными бактериями, идентифицированными с помощью ПЦР rrs , были стафилококки (52 случая, в том числе 32 S. aureus ), стрептококки (15 случаев, в том числе 5 Streptococcus pyogenes ), F. tularensis (18 случаев), микобактерии (6 случаев) и Pseudomonas aeruginosa (5 случаев). rrs ПЦР-амплификация и секвенирование по сравнению с кПЦР были положительными для 56% из видов Bartonella , 8% для микобактерий и 78% из F.tularensis — положительные лимфатические узлы. Лимфатических узлов, инфицированных T. whipplei , не обнаружено. КПЦР была значительно лучше, чем амплификация и секвенирование rrs ПЦР для обнаружения B. henselae ( P = 0,05) и микобактерий ( P = 0,01), тогда как при обнаружении F. tularensis ( P = 0,2) (). Более того, qPCR была значительно лучше, чем амплификация и секвенирование rrs PCR для обнаружения M.tuberculosis ( P = 0,05) и M. avium ( P = 0,007), тогда как для других микобактерий различий не обнаружено.

ТАБЛИЦА 2

Результаты молекулярных анализов, посева и гистологического анализа исследованных лимфатических узлов

324 (50)
Диагноз d Виды Количество положительных лимфатических узлов No. %) положительных лимфатических узлов c по:
Специфическая ПЦР 16S рРНК Культура Гистологический анализ
332 (97.6) 189 (56) a 1 (0,3) 21 (6)
Bartonella alsatica 1 100137 1 (100) 100137 6 (14)
Mycobacterium avium 27 12 (44) 4 (15) a 22 (82 0
Mycobacterium genavense 2 1 (50) 1 (50) 2 (100) 0
35 bollet8 2 1 (50) 0 2 (100) 0
Стафилококки Staphylococcus aureus 45 ND 5 (11)
Staphylococcus epidermidis 33 ND 18 (55) 19 (58) 0
9 9 9 9 Staphylase6 Другие коагулазо-отрицательные ND 2 (18) 9 (82) 0
Streptococci Streptococcus pyogenes 6 ND 5 (83) 17 (33) )
Streptococcus b 2 ND 2 (100) 0 0
Streptococcus c / d 8 (80) 4 (40) 0
Propionibacterium acnes 34 ND 2 (6) 33 (9724) 0
Francisella tularensis 23 23 (100) 18 (78) 1 (4) b whipplei 7 7 (100) 0 1 (14) 3 (43)
Pseudomonas aeruginosa 4 (67) 1 (17)
Escherichia coli 3 ND 2 (67) 2 (67) 0 0005 Stenotrophomonas maltophilia 3 ND 1 2 (67) 1 (33)
Klebsiella pneumoniae 2 (100) 0
Serratia marcescens 2 ND 2 (100) 1 (50) 0 acter 9136 3 ND 1 (33) 2 (67) 0
Enterococcus sp. 2 ND 1 (50) 1 (50) 0
Prevotella sp. 3 без даты 3 (100) 0 0
Actinomyces 2 без даты 1 (1 ) 1 (50)
Fungi sp. 2 ND 1 (50) 1 (50) 0
Полимикробный 10 ND 20137 9 (90) 1 (10)
Прочие 19 ND 14 (74) 7 (37) 0
Всего 648 399 62138 642 182 (28)

Культура.

Бактерии были выделены из 182 (28%) образцов, причем микобактерии были наиболее часто восстанавливаемыми организмами (62 случая, 34%). Другими распространенными бактериями, выделенными путем культивирования, были S. aureus (24 лимфатических узла, 13%) и Staphylococcus epidermidis (19 лимфатических узлов, 10%). B. henselae культивировали и успешно пассировали из одного лимфатического узла. Мы выделили 1 изолят Francisella tularensis и 1 изолят T. whipplei путем культивирования клеток в оболочке флакона.Анаэробные бактерии, культивированные из лимфатических узлов, включали Propionibacterium acnes (33 случая, 18%), Fusobacterium necrophorum (1 образец, 0,5%) и Fusobacterium naviforme (1 образец, 0,5%). Культура была положительной на 83% микобактерий, 58% стафилококков и 33% стрептококк-положительных лимфатических узлов. КПЦР была значительно лучше, чем культура для диагностики F. tularensis ( P = 0,017) (). Культура была значительно лучше, чем ПЦР-амплификация и секвенирование rrs для P.acnes ( P = 0,003) и S. epidermidis ( P = 0,003). Более того, культура была значительно лучше, чем qPCR для обнаружения M. tuberculosis ( P = 0,004) и M. avium ( P = 0,001). Не было обнаружено значительных различий между культуральным и молекулярным анализами для других бактериальных агентов.

Гистологический анализ.

Гистологический анализ выполнен на 412 лимфатических узлах (). Большинство этих лимфатических узлов (194, 20%) были воспалительными, совместимыми с инфекционным лимфаденитом, тогда как новообразование было обнаружено в 119 лимфатических узлах (29%).Гистологический анализ не был окончательным для 49 лимфатических узлов (12%) и был нормальным для 59 лимфатических узлов (14%). Согласно бактериологическим исследованиям 27 (14%) лимфатических узлов, совместимых с инфекционным лимфаденитом, были положительными, в том числе 13 случаев CSD (положительная ПЦР), 6 случаев M. tuberculosis (3 положительных при ПЦР и посеве и 3 положительных только при ПЦР), 4 случаев S. aureus (как положительная ПЦР, так и культура), 3 T. whipplei (положительная ПЦР), 1 Pseudomonas aeruginosa (положительная культура) и 1 Streptococcus pyogenes (как положительная ПЦР, так и культура).Пять лимфатических узлов (4%) с новообразованием также были положительными на инфекционный агент (4 случая были положительными на B. henselae с помощью ПЦР и 1 случаев S. aureus были положительными с помощью ПЦР и посева). Злокачественность лимфатических узлов, инфицированных CSD, была определена как неходжкинская лимфома. Бактериологические анализы показали, что у 4 лимфатических узлов был CSD, не подтвержденный гистологическим анализом; один был также инфицирован Actinomyces sp. (положительный результат как ПЦР, так и посев), один был инфицирован Stenotrophomonas maltophilia (положительный как при ПЦР, так и при культивировании), а другой был полимикробным (положительный как при ПЦР, так и при культивировании)).

ТАБЛИЦА 3

Результат гистологического анализа лимфатических узлов, зафиксированных в формалине

Гистологические данные Число положительных лимфатических узлов при гистологическом анализе Число (%) положительных бактериологических анализов
Новообразование 119 5 (3)
Воспалительный лимфаденит 194 27 (14)
Нормальный 59 0
Не специфический 8138 16)
Всего 412 49 (12)

Регрессионный анализ.

M. tuberculosis был обнаружен значительно чаще у женщин, чем у мужчин ( P = 0,01). Не было обнаружено значительных различий между мужчинами и женщинами для других бактериальных агентов. Связь с возрастом была обнаружена для видов Bartonella , M. tuberculosis , T. whipplei , M. avium , S. epidermidis и F. tularensis . Пациенты с CSD были значительно моложе (медиана ± IR, 27 ± 17 лет; диапазон от 2 до 90 лет), чем пациенты в группе без CSD (медиана ± IR, 37 ± 25 лет; диапазон от 2 месяцев до 85 лет). ) ( P = 0.001) (). Пациенты с лимфатическими узлами, инфицированными M. tuberculosis , были значительно старше (медиана ± IR, 47 ± 21 год; диапазон от 1,5 до 85 лет), чем пациентов, не инфицированных M. tuberculosis (медиана ± IR, 30 ± 21). лет; диапазон от 0,2 месяца до 90 лет) ( P = 0,001). Пациенты с лимфатическими узлами, инфицированными M. avium , были значительно моложе, чем пациенты с комплексом M. avium без (медиана ± IR, 6 ± 15 лет; диапазон от 1,5 до 70 лет) по сравнению с 33 ± 21 годом (диапазон , От 2 месяцев до 90 лет) ( P = 0.001). Лимфатические узлы, инфицированные F. tularensis , были от пациентов значительно более старшего возраста (медиана ± IR, 44 ± 18 лет; диапазон от 14 до 73 лет), чем пациентов, не инфицированных F. tularensis (медиана ± IR, 31 ± 21). лет; диапазон от 2 месяцев до 90 лет) ( P = 0,005). Лимфатические узлы, инфицированные T. whipplei , были от пациентов значительно старше (медиана ± IR, 50 ± 12 лет; диапазон от 35 до 66 лет), чем пациентов, не инфицированных T. whipplei (медиана ± IR, 31 ± 21). лет; диапазон от 2 месяцев до 90 лет) ( P = 0.04). Пациенты с лимфатическими узлами, инфицированными S. epidermidis , были значительно старше (медиана ± IR, 40 ± 20 лет; диапазон от 2 месяцев до 79 лет), чем пациентов, не инфицированных S. epidermidis (медиана ± IR, 30 ± 22 года; диапазон от 3 месяцев до 90 лет) ( P = 0,001). Для других бактериальных агентов существенной разницы не обнаружено.

ТАБЛИЦА 4

Демографические данные групп пациентов

± 15 .5

3

Инфекция? Возраст (медиана ± внутриквартильный размах) в годах
CSD M.tuberculosis M. avium T. whipplei F. tularensis S. epidermidis
490,5 ± 12,3 43,9 ± 18,1 40,1 ± 20,3
Нет 36,5 ± 24,6 30,4 ± 21,2 32,6 ± 21,1 31,2 ± 20,8 30 ± 21,7
P значение 0,001 0,001 0,001 0,04 0,005 0,001

узлы, используемые нами в обширном исследовании DISC

молекулярные анализы и культуры для диагностики инфекционного лимфаденита. Кроме того, лимфатические узлы были проверены гистологическим анализом, когда это было возможно. Все наши молекулярные и культуральные анализы были ранее оценены (3, 11, 16, 17).Кроме того, мы обычно включаем множество отрицательных и положительных контролей в каждый анализ, а качество экстракции ДНК проверялось для всех образцов. Однако ограничением нашего исследования было то, что мы не тестировали на грибки или вирусы, которые также могут представлять причины увеличения лимфатических узлов. Более того, мы не получили гистологические данные для всех пациентов, потому что большинство образцов, отправленных в наш центр, были замороженными или слишком маленькими. В нашей серии лимфатических узлов новообразования составляли 7% случаев подозрения на CSD.Однако этот процент может быть выше, поскольку мы проверили только 24% лимфатических узлов с помощью гистологического анализа. Кроме того, ограничением было то, что мы могли анализировать наши результаты по тому, была ли получена часть или весь лимфатический узел, так как весь лимфатический узел с большей вероятностью будет давать патоген.

Насколько нам известно, наше исследование лимфатических узлов является самым крупным из описанных на сегодняшний день (). Однако сравнение исследований затруднено, и следует учитывать контекст лабораторных предубеждений, эпох и различных популяций пациентов, присущих каждому конкретному исследованию.В нашем исследовании B. henselae было обнаружено в основном у более молодых пациентов и являлось наиболее частой причиной инфекционного лимфаденита. Наши результаты подтвердили предыдущие исследования нашей лаборатории (2, 3). Предвзятость в нашем исследовании заключается в том, что наша лаборатория является справочным центром по ку-лихорадке, риккетсиозу и бартонеллезу. Это было причиной того, что все лимфатические узлы были оценены с помощью кПЦР специально для B. henselae , F. tularensis , T. whipplei и C. burnetii .Более того, более высокий процент положительных результатов B. henselae в наших исследованиях был обусловлен тем, что образцы были взяты у пациентов с подозрением на CSD. Аналогичным образом Ridder et al. обнаружили B. henselae как наиболее частую причину инфекционного лимфаденита у пациентов с неясными новообразованиями в голове и шее (20). До открытия B. henselae , что объясняет его отсутствие в исследованиях 1980-х годов (2) и в эпоху молекулярных анализов, Mycobacterium spp.был наиболее частой причиной инфекционного лимфаденита (21, –23). В нашем исследовании M. tuberculosis было третьим по частоте возбудителем инфекционного лимфаденита после S. aureus . Об аналогичном проценте для M. tuberculosis сообщил Добернек (21). Напротив, Anthony et al. (22) и Freidig et al. (24) обнаружили более низкий процент для M. tuberculosis . Кроме того, Росадо и др. (25) обнаружили два случая лимфаденита видов Yersinia в паховом и брыжеечном лимфатических узлах.

ТАБЛИЦА 5

Предыдущие исследования бактериального лимфаденита

Робертс и др. (1984) (23) Комплекс M. kansasii (0,7)
Автор (год) (ссылка) Количество пациентов Используемый метод диагностики
Обычно выявляемые возбудители инфекционного лимфаденита (% положительных случаев) a
Культура ПЦР 1-й агент 2-й агент 3-й агент 4-й агент
16137 9013 908 М.tuberculosis (6) S. aureus (4) ND ND
Anthony et al. (1983) (22) 228 M. tuberculosis (3) B. henselae (1) T. gondii (0,4) ND
ND
ND
163 Да Нет Микобактерии (17) S.epidermidis S. viridans P. acnes
Freidig et al. (1986) (24) 419 Да Нет Histoplasma capsulatum (4) M. tuberculosis (3) M. avium
Ridder et al. (2002) (20) 454 Да Да B.henselae (13) S. pyogenes (2) S. aureus (1) M. tuberculosis (1)
Chau et al. (2003) (30) 423 Да Нет T. gondii (4) M. tuberculosis (3) B. henselae (0,7) Streptococci )
Rolain et al. (2006) (2) 786 Да Да B.henselae (31) Микобактерии (7) Коагулазонегативные стафилококки (3) S. aureus (2)
Angelakis et al. (2009) (3) 491 Нет Да B. henselae (30) S. aureus (4) F. tularensis (3) M. tuberculosis (1)
Rosado et al. (2011) (25) 368 Да Да M.avium комплекс (60) B. henselae (20) Иерсиниоз (7) F. tularensis (3)
Это исследование 1,688 Да Да Да B. henselae (33) S. aureus (7) Коагулазонегативные стафилококки (7) M. tuberculosis (7)

Микобактериальная инфекция была выявлена ​​в 11% случаев. положительные лимфатические узлы.По сравнению с нашим предыдущим исследованием (2), мы обнаружили больше микобактериальных агентов, скорее всего, потому, что в настоящее время лимфатические узлы регулярно культивируются независимо от предполагаемого диагноза. КПЦР была лучше для диагностики микобактериальной инфекции, чем амплификация гена rrs . Однако наши молекулярные анализы были менее эффективны по сравнению с культурой для диагностики микобактериальной инфекции. Несмотря на длительное время инкубации, необходимое для выделения штаммов микобактерий, культивирование по-прежнему имеет решающее значение, поскольку оно обеспечивает лучшую чувствительность для обнаружения этих агентов.Для повышения чувствительности диагностики микобактериального лимфаденита было предложено сочетание различных процедур с разной чувствительностью (6). В нашем исследовании мы объединили молекулярные анализы с культивированием и на основе этих результатов попытаемся разработать более эффективный новый анализ количественной ПЦР специально для обнаружения микобактерий.

Прихотливые организмы были причиной инфекционного аденита, и мы обнаружили, что количественная ПЦР является референтным методом диагностики этих агентов.Амплификация и секвенирование rrs были менее эффективны для обнаружения B. henselae и F. tularensis , чем специфическая кПЦР, тогда как скорость обнаружения для T. whipplei была низкой. Культура оказалась неэффективной для диагностики требовательных организмов, поскольку их выделение часто затруднено и зависит от количества микроорганизмов в клетках, которое должно быть как можно большим, и от стадии центрифугирования, которая усиливает адгезию высвобождаемых бактерий. от их внутриклеточного положения в клетках в культуре (26).В предыдущих исследованиях мы наблюдали бактерии путем прямой иммунофлуоресценции во многих лимфатических узлах, которые были отрицательными при культивировании, что позволяет предположить, что бактерии в лимфатических узлах нежизнеспособны (12). Более того, в нашей ранее опубликованной серии лимфатических узлов мы обнаружили очень низкий уровень изоляции B. henselae из лимфатических узлов (2). Основываясь на этих результатах, мы обычно не культивируем лимфатические узлы, положительные на B. henselae . Выделение требовательных организмов из образцов по-прежнему имеет решающее значение для описания новых видов, что позволяет проводить генетические описания, физиологические анализы, совершенствовать диагностические инструменты и определять чувствительность бактерий к антибиотикам (11, 27).Гистологический анализ лимфатических узлов имеет решающее значение, поскольку мы обнаружили четыре лимфатических узла с CSD и злокачественными новообразованиями. Риддер и др. также сообщили о 2 случаях плоскоклеточного рака и 2 случаях злокачественной В-клеточной лимфомы у пациентов с высокими титрами антител к B. henselae (20).

В этом обширном исследовании лимфатических узлов мы показали, что анализ лимфатических узлов путем комбинации rrs ПЦР-амплификации и секвенирования со специфической КПЦР и посевом имеет решающее значение для диагностики бактериального лимфаденита.Стафилококки, стрептококки и другие аэробные и анаэробные бактерии были обнаружены как возбудители инфекционного аденита. rrs ПЦР остается критически важным для обнаружения этих бактерий (10). Хотя эффективность ПЦР rrs для обнаружения неприхотливых агентов варьировалась и зависела от вида бактерий, не было обнаружено значительных различий между культурой и ПЦР rrs . Чтобы повысить чувствительность посева, образцы биопсии лимфатических узлов должны быть взяты перед лечением на ранней стадии заболевания и должны быть засеяны как можно скорее.Однако мы не можем предоставить данные о лечении пациента во время биопсии лимфатического узла.

Врачи должны знать, что в случае отрицательного результата rrs ПЦР не исключено инфицирование привередливыми организмами и микобактериями, учитывая низкую чувствительность эубактериальной ПЦР. Инфекция CSD и M. avium чаще встречается у молодых пациентов, тогда как пациенты с M. tuberculosis значительно старше. Более того, мы подчеркнули необходимость того, чтобы удаление лимфатических узлов и гистологический анализ имели решающее значение для точной диагностики, поскольку новообразования могут быть клинически ошибочно диагностированы как CSD, когда используются только молекулярные анализы.

Болезнь Кикучи: дифференциация от туберкулезного лимфаденита на основе паттернов узлового некроза на КТ

Реферат

Предпосылки и цель: кД, также известный как гистиоцитарно-некротический лимфаденит, часто имитируется TL, особенно когда KD сопровождается крупным некрозом на КТ. Мы проанализировали паттерны узлового некроза на КТ у пациентов с KD и TL, чтобы определить прогностические признаки, которые различают эти 2 объекта.

МАТЕРИАЛЫ И МЕТОДЫ: Мы включили 24 пациента с КБ (14 женщин, 10 мужчин; средний возраст 25 лет.1 год) и 45 с TL (36 женщин, 9 мужчин; средний возраст 39,9 года) с узловым некрозом на КТ. Степень, количество, расположение и границы узлового некроза; наличие перинодальной инфильтрации; и узловой кальциноз. Были получены два индекса ослабления для узлового некроза: CTN и CTN / M. Были сопоставлены характеристики CT двух заболеваний, и был проведен многомерный логистический регрессионный анализ для определения прогностических характеристик, которые помогли бы дифференцировать KD от TL.

РЕЗУЛЬТАТЫ: Легкая или умеренная степень узлового некроза ( P =.000), множественные очаги некроза ( P = 0,002), нечеткие границы очагов некроза ( P = 0,000), CTN> 44,5 ( P = 0,000), CTN / M> 0,7 ( P = 0,000) и отсутствие кальцификации узлов ( P = 0,012) были связаны с KD. Многомерный логистический регрессионный анализ показал, что нечеткие границы очагов некроза были независимыми предикторами с точностью 80%.

ВЫВОДЫ: Наличие нечетких краев некротических очагов было независимым предиктором дифференциации КД от ТЛ с высокой диагностической точностью.

СОКРАЩЕНИЯ:

CTN
CT-ослабление узлового некроза
CTN / M
CT-ослабление некротической части лимфатического узла к прилегающей мышце
FNAB
тонкоигольная аспирационная биопсия
KD
KD
920 болезнь ROC
анализ рабочих характеристик приемника
TL
туберкулезный лимфаденит
US
сонография

KD, также известный как гистиоцитарно-некротический лимфаденит, является редкой самоограничивающейся причиной лимфаденопатии шейки матки, преимущественно более молодой, чем у южноазиатских женщин. 30 лет.КД гистопатологически характеризуется кортикальным и паракортикальным некрозом с лимфоретикулярной инфильтрацией и отсутствием гранулоцитарной инфильтрации. 1,2 Заболевание следует отличать от множества других заболеваний, включая TL, лимфому и другие доброкачественные и / или злокачественные аденопатии, клиническими проявлениями и лабораторными методами. 3

TL часто имитирует KD, особенно когда KD сопровождается узловым некрозом на КТ. Более того, TL распространен в Юго-Восточной Азии. 4 Однако, в отличие от KD, пациентам с TL всегда требуется противотуберкулезная химиотерапия, а иногда и хирургическое удаление. 5 Следовательно, важно различать KD и TL, чтобы обеспечить соответствующее лечение. 6

FNAB считается диагностическим инструментом для KD и TL, но FNAB не может быть лучшим решением для дифференциации этих заболеваний. Сообщалось, что диагностическая точность FNAB для KD составляет приблизительно 50%, возможно, из-за того, что цитологические особенности перекрывают таковые TL. 7 Таким образом, особое внимание уделяется методам визуализации, таким как УЗИ и КТ, для выявления и характеристики этих 2 типов некротического лимфаденита. Хотя КТ представляет радиационную опасность, она превосходит УЗИ, потому что она объективна и не зависит от навыков оператора при определении узлового некроза. Кроме того, это также может помочь определить точную степень лимфаденита.

Ранее сообщалось о результатах компьютерной томографии для каждого заболевания. 1,8–12 Наиболее частые результаты КТ при КД включают однородное усиление с узловым некрозом или без него и перинодальную инфильтрацию на КТ, в то время как типичные результаты КТ при TL включают центральный некроз с низкой степенью ослабления с усилением периферического ободка с / без кальцификации .Однако дифференцировать эти заболевания в повседневной практике по-прежнему сложно, поскольку они имеют частично совпадающие данные по КТ. Целью нашего исследования было количественно, а также качественно проанализировать особенности КТ узлового некроза в гистологически подтвержденных случаях КД и ТЛ, а также определить прогностические признаки, которые могут позволить дифференцировать КД от ТЛ.

Материалы и методы

Исследуемая популяция

Это ретроспективное исследование было одобрено наблюдательным советом нашего учреждения, и требование информированного согласия было отменено.Компьютеризированный поиск медицинских карт нашего учреждения с января 2005 г. по март 2010 г. обнаружил 38 пациентов с KD и 62 пациента с TL, гистопатологически подтвержденным методом эксцизионной биопсии. Чтобы создать группу подходящих случаев для сравнения паттернов узлового некроза на КТ между двумя заболеваниями, мы использовали следующие критерии включения: 1) патологический диагноз KD и TL шейных лимфатических узлов, 2) доступная КТ шеи с контрастным усилением. изображение, и 3) наличие узлового некроза в крупнейших лимфатических узлах, проанализированных на КТ.«Узловой некроз» на компьютерной томографии был определен как очаговые области с низким затуханием. 13

Из 100 пациентов с этим заболеванием были исключены 10 пациентов с KD и 17 с TL, включая тех, кому не делали компьютерную томографию шеи, и тех, у которых болезнь не затрагивала шейные лимфатические узлы. Кроме того, 4 пациента с KD были исключены, потому что у них не было выявлено узлового некроза на КТ на основании самого большого лимфатического узла.

Наконец, 24 пациента с диагнозом KD (14 женщин, 10 мужчин; средний возраст 25 лет.1 ± 12,03) и 45 пациентов с диагнозом TL (36 женщин, 9 мужчин; средний возраст 39,9 ± 15,51), показавших узловой некроз на КТ, были включены в наше исследование (рис. 1).

Рисунок 1.

кД у 8-летней девочки. Поперечное КТ-изображение показывает лимфатический узел (, стрелка ), содержащий множественные некротические очаги в периферической части узла. Очаги некроза имеют нечеткие края, а степень узлового некроза составляет менее 30% (легкая степень) лимфатического узла. Видно стирание жировой плоскости, окружающей узел ( стрелка ).CTN и CTN / M были рассчитаны как 79 HU и 1,0 соответственно.

Средние интервалы времени между КТ шеи и эксцизионной биопсией у пациентов с KD и TL составили 8,2 дня и 7,4 дня соответственно.

Уровень II был наиболее часто анализируемым участком KD, выявленным у 16 ​​(66,7%) из 24 пациентов с KD, за ним следовал уровень V у 4 (16,6%), в соответствии с узловой классификацией на основе изображений, представленной Som et al. 14 Наиболее анализируемые лимфатические узлы в TL были на уровне II (20/45, 44.4%) и V (16/45, 35,6%).

Средние максимальные диаметры проанализированных лимфатических узлов KD и TL составили 2,0 и 2,5 см соответственно. Характеристики исследуемой популяции представлены в Таблице 1.

Таблица 1:

Характеристики исследуемой популяции a

Протокол изображений

КТ шеи (сканер Somatom 16CT или 64CT; Siemens Medical Systems, Малверн, Пенсильвания) была выполнена в осевых плоскостях от основания черепа до верхнего средостения.Срезы были прилегающими друг к другу толщиной 3 мм. Изображения были получены после внутривенного введения 80 мл неионного контрастного вещества (Ultravist [iopromide]; Schering, Берлин, Германия) в зависимости от веса пациента с 40-секундной задержкой перед началом сканирования.

Оценка визуализации

Качественный анализ.

Два радиолога (S.L. и J.H.Y.), которые не знали о патологических результатах, просмотрели изображения компьютерной томографии, и два наблюдателя достигли консенсуса.Были проанализированы самые большие пораженные лимфатические узлы с узловым некрозом на КТ, которые максимально соответствовали месту иссеченной биопсии. Паттерны узлового некроза оценивались на основе степени, количества, местоположения и границ. Также оценивали наличие перинодальной инфильтрации и кальцификации узлов.

Степень некротических очагов была разделена на 3 группы: легкая (<30% пораженного лимфатического узла), умеренная (30–70%) и тяжелая (> 70%). По количеству очагов некроза были разделены на единичные и множественные (> 2 очага некроза).Расположение очагов некроза классифицировалось как центральная или периферическая (эксцентрическая или рассеянная) часть внутри узла. Края некротических очагов были классифицированы как нечеткие, относительно хорошо выраженные или хорошо выраженные. Перинодальная инфильтрация считалась присутствующей, если прилегающая жировая прослойка была скрыта. Присутствие (отсутствие) кальцификации в узле также оценивалось и кодировалось как двоичная переменная.

Количественный анализ.

CTN / M измеряли в единицах Хаунсфилда с использованием вручную определенных круговых или овальных областей интереса (приблизительно 5 мм 2 ) на постконстрастных КТ-изображениях.На некротическую часть помещали не менее 3 представляющих интерес области, за исключением сосудов корня и паренхимы лимфатического узла и прилегающих мышц, таких как грудино-ключично-сосцевидные и трапециевидные мышцы, без артефактов, укрепляющих пучок. Затем значения интересующей области были усреднены.

Затем были выведены два индекса ослабления для узлового некроза, CTN и CTN / M.

Статистический анализ

Чтобы оценить различия в демографических характеристиках между KD и TL, мы использовали тест Манна-Уитни U и тест χ 2 .Тест χ 2 использовался для сравнения категориальных переменных, включая протяженность, количество, расположение и границы очагов некроза; перинодальная инфильтрация; и узловой кальциноз. Мы использовали тест Манна-Уитни U для сравнения CTN и CTN / M в KD и TL.

ROC использовался для определения оптимальных значений отсечки для CTN и CTN / M, чтобы отличить KD от TL. Площадь под кривой ROC обеспечивает измерение общих показателей ослабления для узлового некроза как эффективных индикаторов для различения двух заболеваний.Оптимальные значения отсечения были определены как значение, при котором сумма чувствительности и специфичности была максимальной.

Многомерный анализ был выполнен с использованием метода множественной логистической регрессии. Модель включает использование обратного пошагового исключения с исключенными переменными при P <.1, чтобы определить, были ли эти результаты КТ полезны независимо друг от друга при различении KD от TL. Статистическая значимость была определена как P <.05. Все статистические анализы были выполнены с использованием статистического пакета для программного обеспечения социальных наук, версия 18.0 (SPSS, Чикаго, Иллинойс).

Результаты

Не было значительных различий в распределении полов между KD (женщина / мужчина, 14:10) и TL (женщины / мужчины, 36: 9). Однако наблюдалась значительная разница в возрастном распределении между KD (средний возраст 24,5 ± 11,22 года) и TL (средний возраст 39,9 ± 15,52 года; P <0,05, критерий Манна-Уитни U ).

Качественный анализ КТ изображений в KD и TL

Паттерны узлового некроза на КТ при KD и TL суммированы в Таблице 2. Степень узлового некроза была легкой или средней у 21 (87,5%) из 24 пациентов с KD и тяжелой у 28 (62,2%) из 45 пациентов с KD. TL ( P = 0,000). Степень узлового некроза значительно различалась между KD и TL, независимо от того, считалась ли она тройной ( P = 0,000) или двоичной переменной (таблица 2). Репрезентативные изображения представлены на рис. 1–3.Двадцать два (91,6%) из 24 пациентов с KD имели множественные очаги некроза в самом большом узле (рис.2), тогда как 20 (44,4%) из 45 пациентов с TL имели один очаг некроза в самом большом узле ( P = .003) (Рис. 4). Не было значительных различий в расположении очагов некроза внутри самого большого узла между двумя заболеваниями ( P = 0,339). При обоих заболеваниях очаги некроза часто располагались в периферической части внутри узла (рис. 2 и 5). Края некротических очагов нечеткие у 19 (79.2%) из 24 пациентов с KD (рис. 1–3) и относительно четко выраженной или четко выраженной у 36 (80,0%) из 45 пациентов с TL (рис. 4–6). Значительные различия между двумя заболеваниями наблюдались на краях очагов некроза, считающихся тройной ( P = 0,000), а также бинарной переменной (таблица 2). Не было значительной разницы в перинодальной инфильтрации между KD и TL ( P = 0,192) (рис. 6). Кальцификация внутри узлов наблюдалась у 11 из 45 пациентов с TL ( P =.012) (Рис 5).

Таблица 2:

Сравнение паттернов узлового некроза на КТ у KD и TL a

Рис 2.

кД у 13-летнего мальчика. Поперечное КТ-изображение показывает лимфатический узел (, стрелка ), содержащий множественные некротические очаги в периферической части узла. Очаги некроза имеют нечеткие края, а степень узлового некроза составляет приблизительно 30–70% (умеренная степень) лимфатического узла. CTN и CTN / M были рассчитаны как 65 HU и 0,9 соответственно.

Рис 3.

кД у 31-летней женщины. Поперечная КТ показывает 2 лимфатических узла с очагами некроза. Более крупный (, стрелка ) имеет единичный некротический очаг с относительно нечетким краем, и его протяженность составляет> 70% (тяжелая степень) лимфатического узла. Видна перинодальная инфильтрация ( стрелка ). CTN и CTN / M составляли 43 HU и 0,7 соответственно.

Рис 4.

TL у 38-летней женщины. Поперечная компьютерная томография показывает некротический лимфатический узел. Лимфатический узел (, стрелка ) имеет единственный некротический очаг с четко определенным краем, а степень узлового некроза составляет> 70% (тяжелая степень) лимфатического узла.CTN и CTN / M составляли 29 HU и 0,4 соответственно.

Рис 5.

TL у 35-летней женщины. Поперечное изображение показывает лимфатический узел (, стрелка ), имеющий множественные некротические очаги с относительно четко очерченными краями и умеренной степенью узлового некроза. Обратите внимание на кальцификацию (стрелка , стрелка ) внутри узла. CTN и CTN / M составляли 38 HU и 0,6 соответственно.

Рис 6.

TL у 37-летнего мужчины. Поперечная КТ показывает несколько лимфатических узлов с очагами некроза. Более крупный (, стрелка ) имеет множественные некротические очаги (не показаны на этом рисунке) с четко определенными краями и серьезной степенью узлового некроза.Обратите внимание на облитерацию перинодального жира вокруг лимфатического узла (стрелка , стрелка ). CTN и CTN / M составляли 22 HU и 0,4 соответственно.

Количественный анализ КТ изображений в KD и TL

Среднее значение CTN для KD (70,3 ± 18,01) было значительно выше, чем у TL (37,4 ± 20,00, P = 0,000) (рис. 7). Среднее CTN / M для KD и TL составило 1,1 ± 0,27 и 0,6 ± 0,31 соответственно; значение для KD было значительно выше, чем для TL ( P = 000) (рис. 8).

Рис 7.

График CTN ТЛ и КД. Среднее значение CTN для KD (70,3 ± 18,01) значительно выше, чем для TL (37,4 ± 20,00). Когда 44,5 использовалось в качестве порогового значения для CTN, чувствительность 89,5% и специфичность 86,0% были достигнуты для дифференциации KD от TL.

Рис 8.

График CTN / M ТЛ и КД. Среднее значение CTN / M для KD (1,1 ± 0,27) значительно выше, чем для TL (0,6 ± 0,31). Когда 0,7 использовалось в качестве порогового значения для CTN, чувствительность составила 94,7%, а специфичность — 76.7% были достигнуты для дифференциации KD от TL.

На кривой ROC мы использовали значения отсечения 44,5 и 0,7 для CTN и CTN / M, соответственно, для дифференциации KD от TL, что дало чувствительность 89,5% и 94,7% и специфичность 86,0% и 76,7% соответственно (рис. 7 и 8). Площади под кривыми ROC CTN и CTN / M составили 0,917 и 0,854 соответственно.

CTN и CTN / M были дихотомизированы как пороги значений отсечки через ROC. Значительные различия между двумя заболеваниями наблюдались в CTN и CTN / M, независимо от того, считались ли они непрерывными или бинарными переменными (таблица 2).

Точность диагностики независимых предсказателей

Был проведен многомерный логистический регрессионный анализ для определения независимых предикторов каждого признака, которые были статистически различающими между KD и TL в одномерном анализе. Результаты определили границы некротических очагов в качестве независимого предиктора для дифференциации KD от TL (отношение шансов 44,46; P = 0,003).

Используя нечеткие границы некротических очагов для дифференциации KD от TL, мы обнаружили, что чувствительность, специфичность, точность, а также положительные и отрицательные прогностические значения составляют 79.2%, 80,0%, 79,7%, 67,9% и 87,8% соответственно.

Обсуждение

Хотя они не распространены в западных странах, KD и TL преобладают в азиатских странах. Поскольку эти заболевания имеют совершенно разные схемы лечения и клиническое течение, важно их дифференцировать. 6 Насколько нам известно, это первое исследование, в котором паттерны узлового некроза на КТ KD и TL были проанализированы объективно и количественно. Наши результаты показывают, что множественные некротические очаги легкой и средней степени тяжести с нечеткими краями и более высокими индексами ослабления некроза (CTN и CTN / M) без кальцификации были статистически значимыми параметрами в дифференциации KD от TL.Кроме того, многомерный логистический регрессионный анализ выявил нечеткие границы некротических очагов в качестве независимого предиктора для дифференциации KD от TL.

Многие предыдущие исследования показали, что в большинстве случаев TL выявляли узловой некроз на КТ-изображениях. 10–12 Однако немногочисленные исследования показали, что КТ-изображения выявили узловой некроз как необычную особенность KD. 1,9 Kwon et al 1 сообщили, что у 16 ​​(16,7%) из 96 пациентов с KD был узловой некроз. В нашем исследовании 24 (94.5%) из 28 пациентов с KD показали узловой некроз на КТ-изображениях, что встречается чаще, чем наблюдалось в предыдущих исследованиях. Поскольку KD также называют гистиоцитарным или подострым некротическим лимфаденитом из-за его гистопатологических особенностей, 15,16 пациентов с KD часто имеют узловой некроз на КТ. Различные компьютерные томографы и параметры получения изображений (например, толщина среза, напряжение и ток трубки) могут способствовать различиям в частоте узлового некроза на КТ.

В нашем исследовании наличие нечетких краев некротических очагов было независимым предиктором для дифференциации KD от TL.Это можно объяснить патологическими особенностями КД и ТЛ. KD характеризуется коагуляционным некрозом, сопровождающимся апоптозом, который включает различные клетки, такие как отложения эозинофильных фибриноидов и кариорезный дебрис, с пролиферацией гистиоцитов и иммунобластов, окружающих область некроза, 2,15,16 , тогда как TL характеризуется некрозом казеоза окружен грануляционной тканью. 17

Наши данные показали, что ослабление некроза для KD было значительно выше, чем для TL.CTN / M показал аналогичные результаты. Поскольку он был получен во избежание систематической ошибки из-за различий в усилении среди КТ-сканирований, результаты подтвердили предположение, что ослабление некроза для KD было выше, чем для TL. Сосуществование ярко эозинофильных фибриноидных отложений при узловом некрозе могло объяснить более высокое ослабление некроза KD.

В нашем исследовании KD показала большее количество некротических очагов в узлах, которые были менее обширными, чем в TL. Есть несколько возможных объяснений этого открытия.Во-первых, КД и ТЛ имеют разные патологические особенности. Во-вторых, в то время как TL безболезненна, KD болезненна и сопровождается системными симптомами, которые могут привести к тому, что пациенты с KD будут проходить КТ раньше, чем пациенты с TL.

В нашем исследовании у 22 (91%) из 24 пациентов с KD была перинодальная инфильтрация, которая является характерной особенностью KD. 1 Однако мы также часто наблюдали перинодальную инфильтрацию в TL (34/45, 76%). Это согласуется с результатами предыдущего исследования 10 , в котором 75% исследований TL показали облитерацию окружающей жировой плоскости.Это возможно потому, что разрушение капсулы лимфатического узла вызывает периаденит после 3 стадии, когда активная ТЛ патологически разделяется на 4 стадии в зависимости от длительности заболевания. 17,18

В нашем исследовании кальцификация внутри узлов наблюдалась только у TL. Фиброкальцификация узлов — один из паттернов ТЛ. 10,17,19 Таким образом, было высказано предположение, что кальциноз в лимфатических узлах является характерным признаком TL, помогая дифференцировать это заболевание от других заболеваний, включая KD.В этом отношении КТ имела преимущества перед МРТ в дифференциации KD и TL, потому что МРТ имеет лишь ограниченную способность отображать кальцификацию узлов. 20

У этого исследования были некоторые ограничения. Во-первых, визуальный анализ был основан только на самом большом лимфатическом узле, содержащем некротические очаги, хотя были затронуты несколько лимфатических узлов на каждого пациента; эти недостающие данные могли повлиять на наши результаты. Вторым ограничением нашего исследования был относительно небольшой размер выборки пациентов с KD и TL для демонстрации различий между двумя заболеваниями.Это могло привести к ограничению получения точных прогнозных значений. Небольшой размер выборки двух заболеваний, включенных в это исследование, объясняется тем, что пациенты с TL и KD не всегда диагностируются хирургическим путем, и даже в группах пациентов с KD большое количество пациентов с KD имеют самоограниченное заболевание до того, как диагностические инструменты будут использованы. применяемый. В результате, возможно, возникла систематическая ошибка отбора. В-третьих, на наши результаты могли повлиять технические ограничения. Небольшой размер представляющих интерес областей для некротических участков, измеренных в настоящем исследовании, возможно, объяснил большую вариабельность в измерениях.Наконец, были использованы компьютерные томографы двух различных разрешений (16- и 64-детекторный компьютерный томограф).

Выводы

Характерными паттернами узлового некроза на КТ KD были множественные некротические очаги от легкой до умеренной с нечеткими краями и более высокими индексами ослабления некроза (CTN и CTN / M) без кальцификации внутри узлов. Более того, наличие нечетких краев некротических очагов было независимым предиктором дифференциации KD от TL, давая 79,2% чувствительности 80.Специфичность 0% и точность 79,7%.

Сноски

  • Документ, ранее представленный на: Ежегодном собрании Радиологического общества Северной Америки, 28 ноября — 3 декабря 2010 г .; Чикаго, Иллинойс.

  • Поступила 17 февраля 2011 г.
  • Принята после доработки 30 апреля 2011 г.
  • © 2012 Американский журнал нейрорадиологии

Национальная информационная служба по болезням животных

Редакционная информация

Автор: Фил Скотт DVM&S BVM&S CertCHP DSHP DipECBHM FRCVS

Проверено: Фил Скотт DVM & S BVM & S CertCHP DSHP DipECBHM FRCVS 2016

Опубликовано: 2011

Казеозный лимфаденит (КЛК) — хроническое заразное кожное заболевание, в основном у овец и коз, заболеваемость которым увеличивается с возрастом.Эпидемиология CLA варьируется в зависимости от страны: от небольшой передачи в отарах в Соединенном Королевстве до крупных пропорций в отарах в Австралии и Соединенных Штатах Америки.

Казеозный лимфаденит вызывается бактерией Corynebacterium pseudotuberculosis . Передача происходит либо напрямую между овцами при тесном содержании, либо косвенно через зараженное стригущее оборудование. Драки, вызывающие поражения кожи на голове, являются основным средством передачи болезней между баранами в Великобритании.Распространенность инфекции увеличивается с возрастом и у овец, содержащихся в условиях интенсивного содержания.

Рис. 1. Борьба с повреждениями кожи на голове является основным средством передачи болезней между баранами в Великобритании

Рис. 2: Борьба с поражением на затылке могла быть путем заражения CLA у этого барана.

Рис. 3: CLA-абсцесс околоушного лимфатического узла у основания уха.

Рис. 4: CLA-абсцесс околоушного лимфатического узла у основания уха.

Рис. 5: CLA-абсцесс околоушного лимфатического узла у основания уха.

CLA характеризуется абсцессом поверхностных лимфатических узлов (околоушный лимфатический узел у этого барана).

Рис. 6: Лимфатические узлы имеют пластинчатый («луковое кольцо») вид, содержащий желто-зеленый вязкий гной с консистенцией, напоминающей зубную пасту.
Клиническая картина

CLA в Великобритании характеризуется абсцессом поверхностных лимфатических узлов, в частности околоушных (основание уха), поднижнечелюстных (под челюстью), подколенных (задняя лапа), предкрюральных (задняя конечность) и предлопаточных (передняя конечность) лимфатических узлов.Эту форму заболевания часто называют кожной или поверхностной формой CLA. Распространение инфекции на лимфатические узлы грудной клетки и внутренние органы, включая легкие, селезенку, почки и печень, составляет висцеральную или внутреннюю форму CLA. Овцы с поверхностной формой CLA могут проявлять клинические признаки болезни только тогда, когда увеличение абсцесса вызывает сжатие дыхательных путей.

Рис. 7: Распространение инфекции на лимфатические узлы грудной клетки — дальнейшего распространения не было, и эта инфекция не имела клинических признаков.

В Австралии срезанные раны приводят к инфицированию предлопаточных и предкрюральных лимфатических узлов, при этом менее 1 процента поражений поражают лимфатические узлы в области головы. Лимфатические узлы туши могут достигать 15 см в диаметре и характеризуются пластинчатым («луковое кольцо») видом пораженных лимфатических узлов, содержащих желто-зеленый вязкий гной с консистенцией, напоминающей зубную пасту. Напротив, CLA в Соединенном Королевстве характеризуется абсцессом околоушных и подчелюстных лимфатических узлов.

В США висцеральная форма CLA обычно ассоциируется с «синдромом тонкой овцы» с поражением легких, печени и почек. Менее распространенные участки — это позвоночник, вымя и мошонка. Большие поражения легких и средостения могут привести к одышке, и эта форма заболевания распространена в США, где пораженных овец называют «легкими». Распространение инфекции, вызывающей значительные поражения внутренних органов, в Великобритании не является обычным явлением.

Дифференциальные диагнозы

Окончательный диагноз кожной формы CLA должен также включать актинобациллез и туберкулез, а также образование местного абсцесса.

Рис. 8: Локальный абсцесс, не связанный с лимфатическим узлом (см. Ниже) — это не CLA.

Рис. 9: Локальный абсцесс, не связанный с лимфатическим узлом (см. Выше) — это не CLA.

Рис. 10: Подкожный абсцесс, не связанный с лимфатическим узлом.

Рис. 11: Вскрытие и дренирование вышеуказанного абсцесса ветеринаром.

Общие дифференциальные диагнозы висцеральной формы CLA, поражающей грудную клетку, включают хроническую гнойную пневмонию, абсцессы плевры или средостения и аденокарциному легких овцы (OPA, Jaagsiekte).

В более общем плане, частые причины хронической потери веса у взрослых овец включают ограниченное питание, плохие зубные ряды, хронический паразитизм, паратуберкулез (болезнь Джона), инфекцию, вызванную вирусом Мадивисна, хронические гнойные процессы и опухоли желудочно-кишечного тракта.

Диагностика

Положительный результат анализа крови указывает на контакт с организмом и может указывать на активную инфекцию, однако сильно ослабленные животные могут дать ложноотрицательный результат. Диагноз подтвержден посевом C.псевдотуберкулез .

Лечение

Несмотря на чувствительность C. pseudotuberculosis к ряду антибиотиков, терапия часто оказывается безуспешной из-за внутриклеточной локализации бактерий и фиброзной капсулы, окружающей очаги поражения. Прокалывание поражений приводит только к загрязнению окружающей среды, что увеличивает вероятность распространения болезни. Абсцессы часто рецидивируют после дренирования и промывания антисептиками.

Управление / Профилактика / Меры борьбы

Профилактика заболеваний в чистых стадах может поддерживаться эффективными мерами биозащиты.В таких программах необходимо тщательно учитывать роль стригущего оборудования и других средств обработки, таких как мобильные погружные ковши и кормушки, как переносчиков болезней. Тем не менее, риск заболевания наиболее высок у приобретенных животных, которые должны быть осмотрены перед покупкой и помещены в карантин не менее двух месяцев. По возможности, ремонтные племенные стада должны приобретаться из благополучных по болезням стада. В качестве альтернативы следует купить овец и провести анализ крови перед госпитализацией.

Рис. 12: Воспроизводящее маточное поголовье должно по возможности приобретаться из благополучных по болезням стада.

Рис. 13: Приобретенные животные — перед покупкой необходимо осмотреть и поместить в карантин не менее двух месяцев.

Коммерческие вакцины снизили заболеваемость CLA в стаде, но не предотвращают все новые инфекции и не излечивают уже инфицированных овец. Коммерческие вакцины используются во многих странах с высокой распространенностью CLA, таких как США и Австралия, но в настоящее время не во многих странах Европы.

В невакцинированных стадах всех серопозитивных животных необходимо отбраковывать и повторять тестирование до тех пор, пока болезнь не будет устранена.

Лимфаденит | Encyclopedia.com

Определение

Лимфаденит — это воспаление лимфатических узлов. Часто это осложнение бактериальных инфекций, хотя оно также может быть вызвано вирусами или другими возбудителями болезней. Лимфаденит может быть генерализованным, затрагивая несколько лимфатических узлов, или ограничиваться несколькими узлами в области локализованной инфекции. Лимфаденит иногда сопровождается лимфангитом — воспалением лимфатических сосудов, соединяющих лимфатические узлы.

Описание

Лимфатическая система — это сеть сосудов (каналов), узлов (желез) и органов. Это часть иммунной системы, которая защищает от инфекций, воспалений и рака и борется с ними. Лимфатическая система также участвует в транспортировке жидкостей, жиров, белков и других веществ по всему телу. Лимфатические узлы — это небольшие структуры, которые фильтруют лимфатическую жидкость и содержат много лейкоцитов для борьбы с инфекциями. Лимфаденит характеризуется увеличением лимфатических узлов, которые развиваются, когда железы поражаются бактериями, вирусами, грибками или другими организмами.Узлы могут быть болезненными и твердыми или мягкими и «эластичными», если образовался абсцесс. Кожа над воспаленным узлом может быть красной и горячей. Расположение пораженных узлов обычно связано с местом основной инфекции, воспаления или опухоли. В большинстве случаев возбудителями инфекции являются Streptococci или Staphylococci . Если лимфатические сосуды также инфицированы, в состоянии, называемом лимфангитом, от раны будут отходить красные полосы в направлении лимфатических узлов, пульсирующая боль и высокая температура и / или озноб.Ребенок обычно чувствует себя плохо с потерей аппетита, головной болью и болями в мышцах.

Обширная сеть лимфатических сосудов по всему телу и их связь с лимфой Узлы помогает объяснить, почему бактериальная инфекция узлов может быстро распространяться на другие части тела или из них. Лимфаденит у детей часто возникает в области шеи, потому что эти лимфатические узлы расположены близко к ушам и горлу, которые часто являются локализацией бактериальных инфекций у детей.

Лимфаденит также называют инфекцией лимфатических узлов, инфекцией лимфатических узлов или локальной лимфаденопатией.

Демография

Лимфаденит и лимфангит — частые осложнения бактериальных инфекций.

Причины и симптомы

Стрептококковые и стафилококковые бактерии являются наиболее частыми причинами лимфаденита, хотя вирусы, простейшие, риккетсии, грибы и туберкулезная палочка могут также инфицировать лимфатические узлы.Заболевания или расстройства, затрагивающие лимфатические узлы в определенных областях тела, включают кроличью лихорадку (туляремию), болезнь кошачьих царапин , венерическую лимфогранулему, шанкроид, генитальный герпес, инфицированные акне , зубные абсцессы и бубонную чуму. Лимфаденит также может возникать в сочетании с целлюлитом, который представляет собой глубокую широко распространенную инфекцию тканей, которая развивается из пореза или язвы. У детей тонзиллит или бактериальная ангина являются наиболее частыми причинами лимфаденита в области шеи.Заболевания, которые поражают лимфатические узлы по всему телу, включают мононуклеоз, цитомегаловирусную инфекцию , токсоплазмоз и бруцеллез.

Ранними симптомами лимфаденита являются отек узлов, вызванный скоплением тканевой жидкости, и повышенное количество лейкоцитов в результате реакции организма на инфекцию. Дальнейшее развитие включает лихорадку с ознобом, потерю аппетита, обильное потоотделение, учащенный пульс и общую слабость.

Диагноз

Физикальное обследование

Диагноз лимфаденита обычно основывается на сочетании истории болезни ребенка, внешних симптомов и лабораторных культур.Врач будет нажимать (пальпировать) пораженные лимфатические узлы, чтобы увидеть, болят ли они или нет, и ищет точку входа для инфекции, например, царапину или укус. Опухшие узлы без болезненности иногда возникают из-за болезни кошачьих царапин, которая встречается редко. У детей, если лимфаденит тяжелый или стойкий, врач может исключить паротит, , ВИЧ, опухоли в области шеи и врожденные кисты, напоминающие увеличенные лимфатические узлы.

Хотя лимфаденит обычно диагностируется в лимфатических узлах на шее, руках или ногах, он также может возникать в лимфатических узлах груди или живота.Если у ребенка резко увеличились лимфатические узлы в паху, врач должен исключить грыжу в паховой области, которая не сместилась (ущемленная паховая грыжа). Грыжи встречаются у 1 процента населения в целом; 85 процентов детей с грыжами — мужчины.

Лабораторные тесты

Наиболее важными тестами являются определение количества лейкоцитов (WBC) и посев крови для идентификации организма. Высокая доля незрелых лейкоцитов указывает на бактериальную инфекцию.Посев крови может быть положительным, чаще всего на стафилококк или стрептококк. В некоторых случаях врач может назначить биопсию лимфатического узла для выявления необычной инфекции или лимфомы.

Когда обращаться к врачу

Если у ребенка развиваются симптомы лимфаденита, его следует отвезти к врачу или в отделение неотложной помощи.

Лечение

Лекарства

Лекарства, назначаемые при лимфадените, различаются в зависимости от бактерии или вируса, которые его вызывают.При бактериальных инфекциях ребенок будет лечиться антибиотиками , обычно пенициллином, клиндамицином, цефалоспорином или эритромицином.

Поддерживающая терапия

Поддерживающая терапия лимфаденита включает отдых для пораженного участка и наложение горячих влажных компрессов для уменьшения воспаления и боли.

Хирургия

Целлюлит, связанный с лимфаденитом, не следует лечить хирургическим путем из-за риска распространения инфекции. Гной выводится только при абсцессе и обычно после того, как ребенок начал лечение антибиотиками.В некоторых случаях биопсия воспаленного лимфатического узла необходима, если диагноз не был поставлен и не было ответа на лечение.

Воспаление лимфатических узлов, вызванное другими заболеваниями, требует лечения первопричины.

Прогноз

Прогноз для выздоровления хороший, если ребенка своевременно лечить антибиотиками. В большинстве случаев инфекцию можно взять под контроль за три-четыре дня. Однако в некоторых случаях для исчезновения отека могут потребоваться недели или месяцы; продолжительность выздоровления зависит от первопричины инфекции.У детей с нелеченным лимфаденитом могут развиться абсцессы, целлюлит или заражение крови (сепсис), что иногда приводит к летальному исходу.

Профилактика

Профилактика лимфаденита зависит от своевременного лечения бактериальных и вирусных инфекций.

Проблемы родителей

Родители могут быть обеспокоены тем, что увеличенные лимфатические узлы у их ребенка являются злокачественными. Им следует немедленно обратиться за медицинской помощью к ребенку, чтобы своевременно решить проблему.

КЛЮЧЕВЫЕ ТЕРМИНЫ

Грыжа — Разрыв в стенке полости тела, через который может выступать орган.

Лимфатические узлы — Небольшие бобовидные скопления ткани, расположенные по всей лимфатической системе. Они производят клетки и белки, которые борются с инфекциями и фильтруют лимфу. Узлы иногда называют лимфатическими узлами.

Лимфангит -Inflammation лимфатических сосудов. Часто возникает вместе с лимфаденитом (воспалением лимфатических узлов).

Септицемия — системная инфекция, вызванная присутствием бактерий и их токсинов в кровотоке.Септицемию иногда называют заражением крови.

Streptococcus —Plural, стрептококков 924 10. Любой из нескольких видов сферических бактерий, образующих пары или цепочки. Они вызывают широкий спектр инфекций, включая скарлатину, тонзиллит и пневмонию.

Ресурсы

КНИГИ

Mandal, B., et al. Конспект лекций по инфекционным болезням. Оксфорд, Великобритания: Blackwell Publishing, 2004.

ВЕБ-САЙТЫ

Лимфаденит. Доступно в Интернете по адресу: .

Джудит Симс Ребекка Дж. Фрей, доктор философии.

Гейл Энциклопедия здоровья детей: от младенчества до подросткового возраста Sims, Джудит; Frey, Rebecca

казеозный лимфаденит

Пищеварительные признаки / анорексия, потеря или снижение аппетита, отсутствие кормления, отсутствие корма Овцы и козы | Все этапы Подписать
Пищеварительные признаки / диарея Овцы и козы | Все этапы Подписать
Пищеварительные признаки / дисфагия, затрудненное глотание Подписать
Общие признаки / непереносимость физических упражнений, легко утомляется Овцы и козы | Племенные самцы; Овцы и козы | Зрелая самка Подписать
Общие признаки / лихорадка, гипертермия, гипертермия Подписать
Общие признаки / лихорадка, гипертермия, гипертермия Подписать
Общие признаки / хромота, скованность передних конечностей, хромота передних конечностей Овцы и козы | Все этапы Подписать
Общие признаки / Отек передних конечностей, образование в суставе передней ноги и / или в несуставной области Подписать
Общие признаки / общая хромота или скованность, хромота Овцы и козы | Все этапы Подписать
Общие признаки / Общая слабость, парез, паралич Овцы и козы | Все этапы Подписать
Общие признаки / Голова, лицо, уши, челюсть, нос, нос, отек, образование Овцы и козы | Все этапы Подписать
Общие признаки / хромота, скованность, хромота задней конечности Овцы и козы | Все этапы Подписать
Общие признаки / Отек задних конечностей, масса в суставе задней ноги и / или в несуставной области Подписать
Общие признаки / Отек задних конечностей, образование в суставе задней ноги и / или в несуставной области Подписать
Общие признаки / Масса внутри живота, опухоль, спайки брюшной полости Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Hogget; Овцы и козы | Зрелая самка Подписать
Общие признаки / Отсутствие роста или прибавки в весе, задержка роста, задержка роста Овцы и козы | Все этапы Подписать
Общие признаки / Отек гортани, трахеи, глотки, масса гортани, трахеи, глотки Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Hogget; Овцы и козы | Зрелая самка Подписать
Общие признаки / лимфаденопатия, опухоль, масса или увеличенные лимфатические узлы Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Диагностика
Общие признаки / Набухание, масса молочной железы, гипертрофия вымени, гинекомастия Свиньи | Свиньи Подписать
Общие признаки / опухоль шеи, массивная шейная область Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Подписать
Общие признаки / парапарез, слабость, паралич обеих задних конечностей Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Hogget; Овцы и козы | Зрелая самка Подписать
Общие признаки / Внезапная смерть, найден мертвым Овцы и козы | Все этапы Подписать
Общие признаки / Отек кожи или подкожный, новообразование, шишка, узелок Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Hogget; Овцы и козы | Зрелая самка Подписать
Общие признаки / опухоль, образование наружной брюшной полости Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Подписать
Общие признаки / опухоль грудной клетки, масса, грудная клетка, грудная клетка, ребра, грудина Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Подписать
Общие признаки / Недостаточный вес, плохое состояние, худощавость, истощение, беспечность, плохая бережливость Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Hogget; Овцы и козы | Зрелая самка Диагностика
Общие признаки / потеря веса Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Подписать
Нервные признаки / вялость, депрессия, вялость, депрессия, вялость, апатия Овцы и козы | Все этапы Подписать
Признаки боли / дискомфорта / Боль в передних конечностях, передняя нога Подписать
Признаки боли / дискомфорта / Боль в задних конечностях, задних конечностях Подписать
Признаки боли / дискомфорта / Боль в молочной железе, вымени Подписать
Признаки боли / дискомфорта / Кожная боль Подписать
Признаки боли / дискомфорта / Кожная боль Подписать
Репродуктивные признаки / аборт или слабые новорожденные, мертворождение Овцы и козы | Зрелая самка Подписать
Репродуктивные признаки / агалактия, снижение, отсутствие молочной продуктивности Овцы и козы | Зрелая самка Подписать
Репродуктивные признаки / анэструс, отсутствие репродуктивного цикла, отсутствие видимой течки Свиньи | Позолота; Свиньи | Свинья Подписать
Репродуктивные признаки / Женское бесплодие, повторный заводчик Овцы и козы | Гиммер; Овцы и козы | Зрелая самка Подписать
Репродуктивные признаки / твердые молочные железы, твердое вымя Подписать
Репродуктивные признаки / мастит, ненормальное молоко Овцы и козы | Зрелая самка Подписать
Репродуктивные признаки / Теплая молочная железа, горячая, горячая, вымя Подписать
Респираторные признаки / ненормальные звуки дыхания в верхних дыхательных путях, обструкция дыхательных путей, стимулятор, храп Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Подписать
Респираторные признаки / аномальные звуки легких или плевры, хрипы, хрипы, хрипы, трение от трения Подписать
Респираторные признаки / кашель, кашель Овцы и козы | Все этапы Подписать
Респираторные признаки / тупые участки при перкуссии грудной клетки, грудной клетки Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Подписать
Респираторные признаки / одышка, затрудненное дыхание с открытым ртом, кряхтение, затрудненное дыхание Подписать
Респираторные признаки / одышка, затрудненное дыхание с открытым ртом, кряхтение, затрудненное дыхание Подписать
Респираторные признаки / учащенное дыхание, полипноэ, тахипноэ, гиперпноэ Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Hogget; Овцы и козы | Зрелая самка Подписать
Кожа / Покровные признаки / Алопеция, истончение, выпадение, легко эпиляция, выпадение волос Подписать
Кожа / Покровные признаки / Неприятный запах кожи, запах Подписать
Кожа / Покровные признаки / Гиперкератоз, толстая кожа Подписать
Кожа / Покровные признаки / Влажная кожа, волосы или перья Подписать
Кожа / Покровные признаки / Влажная кожа, волосы или перья Подписать
Кожа / Покровные признаки / Кожные гнойные выделения Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Диагностика
Кожа / Покровные признаки / Шерсть грубая, тусклая, стоит дыбом Овцы и козы | Все этапы Подписать
Кожа / Покровные признаки / Кожные корки, струпья Подписать
Кожа / покровные признаки / отек кожи Подписать
Кожа / Покровные признаки / Кожная эритема, воспаление, покраснение Подписать
Кожа / Покровные признаки / Кожная эритема, воспаление, покраснение Подписать
Кожа / Покровные признаки / Кожный свищ, синус Овцы и козы | Племенные самцы; Овцы и козы | Гиммер; Овцы и козы | Хоггет; Овцы и козы | Зрелая самка Диагностика
Кожа / покровные признаки / Некроз кожи, шелушение, гангрена Подписать
Кожа / Покровные признаки / Кожные папулы Подписать
Кожа / Покровные признаки / Кожные пустулы Подписать
Кожа / покровные признаки / Кожная язва, эрозия, раздражение Подписать
Кожа / покровные признаки / Кожная язва, эрозия, раздражение Подписать

Педиатрические пути

УПРАВЛЕНИЕ

Легкая инфекция — лечите пероральными антибиотиками в соответствии с местными / национальными рекомендациями.

Выбор орального Abx в соответствии с местными / национальными рекомендациями
Общая продолжительность лечения = 7 дней
Предоставьте устную и письменную информацию о страховочной сетке

При легкой инфекции рассмотрите IVAbx, если:

  • Устный Abx не переносится / всасывается
  • Нет улучшений, несмотря на ≥48 часов адекватного перорального Abx (проверьте дозу и соблюдение режима).Может потребоваться разрез и дренаж — рассмотрите УЗИ.
  • Значительная иммуносупрессия

Выбор антибиотика в соответствии с местными эмпирическими рекомендациями по антибиотикам

УПРАВЛЕНИЕ

УМЕРЕННАЯ инфекция — сначала лечите с помощью IVAbx в соответствии с местными эмпирическими рекомендациями по применению антибиотиков. Если клиническое ухудшение, несмотря на 24-часовой IVAbx или сохраняющуюся лихорадку / нет клинического улучшения, несмотря на 48-часовой IVAbx, срочно назначьте УЗИ.В случае сбора, осмотрите ЛОР и рассмотрите возможность разреза и дренирования. Консервативное лечение может быть рассмотрено для детей с небольшими коллекциями (<2,2 см), если нет признаков опасности. 1,2
При появлении «красных флажков» необходимо срочно осмотреть ЛОР и рассмотреть срочную компьютерную томографию шеи. 2 Перед визуализацией убедитесь в безопасности дыхательных путей.

Рассмотрите возможность амбулаторного лечения 4 на IVAbx от отделения ED / оценки (избежание госпитализации), если:

Обеспечьте наличие надежных систем клинического руководства и документации для детей, передвигающихся передвижением
Требуется ежедневная проверка и предоставьте устную и письменную информацию о безопасности
IV на устное переключение, когда:

  • Клинически улучшается + — улучшается маркеры воспаления
  • Апирексиальный
  • Если исходный контроль (I + D), то рекомендуется переход с раннего IV на оральный.
  • Выбор орального Abx в соответствии с местными / национальными правилами. Общая продолжительность лечения (в / в + перорально) = 7 дней

Если клинически ухудшается или остается гипертермия, несмотря на антибиотики, примите во внимание:

  • Глубокая инфекция, требующая контроля источника; Обзор ЛОР + — визуализация (USS)
  • Устойчивый организм — проверьте факторы риска и результаты микробиологии
  • Неинфекционная патология или необычная инфекция (учитывать различия)
  • Обратитесь за удостоверением личности / микроконсультацией при сложной инфекции

УПРАВЛЕНИЕ

ТЯЖЕЛАЯ инфекция — начните IVAbx в соответствии с местными / национальными рекомендациями

  • Срочная ЛОР-проверка и рассмотрение системы управления источниками (оперативное управление)
  • Если дыхательные пути нарушены из-за отека, примите экстренные меры, чтобы обезопасить их.
  • При наличии признаков заболевания, опосредованного токсинами, рассмотрите возможность добавления антибиотика-антитоксина (т.е. клиндамицин) и нижний порог для срочного дренирования (контроль источника).

Бактериальный лимфаденит в крупной специализированной больнице во Франции с 2008 по 2012 год

ВВЕДЕНИЕ

Увеличенные лимфатические узлы — частый симптом ряда инфекционных, аутоиммунных и злокачественных заболеваний (1). Клинические симптомы часто схожи или неспецифичны, и несколько этиологических агентов могут быть ответственны за увеличение лимфатических узлов (1). Разнообразные бактериальные, вирусные, грибковые и протозойные агенты могут служить в качестве координационного центра для последующего клинического исследования (2).Bartonella henselae, основной возбудитель болезни кошачьих царапин (CSD), является наиболее частым возбудителем инфекционной лимфаденопатии у взрослых и детей (2, 3). CSD является сезонным заболеванием (4), и недавно живые B. henselae были обнаружены в местах первичной прививки пациентов после кошачьей царапины (5). Микобактерии обычно вызывают лимфаденопатию, а на периферический туберкулезный лимфаденит приходится примерно 10% случаев туберкулеза в США (6). Заболеваемость лимфаденитом, вызванным нетуберкулезными микобактериями, в последние десятилетия увеличилась, в первую очередь у детей (7).Staphylococcus aureus и Streptococcus pyogenes являются причиной примерно от 40 до 80% случаев острого одностороннего шейного лимфаденита у детей (8). Francisella tularensis, возбудитель туляремии, и Tropheryma whipplei, возбудитель болезни Уиппла, являются менее распространенными источниками инфекционной лимфаденопатии (2, 3). Образцы эксцизионной биопсии обычно выполняются для получения материала лимфатических узлов для соответствующих лабораторных и гистологических исследований. обследование, и такие образцы биопсии обычно требуются для окончательного диагноза (9).Посевы обычно заказываются на биоптатах лимфатических узлов, но у этого метода есть общепризнанные ограничения. Более того, некоторые этиологические агенты нелегко выделить с помощью обычных методов и требуют специализированных систем культивирования клеток. Недавно мы предложили молекулярную стратегию, основанную на количественной ПЦР в реальном времени (КПЦР) для обнаружения наиболее часто встречающихся возбудителей инфекционной лимфаденопатии (3). Этот анализ кПЦР значительно более чувствителен, чем ПЦР-амплификация и секвенирование гена 16S рРНК для обнаружения B.henselae, F. tularensis и микобактерии (3). ПЦР гена 16S рРНК по-прежнему важна для обнаружения других новых или появляющихся бактериальных агентов (10). В этом исследовании мы проанализировали большую коллекцию лимфатических узлов с помощью молекулярных методов и бактериальных культур. Наша цель состояла в том, чтобы оценить полезную стратегию диагностики инфекционного лимфаденита.

ОБСУЖДЕНИЕ

В этом обширном исследовании лимфатических узлов мы использовали молекулярные анализы и культуры для диагностики инфекционного лимфаденита.Кроме того, лимфатические узлы были проверены гистологическим анализом, когда это было возможно. Все наши молекулярные и культуральные анализы были ранее оценены (3, 11, 16, 17). Кроме того, мы обычно включаем множество отрицательных и положительных контролей в каждый анализ, а качество экстракции ДНК проверялось для всех образцов. Однако ограничением нашего исследования было то, что мы не тестировали на грибки или вирусы, которые также могут представлять причины увеличения лимфатических узлов. Более того, мы не получили гистологические данные для всех пациентов, потому что большинство образцов, отправленных в наш центр, были замороженными или слишком маленькими.В нашей серии лимфатических узлов новообразования составляли 7% случаев подозрения на CSD. Однако этот процент может быть выше, поскольку мы проверили только 24% лимфатических узлов с помощью гистологического анализа. Кроме того, ограничением было то, что мы могли анализировать наши результаты по тому, была ли получена часть или весь лимфатический узел, так как весь лимфатический узел с большей вероятностью будет давать возбудитель. лимфатические узлы — самые крупные из описанных на сегодняшний день (Таблица 5). Однако сравнение исследований затруднено, и следует учитывать контекст лабораторных предубеждений, эпох и различных популяций пациентов, присущих каждому конкретному исследованию.В нашем исследовании B. henselae был обнаружен в основном у более молодых пациентов и был наиболее частой причиной инфекционного лимфаденита. Наши результаты подтвердили предыдущие исследования нашей лаборатории (2, 3). Предвзятость в нашем исследовании заключается в том, что наша лаборатория является справочным центром по ку-лихорадке, риккетсиозу и бартонеллезу. Это было причиной того, что все лимфатические узлы были оценены с помощью кПЦР специально на B. henselae, F. tularensis, T. whipplei и C. burnetii. Более того, более высокий процент положительных результатов B. henselae в наших исследованиях объясняется тем, что образцы были взяты у пациентов с подозрением на CSD.Аналогичным образом Ridder et al. обнаружили B. henselae как наиболее частую причину инфекционного лимфаденита у пациентов с неясными новообразованиями в голове и шее (20). До открытия B. henselae, что объясняет его отсутствие в исследованиях в 1980-х годах (2) и в эпоху молекулярных анализов, Mycobacterium spp. был наиболее частой причиной инфекционного лимфаденита (21–23). В нашем исследовании M. tuberculosis был третьим по частоте возбудителем инфекционного лимфаденита после S. aureus. Аналогичный процент для M.туберкулез сообщил Добернек (21). Напротив, Anthony et al. (22) и Freidig et al. (24) обнаружили более низкий процент M. tuberculosis. Кроме того, Росадо и др. (25) обнаружили два случая лимфаденита Yersinia разновидностей в паховом и брыжеечном лимфатических узлах.

ТАБЛИЦА 5

ТАБЛИЦА 5 Предыдущие исследования бактериального лимфаденита 931 .tuberculosis (6) 93 93 93 Инфекция, вызванная микобактериями был выявлен в 11% положительных лимфатических узлов.По сравнению с нашим предыдущим исследованием (2), мы обнаружили больше микобактериальных агентов, скорее всего, потому, что в настоящее время лимфатические узлы регулярно культивируются независимо от предполагаемого диагноза. КПЦР была лучше для диагностики микобактериальной инфекции, чем амплификация гена rrs . Однако наши молекулярные анализы были менее эффективны по сравнению с культурой для диагностики микобактериальной инфекции. Несмотря на длительное время инкубации, необходимое для выделения штаммов микобактерий, культивирование по-прежнему имеет решающее значение, поскольку оно обеспечивает лучшую чувствительность для обнаружения этих агентов.Для повышения чувствительности диагностики микобактериального лимфаденита было предложено сочетание различных процедур с разной чувствительностью (6). В нашем исследовании мы объединили молекулярные анализы с посевом, и на основе этих результатов мы попытаемся разработать более эффективный новый анализ количественной ПЦР специально для обнаружения микобактерий. Причиной инфекционного аденита были быстрые организмы, и мы обнаружили что количественная ПЦР была референтным анализом для диагностики этих агентов.Амплификация и секвенирование rrs были менее эффективными для обнаружения B. henselae и F. tularensis, чем специфическая кПЦР, тогда как частота обнаружения T. whipplei была низкой. Культура оказалась неэффективной для диагностики требовательных организмов, поскольку их выделение часто затруднено и зависит от количества микроорганизмов в клетках, которое должно быть как можно большим, и от стадии центрифугирования, которая усиливает адгезию высвобождаемых бактерий. от их внутриклеточного положения в клетках в культуре (26).В предыдущих исследованиях мы наблюдали бактерии путем прямой иммунофлуоресценции во многих лимфатических узлах, которые были отрицательными при культивировании, что позволяет предположить, что бактерии в лимфатических узлах нежизнеспособны (12). Более того, в нашей ранее опубликованной серии лимфатических узлов мы обнаружили очень низкий уровень изоляции B. henselae от лимфатических узлов (2). Основываясь на этих результатах, мы обычно не культивируем лимфатические узлы, положительные на B. henselae. Выделение требовательных организмов из образцов по-прежнему имеет решающее значение для описания новых видов, что позволяет проводить генетические описания, физиологические анализы, совершенствовать диагностические инструменты и определять чувствительность бактерий к антибиотикам (11, 27).Гистологический анализ лимфатических узлов имеет решающее значение, поскольку мы обнаружили четыре лимфатических узла с CSD и злокачественными новообразованиями. Риддер и др. также сообщили о 2 случаях плоскоклеточного рака и 2 случаях злокачественной В-клеточной лимфомы у пациентов с высокими титрами антител к B. henselae (20). В этом обширном исследовании лимфатических узлов мы показали, что анализ лимфатических узлов комбинацией rrs ПЦР-амплификация и секвенирование с использованием специфической количественной ПЦР и посева имеют решающее значение для диагностики бактериального лимфаденита.Стафилококки, стрептококки и другие аэробные и анаэробные бактерии были обнаружены как возбудители инфекционного аденита. rrs ПЦР остается критически важным для обнаружения этих бактерий (10). Хотя эффективность ПЦР rrs для обнаружения неприхотливых агентов варьировала и зависела от вида бактерий, не было обнаружено значительных различий между культурой и ПЦР rrs . Чтобы повысить чувствительность посева, образцы биопсии лимфатических узлов должны быть взяты перед лечением на ранней стадии заболевания и должны быть засеяны как можно скорее.Однако мы не можем предоставить данные о лечении пациента во время биопсии лимфатического узла.

Врачи должны знать, что в случае отрицательного результата ПЦР rrs не исключено инфицирование привередливыми организмами и микобактериями, учитывая низкую чувствительность эубактериальной ПЦР. Инфекция CSD и M. avium чаще встречается у молодых пациентов, тогда как пациенты с M. tuberculosis значительно старше. Более того, мы подчеркнули необходимость того, чтобы удаление лимфатических узлов и гистологический анализ имели решающее значение для точной диагностики, поскольку новообразования могут быть клинически ошибочно диагностированы как CSD, когда используются только молекулярные анализы.

Добавить комментарий

Ваш адрес email не будет опубликован.

© 2019 - Правила здоровья и долголетия
Автор (год) (ссылка) Количество пациентов Используемый метод диагностики Обычно выявляемые возбудители инфекционного лимфаденита (% положительных случаев) a
Культура ПЦР 1-й агент 2-й агент 3-й агент 4-й агент
Добернек (1983) (1983) (21) 16940 S. aureus (4) ND ND
Anthony et al. (1983) (22) 228 M. tuberculosis (3) B. henselae (1) T. gondii (0,4) ND
Roberts et al. (1984) (23) 163 Да Нет Микобактерии (17) S. epidermidis S. viridans P. acnes
Freidig et al.(1986) (24) 419 Да Нет Histoplasma capsulatum (4) M. tuberculosis (3) M. avium complex (2) M. kansasii (0,7)
Ridder et al. (2002) (20) 454 Да Да B. henselae (13) S. pyogenes (2) S. aureus (1) M. tuberculosis (1)
Chau et al. (2003) (30) 423 Да Нет Т.gondii (4) M. tuberculosis (3) B. henselae (0,7) Стрептококки (0,5)
Rolain et al. (2006) (2) 786 Да Да B. henselae (31) Микобактерии (7) Коагулазонегативные стафилококки (3) S. aureus (2) 93 Angelakis et al. (2009) (3) 491 Нет Да B. henselae (30) S. aureus (4) F.tularensis (3) M. tuberculosis (1)
Rosado et al. (2011) (25) 368 Да Да Комплекс M. avium (60) B. henselae (20) Иерсиниоз (7) F. tularensis (3)
Это исследование 1,688 Да Да B. henselae (33) S. aureus (7) Коагулазонегативные стафилококки (7) M. tuberculosis (7)