Кудин чай полезные: польза и вред, советы врачей, как заваривать и пить чай

Содержание

Чай Кудин и его свойства

Чай «Кудин» — это одна из разновидностей зеленого китайского чая, получаемая из широколистного падуба, реже из бирючины. Листья данных растений имеют толстый черешок, рубцевидные края, а также достигают до 4 сантиметров в длину и 4 миллиметров в толщину. Если переводить название чая с китайского, то оно будет звучать как «кхудин» — «горький чай». Добывается данный чай в южных провинциях Китая. После периода обработки листья «Кудина» бывают следующих видов: листовые, спиральные, связанные, скрученные и прессованные. Чаем, обладающим наилучшим качеством и большим количеством полезных свойств, является «Кудин Шой Су», который производится из крошечных листочков. В 1997 году на международной выставке чаев в Китае данный чай выиграл золотую медаль в номинации «Лечебный чай».

История чая

Происхождение чая основывается на одной китайской легенде и начинается примерно в 770 году, во время правления Тан Тянбао. В это время император издает указ о сборе всех способов омоложения организма для продления молодости своей любимой жены, красавицы Ян Гойфей. Помощник императора Ян Гоаньтин в одном из монастырей на Сыконашни нашел рецепт под названием «вечная весна». Суть данного рецепта заключалась в омолаживающих свойствах напитка «Кудин». По этому рецепту изготовил чай один монах, который обладал секретами исцеления на основе трав. Он и подарил Яну Гоаньти бочонок этого удивительного чая. После этого чай был передан Ян Гойфей. Жена могущественного властелина по достоинству оценила удивительные свойства чая и наградила помощника императора. В 1368 году, при правлении династии Мин, данному чаю был придан статус придворного средства. После этого чай «Кудин» стал популярным народным средством в восточных странах. И вот уже более одного тысячелетия данный чай используется в народной медицине за счет своих целебных свойств.

Чай «Кудин»: свойства

Данный напиток обладает огромным витаминно-минеральным комплексом, который оказывает положительное влияние на организм человека. «Кудин» содержит множество аминокислот, богат железом, кальцием, магнием, калием, витамином С, витамином В1, цинком, марганцем, селеном, медью и множеством других витаминов. Чай «Кудин» обладает жаропонижающим, антисептическим, противовоспалительным, тонизирующим, детоксикационным и мочегонным свойствами. Его используют для понижения артериального давления, нормализации уровня сахара в крови, усиления ферментации печени, снижения холестерина в крови, повышения мужской потенции и улучшения зрения. Кудин является хорошим средством при простудных и вирусных заболеваниях, его употребляют для улучшения пищеварительного процесса и снятия похмельного синдрома.

Чай «Кудин»: противопоказания

Если человек страдает какими-либо заболеваниями, то перед употреблением данного зеленого чая ему лучше посоветоваться со своим лечащим врачом. «Кудин» не следует принимать людям, у которых есть проблемы с желудочно-кишечным трактом, такие как язва желудка, гастрит или заболевания двенадцатиперстной кишки, так как он может вызвать боль в желудке, кишечные колики или способствовать образованию изжоги. Помимо этого, ученые выдвинули теорию, что зеленый чай сбивает ритм работы сердца, поэтому следует воздержаться от принятия «Кудина» людям с сердечно-сосудистыми заболеваниями во избежание серьезных последствий. От чрезмерного употребления чая «Кудин» лучше воздержаться людям с заболеваниями, которые связаны с щитовидной железой, и гипертоникам, потому что он может оказать на них отрицательное воздействие и вызвать ухудшение имеющихся заболеваний.

Как заваривать и пить «Кудин»

Чтобы заварить китайский чай «Кудин», используется кипяченая вода температурой примерно 50 градусов по Цельсию, если же вода будет горячее, то напиток получится более горьким. На 250 миллилитров воды берется 5 грамм — примерно одна чайная ложка «Кудина». Заваривать чай можно в обычном заварнике. Первая заварка сливается примерно через 5 секунд после наполнения, потому что она необходима для раскрытия листьев Кудина и передачи аромата чая. Вторая заварка длится около 1 минуты, после чего чай следует перелить в отдельную посуду для употребления. Данный чай можно заваривать до четырех раз, но каждую последующую заварку необходимо увеличивать на одну минуту. Кудин употребляют как в горячем, так и в холодном виде. Не стоит заедать «Кудин» какими либо закусками и добавлять в него сахар или сливки, но для обогащения чая витаминами и полезными свойствами можно добавить немного меда. Чай «Кудин» употребляется в чистом виде, и его используют как лечебное средство.

Аромат и вкус чая

При правильном заваривании «Кудин» дает светло-зеленый цвет настоя и утонченный сладко-травяной аромат китайских плантаций. Чай обладает горьким и густым специфическим вкусом, и оставляет сладкое экстравагантное послевкусие.

Волшебный Кудин: полезные свойства травяного чая

Красота Востока > Новости и статьи > Волшебный Кудин

Китайский травяной чай Кудин именно тот напиток, который пьют не столько для того, чтобы утолить жажду, сколько получить заряд полезных витаминов и макро-элементов, которые в свою очередь помогают круглый год держать тело в тонусе, а иммунную систему сильной и непроницаемой для болезней.

Особенный Кудин

Полезные свойства Кудина знакомы китайским врачевателям и мудрецам более двух тысяч лет. Сегодня о пользе этого травяного чая знает и современная наука, которая подробно изучила это растение. Горький на вкус, он богат витаминами почти всех типов, от С до PP, а также содержит так необходимый нашему организму калий, кремень и марганец, которые сложно получить из повседневной пищи. Многие знатоки травяных чаев небезосновательно считают Кудин лучшим напитком для укрепления здоровья, известных человечеству.

Интересный факт: Кудин — это не чай, а лист растения «падуб широколистный». К чайному кусту Кудин не имеет никакого отношения, но традиционно многие называют его чаем.

Откуда берется Кудин?

Падуб широколистный, он же Кудин — это листы экзотического растения, который часто можно встретить в разных уголках Китая. Низкое приземистое дерево с характерными широкими листьями культивируют в провинции Сычуань, у подножий Желтой горы. По мнению самих китайцев, самый лучший Кудин собирается именно там по двум причинам. Во-первых, этот регион отличается хорошей экологией, во-вторых, в народе ходят легенды о том что именно в провинции Сычуань сосредоточена сила земли. Часто можно услышать альтернативное название Кудина — «Горькая Слеза». Вкус напитка действительно горьковат, однако это только добавляет его аромату изюминки.

Полезные свойства Кудина

Уникальный состав напитка помогает человеку от множества болезней. Его пьют и для профилактики, и во время заболевания, чтобы помочь своему телу быстрее победить болезнь. Доказано, что Кудин помогает при:

  • простуде;
  • гипертонии;
  • проблем с желудком и кишечником;
  • заболеваниях сердца и сосудов;
  • отравлении пищей.

Наконец, для многих он становится ежедневным помощником в похудении, понижении уровня сахара в крови, укреплении иммунитета после заболевания. Для людей старшего возраста Кудин рекомендуем еще и потому, что замедляет процессы старения мозга, связанных с возрастом. Одним словом, ценность Кудина сложно переоценить.

Купить Кудин и другие травяные чаи вы можете в нашем чайном доме «Красота Востока». Будьте здоровы!

Лечебные и другие полезные свойства чая Кудин

Содержание:
  1. История целебного напитка
  2. Кладезь полезных свойств
  3. Вкус лечебного настоя
  4. Из чего получается полезный чай
  5. Видео как правильно заваривать чай кудин

История целебного напитка

Во всем мире знают знаменитый лечебный чай Кудин, что означает «горькая трава». Впервые о нем упоминается в манускриптах около 4000 лет назад и с тех самых пор этот чай считается лекарством от всех болезней.

Особые свойства чая Кудин применяются для лечения и профилактики большинства заболеваний, а ферменты калия в этом напитке служат отличной поддержкой для сердца.

Из этого становится понятно, что такой напиток не следует пить каждый день. Его, как лекарственное средство, желательно употреблять маленькими дозами.

О целебных свойствах чая слагали легенды. Китайские врачи рекомендуют его, как средство, которое:

  1. противодействует образованию раковых опухолей,
  2. снижает воздействие радиации,
  3. повышает остроту зрения,
  4. а также способствует выводу холестерина.

Зная все эти свойства чая, древние врачеватели применяли его, как профилактическое средство.

Кладезь полезных свойств

Кудин нельзя назвать стопроцентным чаем из-за его целебных свойств, хотя заваривается он так же, да и внешним видом напоминает чайные листки. Его полезные свойства до конца еще не изучены и, именно поэтому его может рассматриваться как медицинский препарат.

Кудин обладает хорошим тонизирующим и бодрящим эффектом, однако заменять им кофе по утрам не рекомендуют.

Пить его следует не более трех раз в неделю для поддержания углеводного и липидного баланса.

К полезным свойствам данного напитка можно отнести:

  • жаропонижающее;
  • бактерицидное;
  • противовоспалительное;
  • средство, улучшающее пищеварение;
  • средство, понижающее уровень липидов в крови, а также холестерина;

Настой из Кудина очень эффективен во время простуд и вирусных заболеваний, отличается своим мочегонным эффектом при выводе вредных токсичных веществ. Теплый настой этого великолепного напитка, помогает снижению уровня сахара в крови и нормализует артериальное давление.

Обладая лекарственными свойствами, этот чай все-таки не лекарство, хотя испытание временем давно прошел и многими китайскими врачами назначается вместо таблеток во время простуды или гриппа.

Вкус лечебного настоя

Кудин имеет довольно таки своеобразный вкус, ярко выраженный горьковатый привкус, переходящий в легкую приятную сладость. Если забыть о его целебных свойствах, то с уверенностью можно сказать, что пить его можно и для удовольствия.

Представьте, что вы хотите удивить своих друзей чайной церемонией, какой чай можно заварить для этого случая? Конечно Кудин!

Необыкновенный напиток порадует их, а о положительных свойствах этого чая, вы расскажите во время чаепития. Настой целебного напитка получается совершенно прозрачным и красивым на вид.

Слегка терпкий аромат возбуждает фантазии экзотического плана и открывает перед вами качественно новый напиток, с загадочным вкусом.

Он несет в себе источник крепкого здоровья и эффект тонизирующего настроения.

Из чего получается полезный чай

Этот чай собирают из листьев Падуба широколистного. В обычном понимании назвать его чаем сложно, но способ приготовления напитка такой же. Он не может заменить чай, это что-то совершенно другое.

Существует несколько разновидностей Кудина и отличаются они друг от друга по виду сложенного листочка и бывает:

  • спиральный,
  • листовой,
  • скрученный,
  • связанный и
  • прессованный.

Употребляют его, чтобы укрепить иммунитет. Он прекрасно адсорбирует токсины и жиры, отлично выводит антиоксиданты и обладает бактерицидными свойствами, очищает печень и почки, нормализует давление. Настой Кудина прекрасно утоляет жажду, придает организму бодрости и поднимает настроение! Этот чай считается в Китае эликсиром молодости и долголетия!

Если сейчас перед вами стоит вопрос, стоит ли пить чай Кудин, то ответ однозначный: стоит!

Ваше здоровье в ваших руках!

Требуется включить JavaScript или обновить плеер!


Просмотров: 7441

Чай кудин — свойства, противопоказания. Кудин чай -особенности, полезные свойства и противопоказания

Каждая выпитая чашка чая разоряет аптекаря.
Китайская пословица

Чай кудин — необычный элитный вид чая, за особый терпкий вкус, называемый в народе «Горькая слеза». На самом деле, ошибочно называть кудин чаем, так как фактически его готовят не из чайных листьев, а из листочков широколиственного падуба.

Что это такое? Падуб – это вечнозелёное экзотическое дерево, произрастающее в тропических и умеренных широтах. Различают два основных вида падубов: широколиственный, из его плотно скрученных листочков готовят кудин, и парагвайский, из него изготавливают чаеподобный напиток под названием «мате», польза которого до сих пор дискутируется).

В связи, с неприхотливостью падуба чай кудин изготавливают во всём Китае. Сбор листьев осуществляют вручную, предотвращая вред механически грубой техники, тщательно отобранные листья подвергаются традиционной механической и термической обработке.

Историческая справка

В Китае существует множество легенд и преданий, посвящённых дереву падуб и чаю кудин. Как гласит одна из них, человечество узнало о прекрасном напитке во времена правления императора Он хотел преподнести своей избраннице дар вечной молодости, поэтому повелел своим подданным собрать самые действенные рецепты омоложения.

Один из подданных случайно оказался в монастыре, настоятель которого поведал ему об удивительном напитке, обладающем целебной силой и сохраняющем молодость. Монах предоставил целый бочонок чая кудин в подарок императору. А его избранница Ян Гуйфей, сделав глоток замечательного напитка, стала ещё красивее и расцвела как цветок сакуры по весне.

Сходства с зелёным чаем

Как уже говорилось, кудин нельзя называть чаем в полном смысле этого слова, так как листья для его изготовления собирают не с чайных кустов, а с дерева падуб. Но в методах сбора, обработки и заваривания два этих напитка крайне похожи.

Во-первых, сбор листьев для обоих напитков осуществляется только вручную. Во-вторых, после сбора, листочки подвергают скручиванию и высушивают в естественных лучах солнца, предотвращая вред парового воздействия.

И, в-третьих, сходства прослеживаются и в методике заваривания: сухие листья заливают горячей и водой и настаивают.

Вкус напитка кудин зависит от температуры воды: чем она выше, тем более ярко проявляется горький оттенок.

Разновидности чая

В Китае производят чай кудин нескольких сортов, отличающихся «возрастом» листочков, которые используют в виде сырья, и методом обработки. Элитным считается чай Сю, производимый из совсем молоденьких листов, собранных в провинции Сычуань. Специалисты в области чая утверждают, что такой метод позволяет сделать напиток более нежным и ароматным. Наиболее распространённые виды чая кудин:

  • спиральный;
  • скрученный;
  • прессованный;
  • связанный;
  • листовой.

Есть мнение, что молодые листья легче отдают свой вкус и крепость воде, поэтому их ценность намного выше. А большие листья медленнее отдают вкус, поэтому их хватает на несколько циклов заваривания.

Польза и вред «Горькой слезы»

Падуб можно поистине назвать кладезем полезных веществ. В его состав входит целый комплекс витаминов (группы В, А, Е, РР, С) и микроэлементов (калий, магний, сера, кремний, марганец). Помимо всего этого, чай кудин содержит флавоноиды, активизирующие ферментные системы организма.

Баснословная польза напитка из листьев падуба заключается в сбалансированном содержании стимулирующих веществ, что благоприятно влияет на репродуктивную систему женщин и мужчин, повышая эректильную функцию у мужчин и возбудимость женщин.

Чай кудин издревле применялся в императорских спальнях как средство соблазнения, а также с целью демонстрации силы и могущества владыки.

Но полезные свойства кудина на этом не заканчиваются. Мультивитаминный комплекс, входящий в его состав, обладает ценнейшим антиоксидантным эффектом, за счёт ингибирования действия свободных радикалов.

Основные полезные свойства напитка описаны ещё в древних манускриптах, хранящихся в Дуньхуане:

  1. Листья падуба, заваренные и настоянные, обладают способностью повышать иммунитет, поэтому кудин часто используется в профилактике и при лечении инфекционных и простудных заболеваний, а также у ослабленных пациентов.
  2. Чай кудин оказывает противотоксическое действие, устраняя вред накопленных продуктов обмена, таким образом, улучшает деятельность печени и почек – органов, выводящих вредные вещества.
  3. У пациентов с хроническими заболеваниями органов пищеварения кудин применяется с целью локализации и снижения воспалительного процесса.
  4. При ежедневном приёме чай кудин обладает способностью снижать аппетит, поэтому часто используется в народной медицине для снижения веса.
  5. Кудин разжижает кровь, обеспечивая снижение тромбообразования, а также снижает артериальное давление за счёт снятия спазма сосудов.

Методика заваривания

Способ 1

Важно соблюдать температурный режим, при заваривании кудина, так как при повышении температуры усиливается горечь напитка. Для заваривания необходимо использовать чистую свежую воду, желательно из природных источников. Доведя воду до кипения, необходимо убрать котелок илизаварничек с огня. Как ранее говорилось, при использовании крутого кипятка напиток получается излишне горький.

Следует слить первую заварку (она необходима для промывания листьев и удаления пыли). После этого в горячую воду добавляю две — три палочки, спирали или веретена (в зависимости от вида обработки), кипятят в течение 10 секунд и снимают с огня. Некоторые предпочитают сразу разливать заварку, не дожидаясь её настаивания, таким образом устраняется горечь и сохраняется польза напитка.

Способ 2

Промывают и размачивают в холодной воде две — три палочки кудина, после чего заливают горячей водой. Дают настояться напитку несколько минут и разливают по чашкам.

Необходимо быть готовым к тому, что кудин обладает выраженным горьким оттенком, но правильно его заварив, вы сможете смягчить вкус, не нанеся при этом вред полезным качествам напитка. Есть ряд правил, которые необходимо соблюдать, чтобы польза этого лекарственного напитка была максимальной.

  • При гипертонической болезни кудин необходимо принимать за 30 минут до еды.
  • При избыточной массе тела стакан кудина выпивается через 1–1,5 часа после еды.
  • При сахарном диабете вред сведётся к минимуму, если выпить стакан такого чая утром перед приёмом первой порции еды.

Польза напитка более явно проявляется, если приём кудина не совмещается с едой, то есть приём осуществляется до или после приёма пищи. Советы диетологов в этом вопросе однозначно говорят, что стимуляция одновременно целебным напитком и едой несёт исключительно вред.

Противопоказания

Кудин может нанести непоправимый вред здоровью больных язвенной болезнью и гастритом. Спорна польза этого напитка и при некоторых эндокринных заболеваниях.

Необычный по своему составу чай кудин имеет много особенностей, которые оказывают на организм положительное воздействие и при отсутствии противопоказаний может применяться как лечебное средство. Его изготавливают из листьев падуба широколистного – высокого вечнозеленого тропического растения, то есть называть кудин чаем не совсем правильно. Популярность и экзотичность напитка сделала его очень востребованным на рынке, а целебные свойства чая кудин ставят его в один ряд с фитонапитками.

История происхождения

Кудин широко применялся китайскими целителями еще 2000 лет назад. Название чая переводится как «горькая трава» или «горькая слеза», что отражает вкусовые свойства получаемого напитка. Его открытие приписывается многим известным личностям, но укоренилась легенда, что именно благодаря императору Тан Тяньбао на основе листьев падуба стали изготавливать целебный напиток.

Согласно легенде, император решил создать эликсир молодости, чтобы подарить его своей избраннице. Растения собирались по всей стране и однажды посланнику посчастливилось забрести в монастырь, где настоятель рассказал ему о чудодейственном кудине и вручил в подарок бочонок с напитком. Избранница императора высоко оценила свойства китайского чая, и с тех пор он стал традиционным.

Особенности чая кудин

Напиток, приготовленный из листьев падуба, часто сравнивают с зеленым чаем. Действительно, процесс приготовления и химический состав у этих растений очень схожи, однако они различаются как по вкусу, так и по свойствам. Для кудина собирают исключительно молодые листья, после чего их скручивают и просушивают на солнце. Причем урожай добывают исключительно вручную. В отличие от кудина зеленый чай производят из листьев , а не падуба широколистного.

Кудин – элитный напиток, который при правильном приготовлении имеет терпкий, слегка горький вкус. Именно поэтому для его производства берут молодые листья растения, которые способны быстро отдавать крепость и насыщенность аромата.

Сорта чая

Китайский чай кудин имеет несколько разновидностей:

  • Листовой.
  • Спиральный (их еще называют «копья»).
  • Скрученный.
  • Прессованный.
  • Связанный.

Качество листа определяется именно по характеру его скрутки

Самым элитным считается Кудин Шуй Сю, который собирают в провинции Сычуань у подножия Желтой горы. Считается, что в этой местности экологически чистый климат и сырье получается более качественным. Падуб широколистный произрастает во всех китайских провинциях, но в них листья растения собираются для производства низкосортного дешевого товара.

Состав кудина

Польза и вред этого экзотического напитка обусловлены химическим составом растения. Это поистине богатый витаминами, микро- и макроэлементами чай. Он содержит витамины группы А, D, Е, РР, В, а также кремний, марганец, серу, железо, фосфаты. Кудин – источник никотиновой, соляной и аскорбиновой кислоты. Помимо этого, в состав растения входят полезные смолы, танин, летучие масла, а по количеству флавоноидов он превосходит все другие виды чая.

Полезные свойства

Уникальный химический состав напитка обусловил неоценимую пользу чая кудин для организма человека. Причем его можно применять как для профилактики, так и для лечения следующих заболеваний:

  • Сердечно-сосудистые.
  • Простудные.
  • Проблемы с желудочно-кишечным трактом.
  • Гипертонические кризы.


Наличие в составе бактерицидных и детоксикационных компонентов позволяет чаю кудин очищать организм от вредных веществ и токсинов, поэтому его рекомендуют пить при различных отравлениях

Полезные свойства чая кудин заключаются в следующем:

  • Наличие в составе фосфора благотворно влияет на нервную систему, в том числе помогает снижать умственную усталость.
  • Помогает при хронической усталости, тонизирует и бодрит организм, а также улучшает память.
  • Регулярное употребление напитка способствует нормализации артериального давления, что является профилактической развития гипертонии.
  • Свойства китайского чая кудин, направленные на выведение токсинов, шлаков и тяжелых металлов из организма, позволяют бороться со свободными радикалами и препятствовать образованию раковых опухолей.
  • Способность разжижать кровь делает кудин незаменимым для профилактики образования тромбов, поэтому его особенно активно пьют люди пожилого возраста.
  • Вяжущие свойства напитка оказывают положительное действие на пищеварительный тракт, в том числе снимают колики и ускоряют обмен веществ.
  • Кудин прекрасно очищает печень и улучшает липидный обмен, а также является мочегонным средством.
  • Напиток является жаропонижающим и противовоспалительным средством, поэтому применяется для лечения простудных заболеваний, ангины, стоматита и иных воспалениях полости рта.
  • Способствует укреплению местного иммунитета.
  • Благодаря входящему в состав калию, укрепляет стенки сосудов и нормализует работу сердечно-сосудистой системы.
  • Чай кудин активно сжигает жиры, поэтому рекомендуется к употреблению в процессе похудения.
  • Во время диеты этот напиток помогает насыщать организм необходимыми полезными веществами.

Противопоказания

Несмотря на неоценимую пользу, кудин имеет стандартные противопоказания к употреблению: беременность и период лактации, а также детский возраст до 12 лет. Не стоит забывать и об индивидуальной непереносимости компонентов растения. Вред чая кудин возможен только при наличии хронического заболевания – гастроэнтерита. В этом случае его употребление следует исключить. В остальных случаях напиток принесет огромную пользу для организма.

Как правильно заварить

Раскрыть вкусовые качества кудина и получить целебный результат можно только при его грамотном приготовлении. Поэтому следует тщательно изучить, как заваривать чай кудин. Для этого существует два способа: предварительное замачивание листьев в холодной воде и стандартное заваривание чая.

Первый метод позволяет сохранить полезные свойства растения и получить напиток с насыщенным чайным ароматом. Для этого возьмите несколько веточек кудина и замочите их в холодной воде до тех пор, пока листья полностью раскроются. Затем залейте заварку кипяченой, но не горячей водой и оставьте на 5 минут для настаивания.

Второй способ более привычный, но требует соблюдения температурного режима. Вода должна быть не горячее 40-50 °С, так как благородный вкус проявляется только если напиток правильно заварен. Заварку следует брать из расчета половина палочки кудина на 250 мл воды. Предварительно ополосните чайничек кипятком, после чего положите в него заварку и залейте горячей водой. Первая вода обязательно сливается – она необходима для того, чтобы пробудить чайные листья и смыть с них пыль. Вторая партия воды уже нужна для настаивания напитка. Время приготовления – от 3 до 4 минут.


Готовый чай можно процедить и употреблять как теплым, так и остуженным

Пейте его маленькими глотками, не смешивая с едой. Кудин употребляется именно как лекарственное средство, поэтому даже разработаны специальные дозировки для различных заболеваний.

По советам врачей стоит придерживаться следующих рекомендаций:

  • При сахарном диабете курс приема кудина составляет 2 недели. При этом следует выпивать один стакан в день за 45 минут до приема второго завтрака.
  • При гипертонии и заболеваниях щитовидной железы один стакан настоя кудина употребляется за 40 минут до обеда, а курс приема также составляет две недели.
  • В случае борьбы с избыточным весом этот чай призван ускорять обменные процессы, поэтому его рекомендуют пить через час после приема пищи. При этом курс приема может длиться до наступления желаемого результата похудения.


Необходимо помнить, что этот благородный изысканный сорт можно приобрести только в специализированных магазинах, иначе легко нарваться на подделку

Горьковатый и терпкий вкус зачастую отпугивает ценителей чая от этого напитка. Однако к нему легко привыкнуть, да и снизить горечь можно, взяв меньше заварки. Потрясающие тонизирующие свойства и кладезь полезных веществ помогут забыть о большинстве заболеваний и поддерживать физическую форму в отличном состоянии.

Чай «Кудин» — это одна из разновидностей зеленого китайского чая, получаемая из широколистного падуба, реже из бирючины. Листья данных растений имеют толстый черешок, рубцевидные края, а также достигают до 4 сантиметров в длину и 4 миллиметров в толщину. Если переводить название чая с китайского, то оно будет звучать как «кхудин» — «горький чай». Добывается данный чай в южных После периода обработки листья «Кудина» бывают следующих видов: листовые, спиральные, связанные, скрученные и прессованные. Чаем, обладающим наилучшим качеством и большим количеством полезных свойств, является «Кудин Шой Су», который производится из крошечных листочков. В 1997 году на международной выставке чаев в Китае данный чай выиграл золотую медаль в номинации «Лечебный чай».

История чая

Происхождение чая основывается на одной китайской легенде и начинается примерно в 770 году, во время правления Тан Тянбао. В это время император издает указ о сборе всех способов омоложения организма для продления молодости своей любимой жены, красавицы Ян Гойфей. Помощник императора Ян Гоаньтин в одном из монастырей на Сыконашни нашел рецепт под названием «вечная весна». Суть данного рецепта заключалась в омолаживающих свойствах напитка «Кудин». По этому рецепту изготовил чай один монах, который обладал секретами исцеления на основе трав. Он и подарил Яну Гоаньти бочонок этого удивительного чая. После этого чай был передан Ян Гойфей. Жена могущественного властелина по достоинству оценила удивительные свойства чая и наградила помощника императора. В 1368 году, при правлении данному чаю был придан статус придворного средства. После этого чай «Кудин» стал популярным народным средством в восточных странах. И вот уже более одного тысячелетия данный чай используется в народной медицине за счет своих целебных свойств.

Чай «Кудин»: свойства

Данный напиток обладает огромным витаминно-минеральным комплексом, который оказывает положительное влияние на организм человека. «Кудин» содержит множество аминокислот, богат железом, кальцием, магнием, калием, витамином С, витамином В1, цинком, марганцем, селеном, медью и множеством других витаминов. Чай «Кудин» обладает жаропонижающим, антисептическим, противовоспалительным, тонизирующим, детоксикационным и мочегонным свойствами. Его используют для понижения артериального давления, нормализации уровня сахара в крови, усиления ферментации печени, снижения холестерина в крови, повышения и улучшения зрения. Кудин является хорошим средством при простудных и вирусных заболеваниях, его употребляют для улучшения пищеварительного процесса и снятия похмельного синдрома.

Чай «Кудин»: противопоказания

Если человек страдает какими-либо заболеваниями, то перед употреблением данного зеленого чая ему лучше посоветоваться со своим лечащим врачом. «Кудин» не следует принимать людям, у которых есть проблемы с желудочно-кишечным трактом, такие как язва желудка, гастрит или заболевания двенадцатиперстной кишки, так как он может вызвать боль в желудке, кишечные колики или способствовать образованию изжоги. Помимо этого, ученые выдвинули теорию, что зеленый чай сбивает ритм работы сердца, поэтому следует воздержаться от принятия «Кудина» людям с сердечно-сосудистыми заболеваниями во избежание серьезных последствий. От чрезмерного употребления чая «Кудин» лучше воздержаться людям с заболеваниями, которые связаны с щитовидной железой, и гипертоникам, потому что он может оказать на них отрицательное воздействие и вызвать ухудшение имеющихся заболеваний.

Как заваривать и пить «Кудин»

Чтобы заварить китайский чай «Кудин», используется температурой примерно 50 градусов по Цельсию, если же вода будет горячее, то напиток получится более горьким. На 250 миллилитров воды берется 5 грамм — примерно одна чайная ложка «Кудина». Заваривать чай можно в обычном заварнике. Первая заварка сливается примерно через 5 секунд после наполнения, потому что она необходима для раскрытия листьев Кудина и передачи аромата чая. Вторая заварка длится около 1 минуты, после чего чай следует перелить в отдельную посуду для употребления. Данный чай можно заваривать до четырех раз, но каждую последующую заварку необходимо увеличивать на одну минуту. Кудин употребляют как в горячем, так и в холодном виде. Не стоит заедать «Кудин» какими либо закусками и добавлять в него сахар или сливки, но для обогащения чая витаминами и полезными свойствами можно добавить немного меда. Чай «Кудин» употребляется в чистом виде, и его используют как лечебное средство.

Аромат и вкус чая

При правильном заваривании «Кудин» дает светло-зеленый цвет настоя и утонченный сладко-травяной аромат китайских плантаций. Чай обладает горьким и густым специфическим вкусом, и оставляет сладкое экстравагантное послевкусие.

Юлия Верн 4 357 0

Необычный чай кудин в переводе с китайского означает «горькая трава». Из названия становится ясно, что напиток имеет специфический вкус из-за особенностей входящих в состав листьев, способа их заваривания. Тем не менее, чай, который собирают в тени китайских гор, ценят за особые качества, активно реализуют и распространяют по миру.

Не даром считается, что китайский чай — подарок природы, от которого не следует отказываться. Большая часть сортов листьев, выращенных на территории Поднебесной, действительно уникальны как по вкусу, так и полезным свойствам. Кудин — один из самых ярких этнических напитков не исключение.

Горьковатый напиток активно использовался местными жителями еще 2000 лет назад. Им заменяли привычный зеленый чай, высоко оценивая эффект от его потребления. Кудин — необычный напиток и с его появлением в Китае связано много историй, легенд и мифом. Современники же, называя его чаем, понимают, что с обычными листьями чайных кустов и деревьев он имеет мало общего.

Основа Кудина — плотные листья падуба широкого, деликатно собранные местными жителями.

Где растет и как собирают

Карликовое дерево растет по всей территории Китая. Тем не менее, самую высокую оценку получили полезные свойства Кудина, собранного у подножья Желтой Горы, что находится в провинциальной местности Сычуань.

Заготавливают чай по технологии, аналогичной с технологией заготовки элитного зеленого чая:

  1. Урожай собирают в период появления новых зеленых листков на дереве.
  2. После сбора готовые листья скручивают, нанизывая на леску.
  3. «Вязанки» с листьями сушат на открытом воздухе в течение нескольких дней.

Завершающим этапом подготовки чая становится сортировка листков как по размеру, так и по степени готовности с последующей упаковкой для хранения.

Кудин — какой на вкус, цвет и аромат?

Как уже было отмечено выше, в переводе с китайского название чая означает «горькая трава». Этим оправдан и его необычный вкус. Действительно пить чай кудин с удовольствием в чистом виде могут не все из-за его специфической вкусовой составляющей. Тем не менее, можно экспериментировать с сортами напитка, подбирая для себя самые подходящие варианты с минимально резким вкусом и ароматом.

Чем выше сорт чая, тем меньше горечи в нем присутствует. Это объясняется составом — в основе напитка самые молодые листья, не успевшие огрубеть и напитаться горьким вкусом. Недостаток элитных сортов Кудина — слабая выдержка, небольшая крепость и потерянная насыщенность аромата.

Полезные свойства китайского напитка — что нужно знать

Выбирая для себя китайский чай, нужно знать, что это напиток не для утоления жажды, а скорее для лечения и профилактики ряда болезней. Четко понимая, чем полезен чай кудин, можно со временем научиться получать удовольствие от процедуры чаепития, используя натуральные добавки для смягчения вкуса.

Популярный сегодня среди людей, ведущих здоровых образ жизни, Кудин действительно помогает бороться со многими недугами, укрепляя здоровье. Лечебные свойства чая оценили в свое время древние китайские врачеватели, рекомендуя его к регулярному потреблению местным жителям.

Правильно заваренный чай — бесценный кладезь витаминов, включающий в себя макро- и микроэлементы, без которых человек не сможет быть здоровым, энергичным, жизнерадостным. Одних только флаваноидов в напитке по числу в 10 раз больше, чем в традиционном китайском чае!

Кудин имеет уникальный химический состав. Неоднократно доказано, что напиток способен:

  • бодрить, вселять силы и энергию, способствовать борьбе с усталостью и повышению работоспособности;
  • укреплять иммунную систему;
  • снижать уровень сахара в крови;
  • очищать сосуды;
  • облегчать симптомы простуды;
  • бороться с изжогой и ринитом;
  • лечить стоматит;
  • укреплять память;
  • нормализовать давление;
  • снижать уровень холестерина;
  • очищать печень;
  • выводить токсины из организма;
  • нормализовать вес;
  • наладить работу сердца и ЖКТ;
  • ускорять метаболизм;
  • уменьшать последствия облучения;
  • не допускать развития раковых опухолей.

Принимая во внимание советы врачей в отношении правильного потребления экологически чистого напитка, можно значительно улучшить здоровье, используя его как мочегонное, бактерицидное, противовоспалительное и жаропонижающие средство.

Искусство заваривания китайского Кудина — этапы и особенности

Чтобы получать пользу, нужно знать, как правильно заваривать чай из Китая. Уникальное природное лекарство требует деликатного подхода к процессу. Процедура заваривания — многоэтапная церемония, где исключены спешка и безответственность:

  1. Подготовка воды.
  2. Подготовка заварки.
  3. Подготовка чайника.
  4. Заваривание.
  5. Число завариваний.

От температуры воды зависит не только вкус напитка, но и его полезные свойства. Кудин, заливаемый крутым кипятком, по вкусу будет похож на полынь. Именно поэтому часто из-за незнания тонкостей заваривания начинающие чаеманы готовят чай неправильно, получая горький, непригодный для потребления напиток.

Чтобы убрать горечь, заваривать листья нужно водой температурой от 40 до 70 градусов. В этом случае она станет практически незаметной, раскроется аромат и благородный вкус чая.

Количество заварки также должно быть фиксированным. На обычный стакан понадобится чайная ложка сырья. В первый раз для знакомства с Кудином будет достаточно половины чайной ложки. Со временем можно немного поэкспериментировать с дозировкой, меняя вкус готового напитка.

Правильно заваренный чай будет иметь приятное немного сладковатое послевкусие.

Перед тем, как заваривать и пить чай кудин нужно подготовить заварочный чайник. Его прогревают кипящей водой, после чего сливают кипяток и используют для заваривания. Сухую смесь засыпают на дно емкости, заливают водой, которую сразу же сливают. Это нужно для того, чтобы «оживить» и «очистить» листья. Повторно их заливают водой, оставляя настаиваться в течение 7-10 минут. Чем дольше будут настаиваться листья, тем крепче получится чай.

Заваривать Кудин можно пять раз. Это удобно и экономично, учитывая, что даже после пятого заваривания сохранятся вкус, аромат и полезные свойства напитка.

Кому противопоказан китайский целебный чай?

Как любое целебное средство, Кудин имеет свои противопоказания, о которых нужно знать каждому, а особенно тем, кто страдает хроническими проблемами со здоровьем. Напиток не рекомендуется потреблять людям с гастритом, язвой желудка, несмотря на то, что он благоприятно воздействует на работу ЖКТ. Кроме того стоит воздержаться от этнического отвара людям с нестабильным артериальным давлением.

Примечательно, что несмотря на то, что Кудин — это польза и вред для лиц с определенными проблемами со здоровьем, он может стать полноценной заменой пищи. Что касается добавок для усиления вкуса, то лучше использовать натуральные продукты вприкуску. Это могут быть коричневый сахар, натуральный мед, варенье, цукаты или сухофрукты.

Кудин чаем не является, так как не имеет никакого отношения к чайным кустам. Это напиток, который заваривают из высушенных листьев вечнозелёного растения, обитателя субтропиков, — падуба широколистного. Собирают листья и обрабатывают в китайских южных провинциях в каньонах, на влажных склонах гор в тени, в смешанных лесах по берегам протоков. Просушенный чай кудин представлен несколькими разновидностями — есть прессованный, скрученный, связанный, спиральный, листовой и др. Высшей категорией считается Кудин Шуй Сю, который производят из маленьких листочков, собранных в провинции Сычуань. Напиток используется не только для утоления жажды и получения удовольствия, но и применяется в китайской народной медицине, так как считается спасительным средством от разных болезней.

Поистине необычен и уникален чай кудин: полезные свойства этого напитка описываются в древнейших китайских документах. В них он называется волшебным, так как, согласно старинным манускриптам, «очищает голову и глаза», «рассеивает ветер», «успокаивает волнение», «выгоняет яды» и выполняет ещё многие другие функции. Современные учёные, изучив состав этого напитка, подтвердили изыскания древних китайцев. В этом настое — множество витаминов (А, E, C, D, В1, В2), минеральных элементов (магний, сера, калий, натрий, марганец, кремний, сера, хлорофилл) и флавоноидов (в 10 раз больше, чем в обычном зелёном чае). Благодаря такому богатству химического состава, при регулярном и грамотном применении чай кудин воздействует на многие системы организма самым благоприятным образом:

  • тонизирует, бодрит, повышает работоспособность, снимает усталость;
  • существенно снижает уровень сахара в крови;
  • укрепляет иммунитет;
  • помогает при простудах, стоматитах, лёгком недомогании, бронхите, изжогах, гингивитах, насморке;
  • очищает кровеносные сосуды;
  • улучшает память;
  • предотвращает образование тромбов;
  • понижает артериальное давление;
  • улучшает работу желудка;
  • нормализует обмены — липидный и углеводный;
  • очищает печень;
  • защищает от радиации;
  • выводит шлаки, тяжёлые металлы, токсины;
  • способствует снижению веса;
  • препятствует образованию раковых опухолей;
  • укрепляет сердце.

Безопасное, натуральное, дарованной природой средство, зелёный чай кудин обладает жаропонижающим, детоксикационным, антиоксидантным, бактерицидным, антивоспалительным, мочегонным, отхаркивающим действием. Представляет ли столь мощное средство опасность организму, расскажут противопоказания к его употреблению.


Противопоказания

Удивителен чай кудин: противопоказания к его употреблению являются «классическими запретами», общими для всех натуральных средств. Это:

  • беременность и лактация;
  • индивидуальная непереносимость;
  • возраст до 12 лет.

Единственным «личным» противопоказанием для чая кудин является хронический гастроэнтерит. Во всех остальных случаях этот напиток доставит только радость и наслаждение, а также несомненную и гарантированную помощь организму. Но для этого его нужно уметь правильно заваривать.

Правила заваривания кудина

Для максимального эффекта нужно грамотно использовать чай кудин: как заваривать этот напиток, нужно знать всем, кто решился на такой уникальный способ лечения своих недугов. Церемония приготовления проходит в несколько этапов.

1. При заваривании кудина важен температурный режим воды: при 100 °С получится напиток, напоминающий по вкусу полынную горечь. Многие, не зная этого нюанса, заваривают кудин, как обычный чай, — кипятком. После этого они отказываются от чудесного напитка — и совершенно зря. Ведь если его заливать водой 40–50°С, получится изысканный, горьковатый, благородный вкус.

2. На одну чайную ложечку с верхом или 1/2 палочки кудина приходится 250 мл воды.

3. Заварник предварительно обдаётся кипятком, после чего засыпается чай и заливается водой.

5. Кудин без вреда для его вкуса и полезных свойств можно заваривать до 5 раз.

Не все понимают вкус кудина, так как напиток горький, оставляет долгое характерное только для него послевкусие. Его пьют маленькими глотками, не смешивая с другими жидкостями (тем более — с водой). Некоторым приходится по вкусу холодный чай кудин. Для этого заваренный настой процеживают и остужают. Не стоит заедать напиток конфетами или булочками. Единственный сочетаемый продукт с ним — это мёд. В Китае его пьют исключительно как лекарственное снадобье. Существуют даже различные дозировки и режим его употребления при разных заболеваниях.


Системы организма имеют разный режим работы и не одинаково реагируют на лекарственные средства, призванные им на помощь. Точно так же — и с чаем кудин. Если использовать его для лечения и профилактики определённых заболеваний, нужно знать, в какое время и в каком количестве его лучше употреблять для большей эффективности.

  • Гипертония, гипотиреоз щитовидной железы

Для нормализации давления и функций щитовидной железы чай кудин нужно пить за 40 минут до обеда в количестве одного стакана. Полный курс лечения должен составлять не менее двух недель. Предварительно рекомендуется взять консультацию у своего постоянного лечащего врача.

  • Избыточный вес

В последнее время особенно активно используется чай кудин для похудения, так как он прекрасно активизирует все обменные процессы в организме и успешно выводит массу ненужных веществ. С этой целью напиток употребляют через час после обеда в количестве одного стакана. Подобная диета может длиться до того момента, как на весах появится заветная цифра. Естественно, параллельно нужно будет ограничить свой рацион питания и заняться спортом.

  • Сахарный диабет II типа

С чаем кудин легко забыть о болезнях. Элитный, строгий, благородный, экзотический напиток подарит качественно новый вкус и необычный тонизирующий эффект, станет неиссякаемым источником здоровья и внесёт в жизнь новые, оптимистичные нотки.


Понравилась статья? Поделитесь с друзьями, щелкнув по значку своей социальной сети.

Похожие записи


зелёный чай кудин и его полезные свойства. Полезные свойства зеленого чая кудин

В мире есть такие чаи, вкус которых представляется крайне необычным для нас, а иногда вообще неприемлемым. Примером является китайский горький чай Кудин. Он имеет множество сортов, но объединяет их типичная горчинка и масса полезных свойств. А вот с традиционным чаем у Кудина мало общего: он производится совсем не из листьев чайного куста.

Чай Кудин («горькая слеза») является травяным напитком, для производства которого используют листья падуба широколистного. Место произрастания этого растения – горные склоны и смешанные леса на юге Китая. Данный вид падуба характеризуется мясистыми листьями и толстыми ветками. Высота растения иногда может исчисляться несколькими метрами. Выделяют разные виды Кудина в зависимости от времени сбора сырья и его скрутки. Чай может состоять из красноватых почек, молодых и зрелых листьев падуба. Кудин бывает в скрученной, спиральной, связанной, листовой, прессованной форме. Его лучший сорт – Шуй Сю, для получения которого используют крошечные листочки растения.

Легенда о чае

Нежные почки чая Кудин имеют почти багряный оттенок. О его появлении рассказывает одна легенда. Девушка с именем А Сянь занималась сбором листьев падуба для приготовления целебных настоев. Однажды местный чиновник дал распоряжение отправить юную девушку в дворец императора, чтобы она стала его наложницей. Однако прекрасная А Сянь не захотела покориться и, прыгнув со скалы, разбилась на смерть. Тогда люди стали говорить, что несколько капелек крови брызнуло на почки кудина, поэтому они стали красноватого цвета, а в их вкусе после заваривания появились легкая сладость и пряные оттенки.

Полезные свойства

Говоря о чае Кудин, невозможно не сказать о его полезных свойствах и противопоказаниях. Напиток является неотъемлемой частью медицины Китая уже на протяжении 2 тыс. лет. Среди полезных свойств Кудина:

  • снижение уровня холестерина;
  • профилактика заболеваний сердца и сосудов;
  • сжигание жиров, улучшение пищеварения, борьба с изжогой;
  • снижение температуры тела, противопростудные свойства;
  • улучшение памяти;
  • понижение давления, нормализация уровня сахара в крови;
  • ослабление признаков похмелья, выведение шлаков и токсинов;
  • повышение жизненного тонуса и т.д.

В составе китайского чая Кудин содержатся аминокислоты, ряд витаминов (С, В1, В2, Е), а также следующие элементы периодической системы: Ca, К, Fe, Mg, Cu, Zn, Na, Mn, Se.

О возможном вреде и противопоказаниях

Польза и вред Кудина не сравнимы по значимости в Поднебесной. Противопоказаниями к приему чая могут быть:

  • острый колит;
  • язва желудка при обострении;
  • беременность и грудное кормление;
  • детский возраст до 12 лет.

Обратите внимание! Чаще всего этот чай при регулярном, но дозированном приеме приносит только пользу. Аллергических реакций на Кудин не было зафиксировано. Однако, чтобы не столкнуться с неприятными последствиями, при покупке нужно обращать внимание на страну-производителя чая и его состав.

Советы врачей по приему Кудина:

  1. В случае повышенного давления и гипотиреоза чай следует заваривать и пить до обеда за 30-40 мин до приема пищи. Продолжительность курса индивидуальная для каждого больного и составляет примерно 7-14 дней. Принимать Кудин нужно ежедневно по 200 мл.
  2. При инсулиннезависимом диабете чай необходимо пить утром примерно за полчаса до еды. Единовременно можно принимать по 200-250 мл. Утренний прием напитка обеспечивает эффективную нормализацию сахара в крови.
  3. Людям с лишним весом следует пить Кудин по истечении 45 мин или 1 ч после обеденного приема пищи. Единовременно можно выпивать также 200-250 мл напитка. Он улучшает усвоение пищевых компонентов, обеспечивает нормализацию и ускорение обмена веществ.

Разновидности

Сегодня чай Кудин представлен широким спектром видов и сортов. Познакомимся с некоторыми из них.

Вьетнамский

Вьетнамский чай Кудин получают в провинциях Вьетнама на севере. Вкус напитка является насыщенным и содержит типичную горчинку. Кудин Tra Dang Cao Bang очень активен, его не рекомендуется употреблять каждый день: в профилактических целях достаточно пары кружечек в неделю. Для лечения болезней могут назначаться курсы приема этого чая.

Из провинции Хайнань

Чай Кудин Хайнань получают в самой южной провинции Поднебесной. По вкусовым характеристикам и форме скрутки он мало отличается от других видов. Это также чай светло-зеленого цвета с горьковатым вкусом. При неправильной заварке дает сильную горечь.

«Копья»

Чай «копья» Кудин является, пожалуй, наиболее популярным видом. Свое название он получил за тип скрутки листьев, напоминающих по форме иглу или копье. Пользу этого чая можно сравнить только с женьшеневыми настойками. Он обладает травянистым вкусом. Горечь чая легкая и переходит в сладковатое послевкусие.

Как заваривать

Способ заваривания Кудина зависит от его сорта. Каждый человек сам выбирает для себя степень насыщенности чая, т.к. одним нравится более горький напиток, другие предпочитают мягкий вкус.

Меньшей горечью обладает сорт Шуй Сю. Заваривать чай нужно придерживаясь следующей схемы:

  1. Температура воды должна составлять 85-90оС.
  2. Для получения напитка объемом 200-250 мл используется 3-5 г (1ч.л. с горкой) заварки.
  3. Сначала молодые листочки заливаются горячей водой, которую необходимо слить примерно через 5 сек. Это делается для того, чтобы листья раскрылись и наполнили окружающее пространство своим ароматом.
  4. Затем листочки вновь заливаются подготовленной водой и уже завариваются примерно в течение 1 мин.
  5. Завариваться чай Кудин может несколько (обычно 3-5) раз. При этом продолжительность каждого следующего заваривания должна увеличиваться на 1 мин.

По-другому происходит приготовление напитка из «иголок» Кудина. Самое главное в заваривании такого чая – не превышать максимальную дозу, которая составляет 1-2 «копья» на чашку.

Несоблюдение этого правила приведет к получению чрезмерно горького напитка и, возможно, к полному разочарованию.

  1. Сначала желательно попробовать чай самому, угощать гостей на этапе знакомства с Кудином пока не стоит. Для этого нужно заварить всего 1 «иголку» в своей чашке.
  2. С целью заваривания добавляется вода температурой 80оС. Если настаивать «копье» в кипятке, получится напиток, скорее всего, не пригодный к употреблению. Чтобы насладиться тонкостью вкуса и благородным послевкусием, Кудин можно заварить водой, температура которой составляет 50оС.
  3. «Иголки» заливаются водой и настаиваются не более 20 сек. Первая заварка сливается.
  4. Следующее заваривание продолжается также около 20 сек, после чего напиток можно пить.

О самых распространенных разновидностях Кудина, его полезных свойствах и правилах заваривания рассказывают в этом видео:

Как пить Кудин: особенности употребления

Как правило, в данный напиток не добавляют сахар и другие компоненты. Если чай рекомендован врачами, но в натуральном виде организм его не принимает, можно положить немного стевии.

Для профилактики заболеваний пить Кудин чаще 2 или 3 раз в 7 дней не нужно. Пара чашек, регулярно выпиваемых за неделю, способна зарядить человека энергией, привести в порядок его обмен веществ и т.д. Не рекомендуется принимать Кудин натощак.

Для похудения

Можно употреблять чай Кудин для похудения. С этой целью он принимается утром или днем в одно время с приемом пищи, богатой белком. В утренние часы можно съесть, например, творог, сладкий фрукт и выпить Кудин. Также чай можно принимать отдельно через некоторое время после завтрака, но не натощак. Иногда можно наткнуться на противоположную информацию, в которой говорится, что чашкой этого чая можно заменить завтрак или ужин, при этом в день должно осуществляться двухразовое сбалансированное питание.

При беременности

Кудин влияет на нервную систему человека. По этой основной причине будущим мамам лучше воздержаться от употребления данного чая.

Можно ли детям

В Китае не разрешают пить чай Кудин детям, которые еще не достигли шестилетнего возраста. Российскими педиатрами была установлена планка повыше: они не рекомендуют принимать детишкам младше 12 лет. После этого возраста родители могут начать давать ребенку горький чай в количестве всего одной ложечки каждое утро.

Чай Кудин , или, как его ещё называют «горькая слеза», представляет собой напиток, который способен постепенно оздоровить весь человеческий организм быстро и эффективно. Это свернутые листья широколистного вечнозеленого падуба, засушенные по лучшим технологиям (нередко их называют иглами).

Происхождение

Кудин – нетрадиционный чай, в Китае этот загадочный напиток употребляют уже более двух тысячелетий, его открытие приписывают известным историческим личностям, о чем рассказывают многочисленные легенды. В переводе слово Кудин – горькая трава, что характеризует вкусовые качества чая.

Процесс изготовления сырья Кудин сходен с технологией изготовления зеленого чая. В обоих случаях используют первые молодые листочки, главное отличие состоит в том, что для чая Кудин собирают листья дерева – широколистного падуба, а не чайного куста.

Наиболее ценен лист падуба, собранный в провинции Сычуань на Желтой горе, из него получают сорт Кудин Шуй Сю. В других провинциях также произрастает это дерево, но чайный материал менее качественный и соответственно более дешевый.

Листья собирают, едва они позеленеют, затем их скручивают и развешивают для сушки на солнце. Сортировка сырья происходит после оценки листа, по качеству различают такие разновидности Кудин: скрученный, спиральный (скрутка завитками), прессованный, листовой, связанный.

Зачастую чай Кудин люди приобретают у известных поставщиков, имеющих множество положительных отзывов и постоянных клиентов. Привести потребителя к ним могут рекомендации от друзей и знакомых или же собственный выбор, который совершают по таким показателям:

  • Поставщик или посредник находится в сфере торговли свыше 5 лет.
  • Чай Кудин всегда имеется в наличии.
  • Товар поставляется напрямую из Китая.
  • Ассортимент продукта большой.

Кудин выпускается в широком ассортименте. Но, приобретая такой чай, нужно внимательно относиться к его компонентам. В состав входят исключительно листья широколистного падуба. Клиентам могут предложить чай, который состоит из листьев парагвайского падуба, производимых в Китае, однако это, скорее, мате, чем необходимый нам продукт.

После того, как упаковка будет открыта, внимание стоит обратить на качество листьев в ней, обязательное требование к таковым:

  • Сухость.
  • Светло-коричневые крапления.
  • Слабый специфический запах.

Если в чайной пачке будет обнаружена пыль, мусор или другие неприятные находки, покупку нужно попробовать вернуть недобросовестному продавцу или попросту выбросить, не обрекая свой организм на длительную переработку некачественного шлака.

Состав, калорийность и пищевая ценность чая Кудин

Этот целебный напиток вобрал в себя множество тех витаминов, которые необходимы для активной жизнедеятельности человека. Включает:

  • Аскорбиновую и никотиновую кислоты.
  • Флавноиды.
  • Танин.
  • Кофеин.
  • Эфирные масла.

Количество калорий чая Кудин может быть от 1 до 5 ккал на 100 мл, зависит от конкретного сорта напитка. На рацион эта цифра оказывает незначительное воздействие. Как правило, Кудин пьют отдельно от каких-либо блюд, не подслащая и не употребляя в сочетании с десертами.

Вкусовые свойства чая

Кудин чай имеет горький вкус. При этом горечь наиболее ярче проявляется в чае, который изготовлен из старых листьев. Чем моложе листья чая, тем меньше в них горечи и кофеина. Не горькими являются иглы.

Горечь это изюминка чая кудин, которая появляется при первом глотке и даже может испортить впечатление от напитка. Но после во рту появляется дивный сладкий привкус, который позволяет забыть о горечи.

Китайские врачи утверждают, что данный целебный напиток обладает универсальными и общеукрепляющими свойствами, из-за чего нередко рекомендуют его многим своим пациентам. Если употреблять чай Кудин в небольших количествах, то он:

  • Эффективно укрепляет иммунитет, поддерживая его на одном уровне.
  • Предотвращает онкологию.
  • Стремительно выводит токсины из ослабленного организма.
  • Ускоряет процесс выздоровления при простуде и вирусе.
  • Оказывает тонизирующее и бодрящее воздействия.
  • Снижает процент вероятности образования тромбов и разжижает кровь.
  • Приводит в норму артериальное давление.
  • Оказывает стимулирующее воздействие на нервную систему человека.
  • Значительно улучшает память, и повышает настроение пациента.

Польза волшебного напитка

В Китае чай Кудин ценится, благодаря его свойствам стимуляции мозговой деятельности во время сна, окрашиваемого красочными сновидениями и пророчествами.

Для взрослых людей

Волшебный напиток способен нормализовать гормональный баланс, усилить женское и мужское либидо, а также значительно повысить работоспособность. Воздействие на организм мужчины проявляется в стимуляции потенции, улучшении эрекции и появлению способности держать под контролем длительность полового акта. Женщины могут заметить исчезновение ПМС и болей при менструации.

Для беременных и кормящих

В процессе беременности и кормления лучше не принимать чай Кудин, поскольку дополнительная стимуляция ЦНС, скорее, навредит организму женщины, чем поможет. В этот период лучший вариант — пить зелёный чай с добавлением молока.

Для детей

В Китае целители считают не нужной мерой предлагать детям напиток вплоть до шести лет, но педиатры стран СНГ относятся к этому серьезнее и ограничение по возрасту ставят – 12 лет. Процесс приучения ребенка к напитку должен проходить следующим образом: 1 чайная ложка чая натощак каждое утро, это окажет тонизирующий и укрепляющий эффект на его организм. Со временем разрешается увеличивать дозу до 50 мл ежедневно.

Для людей преклонного возраста

После достижения человеком отметки 50 лет, употреблять напиток стоит умеренно, и тогда это будет приносить лишь пользу:

  • Тормозит старение.
  • Предотвращает возможное развитие склероза.
  • Является отличным средством для поднятия настроения.
  • Помогает сохранять активность длительное время.
  • Облегчает адаптацию.

Рекомендуется употреблять чай Кудин только при повышенном давлении. Наиболее эффективно проявит себя в употреблении ослабленными после болезни или лечения медикаментозными препаратами людьми. Способен повышать тонус, иммунитет и очищать организм от вредных токсинов. Хорошо помогает диабетикам, так как благоприятно действует на выполнение функций щитовидной железы.

Противопоказания распространяются на людей:

  • С воспалениями желудочно-кишечного тракта.
  • С язвой желудка при обострениях.
  • При беременности и в период кормления грудью.
  • Дети, не достигшие возраста 12 лет.

Побочные эффекты при соблюдении мер предосторожности в выборе продавца, а также при соблюдении противопоказаний пока не отмечались.

Людям, желающим извлечь максимальную пользу и, вместе с тем, получить удовольствие, стоит научиться правильному завариванию. Один лист чая необходимо заливать 350-400 мл прохладной воды, а дальше есть несколько способов заваривания:

  1. Один лист заливается 50 мл воды, которая далее сливается и заливается таким же кол-вом на 15 минут. После добавляют 300-350 мл воды 80 градусов – Кудин заварится спустя 5 минут.
  2. В емкости с водой 50 градусов игла заваривается в течение 10 минут. Если чай готовится по этой технологии, то добавляется вода 70-80 градусов на 5 минут.

Показания к применению:

  1. Чтобы привести в норму деятельность желез внутренней секреции – его пьют натощак, до еды, дважды в день.
  2. Для того, чтобы улучшить обмен веществ – пьют в горячем виде после обеда и завтрака.

Прежде, чем приступить к приготовлению напитка необходимо запомнить, что этот сорт не относится к простому чаю. Он очень горький и одной «иголочки» на чашку будет очень много. Заваривайте только половину, а начинать лучше с трети палочки, чтобы понять степень горькости, которая вам подходит.

Заваривать можно различными способами:

  1. Если не любите ощущать аромат напитка, то заливайте кипятком. При таком методе завариваниявыходит ярко горький чай, практически лишенный запаха.
  2. Для благородного, терпкого аромата со слегка горьковатым привкусом заливайте водой, которая имеет температуру 80 градусов. Затем дайте время настояться. При таком варианте приготовления вы сможете ощутить природный вкус напитка. А после каждого глотка испытаете сладковатое, приятное послевкусие.
  3. Для заваривания настоя в гайване, нужно окатить ее кипятком и просушить. Затем добавить сухой Кудин. Заливать только горячей водой. Через три минуты слить полностью всю заварку и снова залить кипятком. Пьют напиток из маленьких чашечек.

Области применения

Напиток помогает бороться с лишним весом, его применяют для лечения заболеваний и интенсивно используют в косметологии. Рассмотрим подробнее методы применения в различных областях.

Полезные свойства для похудения

Благодаря собственным свойствам, напиток не только тонизирует и бодрит, но и уменьшает аппетит.

По сравнению с другими видами чая и кофе, Кудин чай обладает мягким действием, которое стимулирует нервную систему уменьшая аппетит.

Поэтому, за счет того, что уменьшается приход калорий в организм, похудение проходит естественным путем. Во время диеты нельзя есть если нет ярко выраженного чувства голода, иначе чай не поможет.

Существует заблуждение, что напиток – пища. Но врачи едины во мнении – это только чай, который способствует уменьшению веса, но не заменяет прием пищи. Натощак употреблять его нельзя, ведь он ранит пустой желудок.

Если вы худеете, то скушайте утром творог или сладкие фрукты, затем запейте его свежеприготовленным напитком. Так же считается, что он перемалывает жирные блюда, поэтому можете побаловать себя омлетом.

Пейте настой утром и вечером, употребляя два раза сбалансированную пищу в течение дня. В чай нельзя добавлять подсластители и ароматизаторы. Употреблять его можно до желаемой потери веса, но стоит помнить, что следует придерживаться ограничения в приеме пищи и заниматься спортом.

Напиток оказывает позитивное влияние на пищеварительную систему, помогает ускорить ее процессы, следовательно, активнее сжигаются жиры и углеводы, которые являются основными источниками лишнего веса.

Кудин чай в кулинарии

В кулинарии чаем Кудин «горькая слеза» заменяют обычный зеленый чай. Заваривать рекомендуется перед употреблением. Напиток помогает утолить жажду и согреться при охлаждении. Поднимет настроение и придаст сил.

Его не употребляют в свежем виде и не используют в качестве добавок. Пьют без подсластителей и не заедают сладостями.

Для лечения используйте менее концентрированный настой, который будет безопасным при длительном употреблении. В тоже время, напиток получится приятнее на вкус, станет мягким и освежающим.

Для профилактических целей пьют один раз в день, обычно утром, но можно употреблять и вечером.

Системы организма по-разному реагируют на чай. Для лечения определенного недуга необходимо употреблять различное количество напитка.

  • При гипертонии и гипотиреозещитовидной железы пьют перед приемом пищи в обед (не раньше, чем за 40 минут). Для приема необходима одна кружка настоя.
  • При излишнем весе рекомендуется выпивать одну кружку через час после еды.
  • При сахарном диабетевторой степени используют перед вторым завтраком (за 45 минут). Необходимо выпить один стакан чая. Лечение проводят в течение двух недель.
  • Чтобы вылечить кожные заболевания, пять скрученных листочков заливают оливковым маслом(150 мл) и настаивают неделю. Затем процеживают. Можно полученной смесью смазывать кожные раздражения и ожоги.

В косметологии:

  • Напиток помогает тонизировать кожу и предотвращать появление морщин. Для этого смазывайте лицо чаем каждое утро.
  • Оказывает антицеллюлитный эффект. Для этого морскую соль (20 г) залить чаем (50 мл) и капнуть масло фенхеля (5 капель). Перемешать и настоять четверть часа. Тело хорошо промыть, а затем нанести скраб. Чаще всего возникает пощипывание, а затем появляется покраснение. Симптомы пройдут через четверть часа. Для применения подходит раз в неделю. Читайте еще:

Узнав обо всех целебных свойствах, вряд ли можно называть Кудин чаем, ведь это, в первую очередь — хорошее китайское средство, укрепляющее и способное оздоровить человеческий организм.

Употреблять его можно не только для удовольствия (человек, конечно, получать его начнет не сразу, а только когда привыкнет к достаточно специфическому для «чая» вкусу), но и для того, чтобы омолодить себя и почувствовать прилив новых сил.

В том, что травы и растения обладают ценными и полезными свойствами, человечество убедилось уже давно. На сегодняшний день многие предпочитают бороться со своими болезнями не традиционными лекарственными препаратами, которые имеют свойство нарушать работу иммунной системы, а с помощью средств народной медицины.

Исторические факты о чае Кудин

Чай Кудин широко применяется в Китае и известен еще со времен династии Восточная Хань. История повествует о том, что при правлении китайского императора Тан Тяньбао его сын Неба, после того, как обрел Ян Гуфей, издал указ о том, чтобы в определенный срок был подготовлен рецепт красоты.

Один из его посланников, Ян Гуаньтин, в поисках такого рецепта, услышал о волшебных свойствах чая Кудин, который оказывал омолаживающий эффект. Чудо-чай можно было приобрести в одном из монастырей на Сыкуншани. В этом монастыре Ян Гуаньтин получил бочонок чая и доставил к месту назначения. Как гласит легенда, красавица Ян Гуфей ощутила на себе поистине благотворное действие чая.

Полезные свойства

Как говорилось выше, чай Кудин общеизвестен не только своим изумрудным цветом и неповторимым вкусом, но еще и тем, что он является незаменимым напитком здоровья и долголетия . Полезные свойства этого чая безграничны.

Регулярное его применение способствует тому, что возможно снизить и избежать риск развития сердечных и сосудистых заболеваний, улучшить пищеварение, уменьшить газообразование и вздутие, избавить от изжоги.

Выяснилось, что в листьях Кудина содержится большое количество аминокислот, витамины C, B1,B2, E, а также незаменимые и необходимые для человеческого организма минералы, как: кальций, магний, медь, калий, железо, цинк, натрий, марганец, селен.

Выделяют несколько сортов чая Кудин, и именно от этого фактора определяются его полезные свойства. Тем не менее, этот благородный напиток обладает следующими свойствами:

  • общеукрепляющим;
  • жаропонижающим;
  • детоксикационным;
  • противовоспалительным;
  • бактерицидным.

К целебным свойствам можно отнести и другие качества чая. Его используют при сильном кашле, удалении флегмы, для улучшения работы желудка и кишечника, повышения тонуса, снижения веса, снижения уровней липоидов и холестерина в крови. Кроме того, Кудин чай обладает бодрящим, тонизирующим и освежающим эффектами, поэтому он широко используется при тяжелой физической и умственной нагрузках, а также как эффективное и мощное средство для снижения веса.

Результаты многочисленных исследований показывают, что этот чудо-напиток можно использовать при лечении не только никотиновой, но и тяжелой алкогольной зависимости, ожирении, повышенного и пониженного артериального давления. При этом побочных эффектов, как правило, не наблюдается и не наносится существенного вреда здоровью.

Исходя из указанных свойств, в народной медицине принято готовить из Кудина различные отвары, настои и настойки. Отвары из листьев применяются при вирусных и простудных заболеваниях, так как оказывают жаропонижающее действие. Поэтому желательно использовать отвар при кашле, ангине, температуре, насморке, простудном ознобе. Вдобавок ко всему, чай Кудин обладает очищающим эффектом, поэтому при регулярном его применении можно очистить в домашних условиях организм от таких вредных веществ, как шлаки, свободные радикалы и токсины.

В целом, чай оказывает только положительное действие на организм человека и используется как средство для общей профилактики и оздоровления. Однако не стоит злоупотреблять им.

Несмотря на ряд полезных свойств, принимать его следует не более двух или трех разов в неделю. Для каждодневного использования он не предусмотрен.

Как заваривать чай Кудин

Чтобы сохранить все полезные и целебные свойства чая, нужно уметь правильно его заваривать. От того, как был заварен или настоян этот напиток, будет зависеть его целебное действие. Стоит сразу предупредить, что напиток имеет горьковатый вкус, поэтому в него добавляют немного сахарного песка или сок любого варенья, чтобы перебить эту горечь .

При заваривании Кудина необходимо помнить, что заливать его крутым кипятком запрещается, в противном случае получится абсолютно горький и ярко-зеленый напиток.

Итак, процесс заваривания состоит из следующих обязательных шагов:

  1. Вода для чая должна быть обязательно мягкой, с этой целью многие предпочитают использовать только ключевую. Однако за неимением таковой, можно взять обычную питьевую.
  2. Воду вскипятить. Как только появятся первые мелкие пузырьки, чайник убрать с огня. Полное закипание не принимается.
  3. Как только вода начнет закипать, несколько спиралек Кудина бросить в чайник, прокипятить в течение 10-ти секунд и убрать с огня. Чай остудить до приемлемой температуры и пить.
  4. Существует еще один способ, как заварить чай. Несколько спиралек или крупинок чая размочить в холодной воде, затем залить горячей (не крутым кипятком) и настоять в течение 2-3 минут, не более.
  5. Считается, что чай Кудин относится к сорту зеленых, поэтому и заваривать его можно, как зеленый чай. При этом так же, как и в предыдущих рецептах, заваривать нужно правильно, то есть при температуре, не превышающей 80-ти градусов по Цельсию.

Существует маленький нюанс, который необходимо учесть любителям не слишком крепкого и горького вкуса. Чтобы напиток получился не крепким и нежным на вкус, заваривать следует при температуре 50-ти или 60-ти градусов . При более высоком градусе чай получится слишком терпким и насыщенным.

Никогда не стоит забывать, что чай используется в основном в лечебных целях. Поэтому не нужно пить его во время завтрака, поедая при этом бутерброды, булочки, пирожное или конфеты. Пить напиток нужно в чистом его виде. Во избежание чувства горечи лучше добавить ложечку сока от варенья, а еще лучше — натурального пчелиного меда.

Поскольку многие используют напиток для профилактики и лечения некоторых заболеваний, нужно знать, в каком количестве его принимать и в каких случаях. Если больной страдает повышенным артериальным давлением, ему следует принимать напиток до еды, на голодный желудок. Доза зависит от состояния больного и степени заболевания. В целом, принято пить не более 150-ти мл в день. Курс лечения составляет две недели.

Если же существует проблема избыточного веса, то использовать напиток следует следующим образом. Пить его нужно после еды, желательно через час после приема пищи. Поскольку чай положительно влияет на пищеварение и ускоряет его процесс, то таким образом происходит активное сжигание жиров и углеводов, что и является основным источником лишнего веса. Достаточно принять за один прием 200 или 250 мл.

При таком заболевании, как сахарный диабет, напиток их Кудина принимают за 40 минут до еды, желательно в утренние часы. Такой режим приема позволит значительно снизить уровень сахара в крови.

Противопоказания к применению

Несмотря на то, что Кудин широко используется сторонниками народной медицины, существует ряд противопоказаний, которые необходимо учитывать при приеме чая. Не стоит особо расстраиваться, так как он в основном противопоказан беременным женщинам и кормящим матерям. Не стоит употреблять чай и маленьким детям, так как горький его вкус может вызвать аллергию или расстройство кишечника.

  1. Любителям чая Кудин было весьма интересно знать, что этот чудо-напиток производится из листьев вечнозеленого субтропического растения, который носит название «Падуб широколистный», что в переводе с китайского обозначает «горькая трава».
  2. Несмотря на то, что Кудин принято считать травой, однако это невысокое и крепкое деревце с толстыми, но гладкими ветвями. У него крупные зелёные листья, имеющие глянцевый блеск. Цветочки у падуба мелкие, желтого цвета, а ягоды небольшие и круглые, имеют желтый, оранжевый или красный цвет.
  3. Горький вкус сторонники китайской медицины соотносят с таким понятием, как: энергия инь, огонь, сердце и тонкий кишечник. Именно поэтому считается, что чай обладает тонизирующим и укрепляющим свойствами, а также благотворно влияет на работу и функционирование сердечной и сосудистой системы, а также кишечника.
  4. Листья Кудина принято собирать только вручную. Наиболее благоприятное время для сбора считается середина весны, именно в это время в листьях содержатся и сохраняются все его полезные свойства. Как только листья собирают, их подвергают следующей обязательной обработке: их скручивают и сушат на солнце.
  5. В продаже можно встретить скрученные, спиральные, связанные и даже прессованные листья Кудина.

Зная о полезных и целебных свойствах этого замечательного чая, можно не сомневаться в его качестве и положительном эффекте. Регулярное его использование поможет предупредить многие заболевания и избавиться некоторых недугов.

Юлия Верн 4 357 0

Необычный чай кудин в переводе с китайского означает «горькая трава». Из названия становится ясно, что напиток имеет специфический вкус из-за особенностей входящих в состав листьев, способа их заваривания. Тем не менее, чай, который собирают в тени китайских гор, ценят за особые качества, активно реализуют и распространяют по миру.

Не даром считается, что китайский чай — подарок природы, от которого не следует отказываться. Большая часть сортов листьев, выращенных на территории Поднебесной, действительно уникальны как по вкусу, так и полезным свойствам. Кудин — один из самых ярких этнических напитков не исключение.

Горьковатый напиток активно использовался местными жителями еще 2000 лет назад. Им заменяли привычный зеленый чай, высоко оценивая эффект от его потребления. Кудин — необычный напиток и с его появлением в Китае связано много историй, легенд и мифом. Современники же, называя его чаем, понимают, что с обычными листьями чайных кустов и деревьев он имеет мало общего.

Основа Кудина — плотные листья падуба широкого, деликатно собранные местными жителями.

Где растет и как собирают

Карликовое дерево растет по всей территории Китая. Тем не менее, самую высокую оценку получили полезные свойства Кудина, собранного у подножья Желтой Горы, что находится в провинциальной местности Сычуань.

Заготавливают чай по технологии, аналогичной с технологией заготовки элитного зеленого чая:

  1. Урожай собирают в период появления новых зеленых листков на дереве.
  2. После сбора готовые листья скручивают, нанизывая на леску.
  3. «Вязанки» с листьями сушат на открытом воздухе в течение нескольких дней.

Завершающим этапом подготовки чая становится сортировка листков как по размеру, так и по степени готовности с последующей упаковкой для хранения.

Кудин — какой на вкус, цвет и аромат?

Как уже было отмечено выше, в переводе с китайского название чая означает «горькая трава». Этим оправдан и его необычный вкус. Действительно пить чай кудин с удовольствием в чистом виде могут не все из-за его специфической вкусовой составляющей. Тем не менее, можно экспериментировать с сортами напитка, подбирая для себя самые подходящие варианты с минимально резким вкусом и ароматом.

Чем выше сорт чая, тем меньше горечи в нем присутствует. Это объясняется составом — в основе напитка самые молодые листья, не успевшие огрубеть и напитаться горьким вкусом. Недостаток элитных сортов Кудина — слабая выдержка, небольшая крепость и потерянная насыщенность аромата.

Полезные свойства китайского напитка — что нужно знать

Выбирая для себя китайский чай, нужно знать, что это напиток не для утоления жажды, а скорее для лечения и профилактики ряда болезней. Четко понимая, чем полезен чай кудин, можно со временем научиться получать удовольствие от процедуры чаепития, используя натуральные добавки для смягчения вкуса.

Популярный сегодня среди людей, ведущих здоровых образ жизни, Кудин действительно помогает бороться со многими недугами, укрепляя здоровье. Лечебные свойства чая оценили в свое время древние китайские врачеватели, рекомендуя его к регулярному потреблению местным жителям.

Правильно заваренный чай — бесценный кладезь витаминов, включающий в себя макро- и микроэлементы, без которых человек не сможет быть здоровым, энергичным, жизнерадостным. Одних только флаваноидов в напитке по числу в 10 раз больше, чем в традиционном китайском чае!

Кудин имеет уникальный химический состав. Неоднократно доказано, что напиток способен:

  • бодрить, вселять силы и энергию, способствовать борьбе с усталостью и повышению работоспособности;
  • укреплять иммунную систему;
  • снижать уровень сахара в крови;
  • очищать сосуды;
  • облегчать симптомы простуды;
  • бороться с изжогой и ринитом;
  • лечить стоматит;
  • укреплять память;
  • нормализовать давление;
  • снижать уровень холестерина;
  • очищать печень;
  • выводить токсины из организма;
  • нормализовать вес;
  • наладить работу сердца и ЖКТ;
  • ускорять метаболизм;
  • уменьшать последствия облучения;
  • не допускать развития раковых опухолей.

Принимая во внимание советы врачей в отношении правильного потребления экологически чистого напитка, можно значительно улучшить здоровье, используя его как мочегонное, бактерицидное, противовоспалительное и жаропонижающие средство.

Искусство заваривания китайского Кудина — этапы и особенности

Чтобы получать пользу, нужно знать, как правильно заваривать чай из Китая. Уникальное природное лекарство требует деликатного подхода к процессу. Процедура заваривания — многоэтапная церемония, где исключены спешка и безответственность:

  1. Подготовка воды.
  2. Подготовка заварки.
  3. Подготовка чайника.
  4. Заваривание.
  5. Число завариваний.

От температуры воды зависит не только вкус напитка, но и его полезные свойства. Кудин, заливаемый крутым кипятком, по вкусу будет похож на полынь. Именно поэтому часто из-за незнания тонкостей заваривания начинающие чаеманы готовят чай неправильно, получая горький, непригодный для потребления напиток.

Чтобы убрать горечь, заваривать листья нужно водой температурой от 40 до 70 градусов. В этом случае она станет практически незаметной, раскроется аромат и благородный вкус чая.

Количество заварки также должно быть фиксированным. На обычный стакан понадобится чайная ложка сырья. В первый раз для знакомства с Кудином будет достаточно половины чайной ложки. Со временем можно немного поэкспериментировать с дозировкой, меняя вкус готового напитка.

Правильно заваренный чай будет иметь приятное немного сладковатое послевкусие.

Перед тем, как заваривать и пить чай кудин нужно подготовить заварочный чайник. Его прогревают кипящей водой, после чего сливают кипяток и используют для заваривания. Сухую смесь засыпают на дно емкости, заливают водой, которую сразу же сливают. Это нужно для того, чтобы «оживить» и «очистить» листья. Повторно их заливают водой, оставляя настаиваться в течение 7-10 минут. Чем дольше будут настаиваться листья, тем крепче получится чай.

Заваривать Кудин можно пять раз. Это удобно и экономично, учитывая, что даже после пятого заваривания сохранятся вкус, аромат и полезные свойства напитка.

Кому противопоказан китайский целебный чай?

Как любое целебное средство, Кудин имеет свои противопоказания, о которых нужно знать каждому, а особенно тем, кто страдает хроническими проблемами со здоровьем. Напиток не рекомендуется потреблять людям с гастритом, язвой желудка, несмотря на то, что он благоприятно воздействует на работу ЖКТ. Кроме того стоит воздержаться от этнического отвара людям с нестабильным артериальным давлением.

Примечательно, что несмотря на то, что Кудин — это польза и вред для лиц с определенными проблемами со здоровьем, он может стать полноценной заменой пищи. Что касается добавок для усиления вкуса, то лучше использовать натуральные продукты вприкуску. Это могут быть коричневый сахар, натуральный мед, варенье, цукаты или сухофрукты.

В аптеках, интернет-магазинах мы сталкиваемся с огромным выбором средств для оздоровления организма. Чайный напиток кудин стал очередной новинкой мира здоровья и красоты.

Многие слышали об оздоравливающих свойствах популярного сегодня напитка кудин. Изучая химический состав продукта, учёные выявили ряд необходимых для полноценного развития и существования нутриентов, что и обуславливает полезность кудина. Следует отметить, что вкус этого эликсира здоровья не особо приятен. Принято называть этот напиток чаем, однако, если ознакомиться с его составом, можно понять, что это не так. Кудин получают путём заваривания высушенных листьев падуба широколистного.

Кудин можно получить, заварив листья падуба широколистного

Химический состав напитка кудин

Напиток кудин содержит в себе следующие вещества:

  • кофеин, теобромин, теофиллин;
  • сапонины, известные своими протекторными свойствами;
  • летучие эфирные масла, кверцетин, оказывающие общеукрепляющее действие;
  • дубильные вещества, танины, выводящие канцерогены, оказывают антиоксидантный эффект;
  • витамины С, D, Е;
  • многочисленные аминокислоты, столь необходимые для роста клеток и тканей организма;
  • І-каротин;
  • кальций;
  • калий;
  • натрий;
  • марганец;
  • молибден;
  • магний;
  • железо;
  • цинк;
  • селен;
  • германий;
  • хром;
  • никель;
  • фосфор.

Вышеперечисленные вещества необходимы для укрепления, поддержания и развития иммунной системы организма.

Полезные свойства напитка

Богатый нутриентами кудин воздействует на человека следующим образом:

  • повышает тонус организма, бодрит;
  • укрепляет иммунитет, позволяет быстрее восстановиться после длительных заболеваний, восполнить дефицит витаминов и минералов;
  • выводит токсины, канцерогенные соединения, шлаки;
  • оказывает мочегонное воздействие;
  • снижает жар, обладает противовоспалительным, антивирусным, бактерицидным свойствами при простудах, ОРВИ, ангинах, гингивитах, стоматитах;
  • обладает гепатопротекторным, цитотоксическим свойством;
  • оказывает антигистаминный эффект;
  • нормализует липидный, углеводный обмен при ожирении;
  • способствует понижению кровяного давления;
  • улучшает регуляцию работы пищеварительного тракта;
  • показан при головных болях;
  • содержит кислоты, оказывающие противоопухолевое воздействие.

Кудин — не панацея. Это означает, что он, безусловно, поможет укрепить здоровье, но остановить гнойную ангину или исцелить рак — едва ли.

Кудин оказывает благотворное влияние практически на многие системы организма

Мнение врачей и диетологов о напитке кудин

Врачи и диетологи считают, что кудин — это хорошая альтернатива чаю. Он безопасен для здоровья, а пить его можно почти всем. Главное — заваривать напиток в соответствии со всеми правилами. Специалисты отмечают, что полезный эффект от употребления кудина, как правило, проявляется постепенно.

Однако эксперты подчёркивают, что достичь эффекта оздоровления возможно только исключительно за счёт комплексного воздействия:

  • правильного питания;
  • режима работы и отдыха;
  • качественного сна;
  • физических упражнений;
  • прогулок на свежем воздухе;
  • стабильного эмоционального фона.

Отдельно отметим, что хвалебные отзывы о кудине известного доктора Мясникова являются не более чем фальсификацией или рекламным ходом продавцов напитка. Ни положительных, ни отрицательных отзывов о продукте Александр Леонидович не давал.

Тема похудения всегда популярна, поэтому и напитку кудин очень часто приписывают уникальные свойства, помогающие снизить вес. По мнению диетологов — это весьма спорный момент:

Кудин — не панацея, но надежный помощник на пути оздоровления организма

Противопоказания

Как и любое натуральное средство, кудин имеет ряд противопоказаний к применению:

  • беременность;
  • кормление грудью;
  • возраст менее 12 лет;
  • пониженное артериальное давление;
  • период обострения заболеваний желудочно-кишечного тракта;
  • хронический гастроэнтерит;
  • индивидуальная непереносимость.

Отдельно следует подчеркнуть, что при диабете кудин употреблять можно. По мнению китайских врачей, он нормализует уровень сахара в крови.

Для получения максимального полезного и вкусового эффекта необходимо правильно заваривать напиток:

  1. Важным моментом является температурный режим. Заваривать напиток нужно не кипятком, а водой температуры от 50 до 80 градусов.
  2. 1 ч.л. с верхом или половину палочки кудина залить 250 мл горячей воды.
  3. Заваривать напиток лучше в гайвани (традиционная китайская посуда для чаепития — чаша с крышкой) либо в простом заварочном чайнике, предварительно обдав его кипятком.
  4. Первую заварку лучше слить. Вторую выдерживать по вкусовым предпочтениям.
  5. Кудин можно заваривать без вреда до 5 раз.

Кудин не рекомендуют пить натощак, лучше его употреблять после или во время еды, в некоторых случаях им можно заменять лёгкие перекусы. Также не следует добавлять сахар, мёд, молоко, разбавлять водой. Пить кудин нужно небольшими глотками, наслаждаясь раскрываемым послевкусием.

  1. Для укрепления организма, повышения иммунитета и резистентности различным заболеваниям достаточно выпивать по стакану после еды 3–4 раза в неделю.
  2. При проблемах с лишним весом также рекомендуется употреблять кудин после еды.
  3. При сахарном диабете 2-го типа кудин применяется за 30–40 минут до еды с утра натощак.
  4. При повышенном давлении кудин следует выпить за 30–40 минут до еды в обед натощак.

Употреблять напиток следует в течение 10–14 дней с перерывами в 1–2 месяца.

Кудин не заваривают кипятком

Чай Кудин — Дедушка ФУ

Есть в наличии

Описание

Это единственный в своем роде горький чай в магазине Дедушки Фу, он создан для тех, кто увлекается китайской медициной или ищет необычных вкусовых впечатлений!

Информация

Вид (степень ферментации)

Листья растения Падуб Широколистный (!Не является чайным деревом)

Советы дедушки Фу

Это единственный в своем роде горький чай в магазине Дедушки Фу, он создан для тех, кто увлекается китайской медициной или ищет необычных вкусовых впечатлений!

Откуда

Провинция Хайнань

Способ обработки

Листья высушиваются и скручиваются в спирали

Цвет, вкус, аромат

Листья длинные,спиралевидные, очень необычной формы! Цвет настоя прозрачный, аромат не похожий на чайный или травяной напиток! А вкус! Это самый горький из всех чаев, вернее – он может таким стать, если его неправильно заварить! Правильно заваренный Кудин имеет ярко выраженную горчинку, но скорее приятную и благородную.

Действие

Мягко стимулирует и тонизирует организм, содержит незначительное количество кофеина, поэтому бодрит не так сильно, как чаи из куста чайного дерева.

Состав, полезные свойства

Чуть ли не самый полезный чай Китая! Помогает при насморке и простуде! Содержит небольшое количество кофеина, так что может быть рекоммендован людям с повышенным давлением.

Вид (степень ферментации) Листья растения Падуб Широколистный (!Не является чайным деревом)
Советы дедушки Фу Это единственный в своем роде горький чай в магазине Дедушки Фу, он создан для тех, кто увлекается китайской медициной или ищет необычных вкусовых впечатлений!
Откуда Провинция Хайнань
Способ обработки Листья высушиваются и скручиваются в спирали
Цвет, вкус, аромат Листья длинные,спиралевидные, очень необычной формы! Цвет настоя прозрачный, аромат не похожий на чайный или травяной напиток! А вкус! Это самый горький из всех чаев, вернее – он может таким стать, если его неправильно заварить! Правильно заваренный Кудин имеет ярко выраженную горчинку, но скорее приятную и благородную.
Действие Мягко стимулирует и тонизирует организм, содержит незначительное количество кофеина, поэтому бодрит не так сильно, как чаи из куста чайного дерева.
Состав, полезные свойства Чуть ли не самый полезный чай Китая! Помогает при насморке и простуде! Содержит небольшое количество кофеина, так что может быть рекоммендован людям с повышенным давлением.

Способ заварки, хранение

Традиционная посуда

Любая посуда

Количество заварки на 100 мл

Внимание! Если неправильно заварить Кудин – его нельзя пить! Берут только один – два листочка на чайник!!!

Температура воды

Температура воды не более 50 градусов!

Время заваривания

Не более минуты

Количество заварок

До 3 х заварок

Условия хранения

На чайной полке при комнатной температуре

Традиционная посуда Любая посуда
Количество заварки на 100 мл Внимание! Если неправильно заварить Кудин – его нельзя пить! Берут только один – два листочка на чайник!!!
Температура воды Температура воды не более 50 градусов!
Время заваривания Не более минуты
Количество заварок До 3 х заварок
Условия хранения На чайной полке при комнатной температуре

Экстракт чая кудин предотвращает метаболические нарушения, вызванные употреблением пищи с высоким содержанием жиров, у мышей C57BL/6 посредством β-антагонизма к Х-рецепторам печени (LXR) Ожирение вызвано накоплением избыточных калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с резистентностью к инсулину, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3].

, [4].Профилактика и лечение ожирения принесет большую пользу пациентам с этим заболеванием. В настоящее время существует только один одобренный FDA препарат (орлистат) для длительного применения при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы для лечения ожирения [3].

Х-рецепторы печени (LXR) являются членами семейства ядерных рецепторов транскрипционных факторов. Были идентифицированы две изоформы LXR, LXRα и LXRβ, которые являются важными регуляторами гомеостаза липидов и холестерина.Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα развивается высокий уровень холестерина в печени и увеличивается жировая печень при кормлении диетой с высоким содержанием жиров [5]. На мышей с нокаутом LXRβ не влияет диета с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными лекарственными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, ингибирует развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей, резистентных к инсулину. регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9].Однако GW3965 повышает уровень триглицеридов в плазме и печени у мышей. С другой стороны, антагонисты LXR, такие как 5α,6α-эпоксихолестерол-3-сульфат, блокируют образование бляшек атеросклероза, ингибируя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического применения.

Зеленый чай и чай кудин — два самых популярных напитка в Китае. Зеленый чай хорошо изучен из-за его различных преимуществ для здоровья, но мало данных о биологической активности горького чая.Чай Кудин используется в качестве напитка в Китае более 2000 лет. В традиционной китайской медицине чай кудин также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. В последнее время несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудин проявляют значительную антиоксидантную активность in vitro [11], [12].Кроме того, чай кудин также значительно уменьшает окклюзию и реперфузию средней мозговой артерии (MCAO/реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активируемой протеинкиназы и циклооксигеназы-2. Он также увеличивает уровень антиапоптотического белка в мозге MCAO/реперфузии крыс [13]. Общие сапонины из чая илекс кудинг улучшают аномальные гемореологические параметры у мышей ApoE -/- , вызванные диетой с высоким содержанием жиров [14]. Тритерпеноидные сапонины из листьев чая илекскудин ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Тем не менее, нет убедительных экспериментальных данных, подтверждающих влияние чая кудин на ожирение и гиперлипидемию. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL/6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев высокоэффективной жидкостной хроматографией с обращенной фазой (ОФ-ВЭЖХ)

Для анализа профилей отпечатков пальцев ЭК (5 мг) растворяли в метаноле (1 мл).Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max при 270 нм. Хроматографическое разделение проводили на обращенно-фазовой колонке Discovery C-18 (250×4,6 мм, 5 мкм) с объемом впрыска 10 мкл метанола (в качестве растворителя А) и воды (в качестве растворителя В). Градиент был установлен следующим образом: 0~10 мин, 5% В; 20 мин, 30% В; 25 мин, 50% В; 40 мин, 90% В; 45 мин, 95% B (скорость потока 1 мл/мин).

Урсоловая кислота и лупеол (чистота >98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя А) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя В), в подвижной фазе при скорости потока 1,0 мл/мин при 30°С. в течение 60 мин. Для обнаружения урсоловой кислоты градиент элюции ВЭЖХ составлял 48 % А (ацетонитрил) и 52 % В (фосфорная кислота, pH 2,5) через 0 мин, 75 % А и 25 % В через 40 мин, 85 % А и 15 % В. в 60 мин. Для обнаружения лупеола использовали постоянную подвижную фазу метанол: вода (98∶2, об./об.).

Культура клеток

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% эмбриональной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем в среде для дифференцировки (DM), содержащей 10 мкг/мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис, Миссури). , Миссури) и к культуре добавляли 0,8 мМ изобутилметилксантина (IBMX, Sigma, Сент-Луис, Миссури). Через 4 дня среду заменили на DMEM с 10% фетальной телячьей сывороткой для дифференцировки при 37°C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли в среду в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным O

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным O (Sigma, Сент-Луис, Миссури) при 60°C в течение 10 минут. минут. Затем были сделаны снимки с использованием микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Germany) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК. кДНК первой цепи синтезировали с использованием набора для синтеза кДНК (Fermentas, Мэдисон, Висконсин), а уровни экспрессии генов анализировали с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ПЦР в реальном времени ABI Stepone Plus (Applied Biosystems, Карлсбад, Калифорния). . Праймеры, использованные в экспериментах, показаны на рис. Уровни мРНК всех генов нормализовали, используя β-актин в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Ген Прямой праймер Обратный праймер
β-Актин TGTCCACCTTCCAGCAGATGT АГКТКАГТААКАГТЦКГЦТАГА
LXRA ГАГТГТГКАКТЦГКАААТГК CCTCTTCTTGCCGCTTCAGT
LXRβ КАГГКТГКАГГТГГААТТК АТГГКГАТААГКААГГКАТАКТ
АВСА1 GGCAATGAGTGTGCCAGAGTTA ТАГТЦАКАТГТГГКАКГТТТТ
ABCG1 TCCCCCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
АроЕ GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG КАКАГКЦКАГГТАТГГААТКА
СРЭБП1 GGCTATTCCGTGAACATCTCCTA АТСКААГГГКАТКТГАГААКТК
ФАС CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C/EBPβ ГГГГТТГТГАТГТТТТГГ CGAAACGGAAAAGGTTCTCA
ППАРα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
ППАРγ CGCTGATGCACTGCCTATGA АГАГГТЦКАКАГАГКТГАТТЦК
PPARβ/δ АГТГАКТГГКГКТКТТЦАТ CGCAGATGGTGTCCTGGAT
C/EBPα CGCAAGGCCGAGATAAAGC CACGGCTCAGCTGTTTCCA
АП2 CATGGCCAAGCCCAACAT CGCCAGTTTTGAAGGAAATC
АКК GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
АСО CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УКП-2 GGGCACTGCAAGCATGTGTA TCAGATTCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17]. Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролиферацией пероксисом мыши (PPAR) α, γ, β/δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарены доктором Р. Эвансом [18]. и д-р Саез [19], [20]. Когда экспрессионные плазмиды котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина-люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг суммарных плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ/δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед тем, как клетки собирали для определения активности люциферазы. 24 часа спустя. Анализы репортеров люциферазы проводили с использованием системы анализа репортеров Dual-Luciferase (Promega, San Luis Obispo, CA), а эффективность трансфекции нормализовали в соответствии с активностью люциферазы rellina. Все эксперименты по трансфекции проводили независимо в трех повторностях.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (номер одобрения: 11002). Самок мышей C57BL/6 приобретали в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 °C) и цикле 12-часового освещения и 12-часовой темноты. Для профилактического эксперимента мышей C57BL/6 одинакового возраста и массы тела случайным образом разделили на разные группы, а затем поместили на диету с высоким содержанием жиров (HF) (60% калорий, полученных из жира, Research Diets, New Brunswick, NJ; D12492), или на диете с высоким содержанием жиров, смешанной с 0.05% от EK, или на низкокалорийной диете в качестве эквивалентной контрольной диеты для чау-чау (10% калорий, полученных из жира, Research Diets; D12450B). Исследование рациона было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением случайным образом группировали. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг/день/кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). В ходе эксперимента нормальные контрольные мыши содержались на обычном рационе (Chow).Потребление пищи за 24 часа измеряли, регистрируя разницу в весе между кормом, помещенным в клетку, и кормом, оставшимся по истечении 24 часов как в обработанных, так и в контрольных группах. Экспериментальные рационы не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни сывороточного триглицерида (TG), общего холестерина (TC), холестерина ЛПВП (HDL-c) и холестерина ЛПНП (LDL-c) исследовали с использованием автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) со 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и фекалиях

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Tris·HCl, pH 7,5, 150 мМ NaCl, 1% Triton) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали компаундом ОСТ и разрезали на срезы размером 10 мкм в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Сканирующая электронная микроскопия

Сканирующая электронная микроскопия применялась для исследования структуры жировой ткани по ранее описанным протоколам [21]. Изображения были получены с помощью сканирующего электронного микроскопа Philip XL-30.

Внутрибрюшинный тест на толерантность к глюкозе

После 2 недель лечения мышей C57BL/6 не кормили в течение ночи в течение 12 часов. Образцы крови брали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г/кг массы тела). Дополнительные образцы крови брали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения уровня глюкозы.

Статистический анализ

Анализ данных был выполнен с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как среднее значение ± стандартная ошибка. Статистический анализ проводили с помощью однофакторного дисперсионного анализа (ANOVA). Различия считались значимыми при P<0,05.

Результаты

Профилирование отпечатков пальцев EK

Чтобы проанализировать компоненты этанольного экстракта чая кудинг, мы проанализировали отпечатки пальцев EK с помощью ВЭЖХ.Рисунок S1A показал, что EK содержит несколько пиков, соответствующих предыдущим результатам. Далее мы сравнили элементы ЭК с известными соединениями урсоловой кислоты и лупеола. На рисунке S1B показано, что при 41,147 мин времени удерживания наблюдался пик поглощения, который был таким же, как пик урсоловой кислоты (рисунок S1C). Точно так же пик EK при времени удерживания 17,379 мин (рис. S1D) был идентичен лупеолу (рис. S1E). Эти выводы согласуются с предыдущим отчетом [22].

EK ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние EK на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM) для индуцирования дифференцировки преадипоцитов 3T3-L1. При индукции ДМ в среду добавляли ЭК с 0-го по 6-й день дифференцировки. Результаты показали, что этанольный экстракт чая кудин значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудин не изменял дифференцировку адипоцитов 3T3-L1 (), что указывает на то, что потенциальное средство для лечения ожирения и дислипидемии могут быть жирорастворимыми компонентами.В результате мы использовали этанольный экстракт в следующих опытах.

Спиртовой экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и спиртовой экстракт добавляли в среду в концентрации 20 мкг/мл. В качестве контроля носителя использовали ДМСО. Клетки окрашивали масляным красным О на 6-й день дифференцировки. GM: среда для выращивания; DM: среда дифференцировки.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5–7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активации фактора транскрипции и экспрессии липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных стадиях. Когда ЕК добавляли во время индукции и удаляли во время дифференцировки, дифференцировка явно не менялась (1). Интересно, что когда ЕК добавляли после завершения индукции, дифференцировка значительно ингибировалась (1), что указывает на то, что ЕК может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

ЕК ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): ЕК использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): EK использовали только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6-й день дифференцировки. (C): результаты RT-PCR в реальном времени уровней экспрессии генов в адипоцитах 3T3-L1. Клетки дифференцировались в течение 6 дней, а затем клетки обрабатывали ЕК в концентрации 20 мкг/мл в течение 24 часов. DM: среда дифференцировки. β-актин использовали в качестве внутреннего контроля.Данные представлены как среднее значение ± стандартная ошибка для 4 обработок. *Р<0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии родственных генов в адипоцитах 3T3-L1, обработанных ЕК. Результаты показали, что EK значительно ингибирует экспрессию адипоцитарного маркера PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение EK не изменило экспрессию генов ACC, CD36 и UCP2 (11).

EK блокирует ожирение и гиперлипидемию, вызванные диетой с высоким содержанием жиров, у мышей C57BL/6

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL/6.Через 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с мышами, получавшими стандартную диету (корм). При добавлении EK прибавка массы тела была намного меньше, чем у контрольных мышей с HF (12). Поскольку торможение набора массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи мышами. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей с HF (1), что указывает на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не изменило содержание ТГ в кале (1), что свидетельствует о том, что роль ЭК в блокировании увеличения массы тела не связана с ингибированием абсорбции липидов. Далее мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при ВЧ-диете (1), что указывает на то, что ЭК защищает от вызванного ВЧ увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL/6 с ожирением, вызванным диетой с высоким содержанием жиров.

(А): Увеличение массы тела. (B): количество потребляемой пищи. (C): Содержание фекальных ТГ. (D): изображения белых и коричневых адипоцитов под сканирующим электронным микроскопом. (E): Уровни общего холестерина (ТС), триглицеридов (ТГ), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, по результатам теста на толерантность к глюкозе (GTT). НС: Не имеет значения. Данные были представлены как среднее значение ± стандартная ошибка. N = 7 для всех групп. * Р<0,05.

Ожирение тесно связано с гиперлипидемией и резистентностью к инсулину, поэтому мы проверили уровень липидов в сыворотке крови и уровень глюкозы в крови натощак у мышей. Анализ липидов в сыворотке показал, что лечение EK приводило к снижению уровней LDL-c в условиях диеты с HF, но уровни TG, TC и HDL-c не претерпели значительных изменений (). Уровни глюкозы натощак были ниже, чем у контрольных мышей с HF (0 мин в ). Затем мы проверили, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест на толерантность к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций 1 г/кг глюкозы. Как показано в , уровни глюкозы у мышей, получавших диету HF, были заметно выше, чем у мышей, получавших диету чау-чау. Лечение EK значительно снизило уровень глюкозы во все моменты времени, что свидетельствует о том, что EK улучшает толерантность к глюкозе у мышей C57BL/6, получавших диету HF.

EK предотвращает накопление липидов в печени мышей C57BL/6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и профиль липидов в печени мышей, получавших EK.Окрашивание HE показало, что мыши, которых кормили пищей с высоким содержанием жиров в течение 5 недель, имели сходную морфологию тканей гепатоцитов с мышами, получавшими стандартную диету (12). Окрашивание масляным красным O показало, что липиды накапливались в печени мышей HF по сравнению с таковым у контрольных мышей Chow (), и что лечение EK заметно предотвращало накопление липидов в печени (). Для подтверждения этих результатов анализировали содержание ТГ и ТС печени. Уровни ТГ у мышей, получавших ВЧ-диету, были заметно выше, чем у контрольных мышей, в то время как лечение ЕК значительно предотвращало накопление ТГ в печени, вызванное диетой с высоким содержанием жиров (14).Общее содержание ОХ в печени не претерпело существенных изменений во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL/6, получавших диету с высоким содержанием жиров.

(A-C): Окрашивание H&E (×200) печени мышей со стандартной диетой (A), диетой HF (B) и HF+EK (C). (D-F): Окрашивание масляным красным O (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы докрашивали гематоксилином. Приведены количественные результаты содержания ТГ (Г) и ТС (Н) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, а ЭК измельчали ​​в порошок и подмешивали к диете в количестве 0,05% (масса/масса). Данные были представлены как среднее значение ± стандартная ошибка. N = 7 для всех групп. * Р<0,05.

EK улучшает метаболические нарушения у мышей с ожирением

Затем мы проверили, может ли EK влиять на метаболические нарушения у мышей с ожирением. Через 3 месяца кормления рационом с высоким содержанием жиров у мышей C57BL/6 развилась высокая масса тела, липиды сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили ЭК в дозе 50 мг/кг/сутки в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (1), и количество потребляемой пищи также не изменилось (1). Однако лечение EK приводило к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей.

EK улучшает метаболические нарушения у мышей C57BL/6 с ожирением.

(A): Масса тела до и после лечения. (B): количество потребляемой пищи. (C): изображения белых адипоцитов с помощью сканирующей электронной микроскопии.(D): Уровни общего холестерина (ТС), триглицеридов (ТГ), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке. (E): толерантность к глюкозе у мышей, получавших HFD, по результатам теста на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг/кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы измеряли с регулярными интервалами 15, 30, 60 и 90 минут. НС: Не имеет значения. Данные были представлены как среднее значение ± стандартная ошибка. N = 7 для всех групп. * Р<0.05.

Анализ липидов в сыворотке крови показал, что уровни ОХ, ТГ, Х-ЛПНП и Х-ЛПВП у мышей с ожирением были значительно повышены по сравнению с таковыми у мышей, получавших стандартную диету. Обработка EK заметно снижала содержание TG, но не изменяла уровни TC, LDL-c или HDL-c в сыворотке (), демонстрируя различное влияние EK на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровень глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших ЭК. показывает, что уровень глюкозы натощак у мышей, получавших ЭК, был ниже по сравнению с таковым у мышей, не получавших лечения, а уровни глюкозы также улучшались через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, что позволяет предположить, что ЭК может улучшать толерантность к глюкозе. Взятые вместе, эти результаты показывают, что EK может облегчить метаболические нарушения у мышей с ожирением, вызванных диетой.

ЕК ингибирует экспрессию липогенных генов в печени мышей

Чтобы проверить эффекты ЭК in vivo, мы исследовали экспрессию генов в печени мышей, получавших ЭК. Как показано на рисунке, уровни мРНК факторов транскрипции, таких как PPARγ, CEB/Pα, и липогенных генов, таких как ацил-КоА-оксидаза (АСО), ацетил-коэнзим А-карбоксилаза (АСС) и аР2, были снижены в печени, обработанной ЕК, что свидетельствует о том, что на экспрессию генов, связанных с липогенезом, влияет лечение EK.

EK ингибирует экспрессию липогенных генов в печени мыши.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты RT-PCR в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ/ß, C/EBPα, C/EBPβ, UCP2, ACO, ACC и aP2 в печени мышей, получавших ЭК, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как среднее значение ± стандартная ошибка для 5 мышей на группу. *Р<0,05.

Чай Кудин содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на ингибировании ожирения и гиперлипидемии, мы проверили, действует ли ЕК на PPARγ, α, β/δ и LXRα и LXRβ, которые являются лекарственными мишенями при метаболических синдромах [25], [26]. Мы не наблюдали ингибирующего действия EK на трансактивность PPARγ, α, β/δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (2), что свидетельствует о том, что EK может содержать лиганд антагониста LXRβ.

EK Анализ транскрипционной активности ядерных рецепторов.

(A, B): трансактивность LXRα и LXRβ. Экспрессионные плазмиды pCMXGal-mouse LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и/или 5–20 мкг/мл ЭК еще в течение 24 часов. В качестве контроля носителя использовали ДМСО. Относительную активность люциферазы измеряли путем сравнения с активностью люциферазы реллиной. Результаты представляют по меньшей мере три независимых эксперимента, а данные представлены как среднее значение ± стандартная ошибка.*Р<0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, получавших EK, сравнивали с таковыми у контрольных мышей HF после профилактического лечения, а β-актин использовали в качестве внутреннего контроля. Данные представлены как среднее значение ± стандартная ошибка для 5 мышей на группу. *Р<0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора генов-мишеней, в том числе синтазы жирных кислот (FAS), белка, связывающего регуляторные элементы стеролов-1c (SREBP-1c), липопротеинлипазы (LPL), АТФ- транспортер связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27]. Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей с HF. Уровни LXRα/β, ApoE, ABCA1 и SREBP1 также были ингибированы в печени мышей, получавших ЕК (1), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставили доказательства того, что чай кудин может предотвращать и облегчать нарушения обмена веществ у мышей, получающих диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение EK блокирует увеличение массы тела, гиперлипидемию и резистентность к инсулину у мышей, индуцированных диетой с HF. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что EK может улучшать метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЕК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования позволяют предположить, что защитный эффект EK против метаболических нарушений, вероятно, обусловлен его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудин используется в лечебных формулах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудин обладает различными биологическими эффектами [28].Было показано, что чай кудин снижает уровни TG, TC и LDL-c в сыворотке у пациентов с дислипидемией [29], [30] и улучшает артериальное давление у пациентов с гипертензией фазы I, а также предотвращает прогрессирование атеросклероза [31]. [32].

У мышей C57BL/6 может развиться метаболический синдром при кормлении пищей с высоким содержанием жиров. В текущем исследовании масса тела, уровни ТС в сыворотке, ТГ, ЛПНП-с и ТГ в печени, толерантность к глюкозе были значительно увеличены у мышей, получавших диету с высоким содержанием жиров в течение 5 недель. Лечение ЭК привело к значительному снижению прибавки в весе и уровня ОХ в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что свидетельствует о том, что ЭК может предотвращать развитие метаболических синдромов.

Прибавка в весе является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно была вызвана уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка калорий. Конкретные механизмы, с помощью которых EK защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных наших исследований. Поскольку снижение потребления пищи может значительно повлиять на массу тела, уровень глюкозы в крови и уровень липидов, мы рассмотрели возможность того, что эффект ЭК может быть результатом снижения потребления пищи. Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай ингибирует всасывание липидов в кишечнике [34]–[36]. Однако наши данные показали, что чай кудин не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что снижение уровня липидов и массы тела может быть не связано с уменьшением всасывания липидов на уровне кишечника. В совокупности наши данные показывают, что защитные механизмы EK против увеличения массы тела не зависят от снижения потребления энергии и абсорбции липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших ЭК, наблюдались более низкие уровни ТГ в сыворотке и уровень глюкозы натощак, чем у контрольных мышей с ожирением. Однако у мышей не наблюдалось значительной потери массы тела, снижения общего холестерина или холестерина ЛПНП. Возможны две причины такого несоответствия. Во-первых, было показано, что удаление лишнего жира намного сложнее, чем предотвращение его увеличения. Во-вторых, в рамках превентивной терапии мы лечили мышей в течение 5 недель, а терапевтических мышей лечили только две недели.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудин на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшалась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие резистентности к инсулину [37]–[39].

По сравнению с водным экстрактом чая кудин, этаноловый экстракт ингибировал дифференцировку адипоцитов 3T3-L1, что свидетельствует о том, что жирорастворимые компоненты чая кудин могут воздействовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудин содержит 11 основных соединений: лупеол, 11-кето-α-амиринпальмитат, α-амиринпальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилуп- 20(29)-ен-30-аль, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерол, н-бегеновая кислота и н-гексакозан [22]. Из них урсоловая кислота изучалась на предмет ее влияния на нарушения обмена веществ. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов липидного обмена и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], снижает массу тела, висцеральное ожирение, уровни глюкозы и плазмы крови. липидов, а также повышение уровня лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41]-[43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, содержится только 6,48% урсоловой кислоты (около 1/20 использовано в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не является единственным эффективным компонентом. Активные соединения в чае кудин необходимо исследовать на предмет их роли в метаболических заболеваниях. Или систему кишечной проницаемости можно использовать для выяснения механизма воздействия чая кудинг на адипоциты 3T3L1.

Опубликованные данные о механизме действия чая кудин ограничены, но исследования показывают, что чай кудин может улучшать нарушения обмена веществ с помощью нескольких механизмов.Наши данные свидетельствуют о том, что чай кудин может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая как LXRα, так и LXRβ. LXRα экспрессируется преимущественно в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Ранее был показан потенциал LXR в качестве мишеней для лекарств при гиперлипидемии, АС, диабете, гипертонии и воспалении [46], [47]. Дальнейшее исследование эффектов EK на мышах с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит определить ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни TC в сыворотке, но повышать уровни TG в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно два встречающихся в природе соединения, реин и нарингенин, были подтверждены как антагонисты LXRα/β и LXRα соответственно, а также было показано, что они обладают свойствами, снижающими гиперлипидемию [48], [49].Kanaya et al. сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЕК избирательно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, что позволяет предположить, что ЕК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью EK также проявляется в экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и была значительно ингибирована в печени и жировой ткани мышей, получавших ЕК. Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что EK защищает от развития ожирения, гиперлипидемии и резистентности к инсулину у мышей, получавших диету с высоким содержанием жиров. Эти данные свидетельствуют о том, что EK может быть использована в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования пищевых добавок природного происхождения для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать в качестве диетической терапии метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени имеют плохой долгосрочный успех. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Питательные вещества | Бесплатный полнотекстовый | Добавка экстракта чая кудин с высоким содержанием диетического питания индуцирует ферменты, метаболизирующие ксенобиотики в печени — 6-недельное исследование кормления на мышах

Вклад авторов

Концептуализация, S.В., А.Ф., К.Л., Х.О., Ю.И., К.Т. и Г.Р.; Методология, С.В., А.Ф., К.Л., Р.Л., Х.О. и Ю.И.; Курирование данных, С.В., А.Ф., К.Л., Р.Л., К.Т. и Г.Р.; Написание — подготовка первоначального проекта, S.W. и Г.Р.; Написание-обзор и редактирование, С.В., А.Ф., К.Л., Х.О., Ю.И., К.Т. и Г.Р.; Надзор, Р.Л., К.Т. и Г.Р.; Приобретение финансирования, Г.Р. Все авторы одобрили этот окончательный вариант работы. Все авторы прочитали и согласились с опубликованной версией рукописи.

Рисунок 1. Экстракт чая Кудин-γ-циклодекстрин (KTE)-комплекс, используемый для исследования кормления мышей.

Рисунок 1. Экстракт чая Кудин-γ-циклодекстрин (KTE)-комплекс, используемый для исследования кормления мышей.

Рисунок 2. Влияние γ-циклодекстрина (ɣCD), экстракта чая Кудинг-ɣCD (KTE-ɣCD) и урсоловой кислоты (UA) на развитие массы тела и состав тела. Мышей кормили (ad libitum) следующими диетами в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12,88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% UA. ( a ) Развитие массы тела и ( b ) состав тела в конце эксперимента.Состав тела рассчитывали по отношению к общей массе тела. Данные выражены как среднее значение ± стандартное отклонение (n = 8–10 мышей/рацион). Статистический анализ развития массы тела проводили с использованием смешанного факторного метода ANOVA (фактор-время и диета) с повторными измерениями после проверки на сферичность с последующим апостериорным тестом Бонферрони (время p < 0,001; диета p = 0,516; время*диета). р = 0,305). Статистический анализ состава тела проводился с использованием однофакторного дисперсионного анализа.

Рис. 2. Влияние γ-циклодекстрина (ɣCD), экстракта чая Кудинг-ɣCD (KTE-ɣCD) и урсоловой кислоты (UA) на развитие массы тела и состав тела. Мышей кормили (ad libitum) следующими диетами в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12,88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% UA. ( a ) Развитие массы тела и ( b ) состав тела в конце эксперимента. Состав тела рассчитывали по отношению к общей массе тела.Данные выражены как среднее значение ± стандартное отклонение (n = 8–10 мышей/рацион). Статистический анализ развития массы тела проводили с использованием смешанного факторного метода ANOVA (фактор-время и диета) с повторными измерениями после проверки на сферичность с последующим апостериорным тестом Бонферрони (время p < 0,001; диета p = 0,516; время*диета). р = 0,305). Статистический анализ состава тела проводился с использованием однофакторного дисперсионного анализа.

Рисунок 3. Экстракт чая Кудин-γ-циклодекстрин (KTE-γCD) увеличивает вес печени и накопление жира в печени.Мышей кормили (ad libitum) следующими диетами в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12,88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% УК (УК). ( a ) Абсолютная масса печени и гепатосоматический индекс (масса печени/общая масса тела) были значительно увеличены у мышей KTE-γCD. Данные выражены как среднее + стандартное отклонение (n = 8-10 мышей/рацион). Статистический анализ массы печени и гепатосоматического индекса проводили с использованием одностороннего ANOVA. Разные буквы обозначают статистически значимые различия между обработками (p ≤ 0.05). ( b ) Репрезентативные гистологические срезы печени, окрашенные Oil Red O (ORO) и гемалауном. Капли жира в клетках печени окрашивались в красный цвет (стрелки), а ядра — в синий. Образцы печени визуализировали с помощью светового микроскопа (увеличение 200× и 400×).

Рисунок 3. Экстракт чая Кудин-γ-циклодекстрин (KTE-γCD) увеличивает вес печени и накопление жира в печени. Мышей кормили (ad libitum) следующими диетами в течение 6 недель: с высоким содержанием жиров, высоким содержанием фруктозы, диетой западного типа (CON, контроль), 12.88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% UA (UA). ( a ) Абсолютная масса печени и гепатосоматический индекс (масса печени/общая масса тела) были значительно увеличены у мышей KTE-γCD. Данные выражены как среднее + стандартное отклонение (n = 8-10 мышей/рацион). Статистический анализ массы печени и гепатосоматического индекса проводили с использованием одностороннего ANOVA. Разные буквы обозначают статистически значимые различия между обработками (p ≤ 0,05). ( b ) Репрезентативные гистологические срезы печени, окрашенные Oil Red O (ORO) и гемалауном.Капли жира в клетках печени окрашивались в красный цвет (стрелки), а ядра — в синий. Образцы печени визуализировали с помощью светового микроскопа (увеличение 200× и 400×).

Рисунок 4. Экстракт чая Кудин-γ-циклодекстрин (KTE-γCD) увеличивал уровни мРНК генов, участвующих в адипогенезе (гамма-рецептор, активируемый пролифератором пероксисом, PPARγ; молекула CD36, CD36), в то время как экспрессия генов, связанных с синтезом липидов (стероловый регуляторный элемент, связывающий транскрипционный фактор 1, SREBP1; синтаза жирных кислот, FASN) была снижена.Мышей кормили следующими диетами ad libitum в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12,88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% % УК (УК). Экспрессию генов анализировали с помощью одноэтапной количественной полимеразной цепной реакции с обратной транскрипцией в реальном времени (одноэтапная qRT-PCR). Все данные qRT-PCR были нормализованы к экспрессии гена 18sRNA и выражены по отношению к группе CON. Данные представлены как среднее + стандартное отклонение (n = 8–10 мышей/рацион). Статистический анализ уровней мРНК SREBP1 проводили с использованием однофакторного ANOVA (p ≤ 0. 05). Значимые различия в уровнях PPARγ, CD36 и FASN рассчитывали с использованием U-критерия Манна-Уитни. Разные буквы обозначают статистические различия между обработками (p ≤ 0,05).

Рис. 4. Экстракт чая Кудин-γ-циклодекстрин (KTE-γCD) увеличивал уровни мРНК генов, участвующих в адипогенезе (гамма-рецептор, активируемый пролифератором пероксисом, PPARγ; молекула CD36, CD36), в то время как экспрессия генов, связанных с синтезом липидов (стероловый регуляторный элемент, связывающий транскрипционный фактор 1, SREBP1; синтаза жирных кислот, FASN) была снижена.Мышей кормили следующими диетами ad libitum в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12,88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% % УК (УК). Экспрессию генов анализировали с помощью одноэтапной количественной полимеразной цепной реакции с обратной транскрипцией в реальном времени (одноэтапная qRT-PCR). Все данные qRT-PCR были нормализованы к экспрессии гена 18sRNA и выражены по отношению к группе CON. Данные представлены как среднее + стандартное отклонение (n = 8–10 мышей/рацион). Статистический анализ уровней мРНК SREBP1 проводили с использованием однофакторного ANOVA (p ≤ 0.05). Значимые различия в уровнях PPARγ, CD36 и FASN рассчитывали с использованием U-критерия Манна-Уитни. Разные буквы обозначают статистические различия между обработками (p ≤ 0,05).

Рисунок 5. Экстракт чая Кудинг-γ-циклодекстрин (KTE-γCD) повышал уровни мРНК ( a ) и белка ( b ) цитохрома P450, семейства 7, подсемейства a, полипептида 1 (CYP7A1) по сравнению с другими группами. Мышей кормили следующими диетами ad libitum в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12.88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% UA урсоловой кислоты (UA). ( a ) Экспрессию генов анализировали с помощью одноэтапной количественной полимеразной цепной реакции с обратной транскрипцией в реальном времени (одноэтапная qRT-PCR). Данные qRT-PCR были нормализованы к экспрессии гена 18sRNA и выражены по отношению к группе CON. Данные представлены как среднее + стандартное отклонение (n = 8–10 мышей/рацион). Статистический анализ уровней мРНК CYP7A1 проводили с использованием U-критерия Манна-Уитни. Разные буквы обозначают статистически значимые различия между обработками (p ≤ 0.05). ( b ) Уровни печеночного белка CYP7A1 определяли вестерн-блоттингом, показан репрезентативный блот. Репрезентативные полосы из УФ-изображения без пятен показаны на дополнительном рисунке S1. Рисунок 5. Экстракт чая Кудинг-γ-циклодекстрин (KTE-γCD) повышал уровни мРНК ( a ) и белка ( b ) цитохрома P450, семейства 7, подсемейства a, полипептида 1 (CYP7A1) по сравнению с другими группами. Мышей кормили следующими диетами ad libitum в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12.88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% UA урсоловой кислоты (UA). ( a ) Экспрессию генов анализировали с помощью одноэтапной количественной полимеразной цепной реакции с обратной транскрипцией в реальном времени (одноэтапная qRT-PCR). Данные qRT-PCR были нормализованы к экспрессии гена 18sRNA и выражены по отношению к группе CON. Данные представлены как среднее + стандартное отклонение (n = 8–10 мышей/рацион). Статистический анализ уровней мРНК CYP7A1 проводили с использованием U-критерия Манна-Уитни. Разные буквы обозначают статистически значимые различия между обработками (p ≤ 0.05). ( b ) Уровни печеночного белка CYP7A1 определяли вестерн-блоттингом, показан репрезентативный блот. Репрезентативные полосы из УФ-изображения без пятен показаны на дополнительном рисунке S1. Рисунок 6. Влияние γ-циклодекстрина (γCD), экстракта чая Кудин-γ-циклодекстрина (KTE-γCD) и урсоловой кислоты (UA) на ферменты фазы I и фазы II трансформации ксенобиотиков в печени мыши. Мышей кормили следующими диетами ad libitum в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12. 88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% UA. Уровни экспрессии генов цитохрома P450, семейство 3, подсемейство a (CYP3A) ( a ) и глутатион S-трансферазы, альфа-1 (GSTA1) ( c ) анализировали с помощью одностадийной количественной обратной транскрипции полимеразной цепи в реальном времени. реакция (одноэтапная qRT-PCR). Все данные qRT-PCR были нормализованы к экспрессии гена 18sRNA и выражены по отношению к группе CON. Данные представлены как среднее + стандартное отклонение (n = 7–10 мышей/рацион).Статистический анализ уровней мРНК CYP3A и GSTA1 проводили с использованием U-критерия Манна-Уитни. Разные буквы обозначают статистически значимые различия между обработками (p ≤ 0,05). Уровни печеночного белка CYP3A ( b ) и GSTA1 ( d ) определяли вестерн-блоттингом, показан репрезентативный блот. Репрезентативные полосы из УФ-изображения без пятен показаны на дополнительных рисунках S1 (CYP3A) и S2 (GSTA1). Рисунок 6. Влияние γ-циклодекстрина (γCD), экстракта чая Кудин-γ-циклодекстрина (KTE-γCD) и урсоловой кислоты (UA) на ферменты фазы I и фазы II трансформации ксенобиотиков в печени мыши. Мышей кормили следующими диетами без ограничений в течение 6 недель: диета западного типа с высоким содержанием жиров и фруктозы (CON, контроль), 12,88% γCD, 7,12% KTE, инкапсулированные в 12,88% γCD (KTE-γCD) или 0,15% %укр. Уровни экспрессии генов цитохрома P450, семейство 3, подсемейство a (CYP3A) ( a ) и глутатион S-трансферазы, альфа-1 (GSTA1) ( c ) анализировали с помощью одностадийной количественной обратной транскрипции полимеразной цепи в реальном времени. реакция (одноэтапная qRT-PCR). Все данные qRT-PCR были нормализованы к экспрессии гена 18sRNA и выражены по отношению к группе CON.Данные представлены как среднее + стандартное отклонение (n = 7–10 мышей/рацион). Статистический анализ уровней мРНК CYP3A и GSTA1 проводили с использованием U-критерия Манна-Уитни. Разные буквы обозначают статистически значимые различия между обработками (p ≤ 0,05). Уровни печеночного белка CYP3A ( b ) и GSTA1 ( d ) определяли вестерн-блоттингом, показан репрезентативный блот. Репрезентативные полосы из УФ-изображения без пятен показаны на дополнительных рисунках S1 (CYP3A) и S2 (GSTA1).

Рис. 7. Дозозависимое увеличение цитотоксичности из-за обработки экстрактом чая Кудинг (KTE) в гепатоцитах HepG2 ( a ). Урсоловая кислота (УК) в концентрациях ≥ 100 мкМ проявляла умеренную цитотоксичность в клетках HepG2 ( b ). Жизнеспособность клеток оставалась неизменной в ответ на хлорогеновую кислоту (CGA) ( c ) и кудинозид D (KudD) ( d ). Жизнеспособность клеток измеряли с помощью анализа поглощения нейтрального красного. Клетки обрабатывали КТЕ (0,06, 0,2, 0.6, 1,2, 2 мг/мл), UA (3, 10, 30, 60, 100, 250 мкМ), CGA (10, 50, 100, 250 мкМ) и KudD (10, 50, 100, 250 мкМ) для 24 ч. Все данные выражены по отношению к контрольной группе (КОН, диметилсульфоксид). Данные представлены как среднее + стандартное отклонение. * указывает на значительную разницу по сравнению с группой CON, проанализированную с помощью t-критерия или U-критерия Манна-Уитни (p ≤ 0,05).

Рис. 7. Дозозависимое увеличение цитотоксичности из-за обработки экстрактом чая Кудинг (KTE) в гепатоцитах HepG2 ( a ).Урсоловая кислота (УК) в концентрациях ≥ 100 мкМ проявляла умеренную цитотоксичность в клетках HepG2 ( b ). Жизнеспособность клеток оставалась неизменной в ответ на хлорогеновую кислоту (CGA) ( c ) и кудинозид D (KudD) ( d ). Жизнеспособность клеток измеряли с помощью анализа поглощения нейтрального красного. Клетки обрабатывали KTE (0,06, 0,2, 0,6, 1,2, 2 мг/мл), UA (3, 10, 30, 60, 100, 250 мкМ), CGA (10, 50, 100, 250 мкМ) и KudD ( 10, 50, 100, 250 мкМ) в течение 24 часов. Все данные выражены по отношению к контрольной группе (КОН, диметилсульфоксид).Данные представлены как среднее + стандартное отклонение. * указывает на значительную разницу по сравнению с группой CON, проанализированную с помощью t-критерия или U-критерия Манна-Уитни (p ≤ 0,05).

Таблица 1. Экспериментальная конструкция.

Таблица 1. Экспериментальная конструкция.

3 Con 3 10 3 10 3 12.88 3 7. 12 2 3 — UA
Group N N ΓCD (%) KTE (%) 9 UA (%)
— —
γCD 1 10 12.88
10
0,15

Чай Кудин — Императорский китайский горький травяной чай

Код товара: HT-006

Происхождение: Хайнань, Китай

Минимальный заказ: 20 кг

Чай Кудин обладает многими лечебными свойствами лечебный чай, производимый в основном в Китае.Название кудин происходит от китайских слов Ку, что означает горький, и Дин, китайское слово, обозначающее шип, так как листья растения кудин скручены, образуя длинные узкие шипы. Хотя у чая горьковатый вкус, некоторые люди обнаруживают, что вскоре после употребления чая у него появляется сладкое послевкусие. Многие люди привыкают к чаю через некоторое время, используя его в сочетании с другими чаями или подсластителями, такими как стевия, поскольку он имеет ряд доказанных преимуществ для здоровья. Кудин ча используется в Китае с 1765 года и ранее назывался Дун Цин.


Процесс изготовления

Этот чай в основном изготавливается из листьев падуба Илекс кудинг ча, которые длинные, узкие и имеют эластичную текстуру. Дерево илекс кудинг ча может расти в течение нескольких сотен лет, и деревья в основном выращивают в Центральном, Южном Китае и некоторых частях Вьетнама. В Китае уезд Даксин в провинции Гуанси на юго-западе Китая является основным центром производства этого чая.В некоторых случаях листья также могут быть высушены и свернуты в форму шара или рулона для удобной продажи покупателям.


Как заваривать

Из-за горького вкуса чая настоятельно рекомендуется, чтобы пользователь не использовал более трех палочек кудинг ча, обычно достаточно только одной или двух шипов, особенно если человек ест кудинг ча в первый раз. Для одного или двух шипов чая требуется не менее 150 мл горячей воды.Колосья необходимо замочить в горячей воде температурой от восьмидесяти до девяноста градусов по Цельсию не менее одной минуты для заваривания чая. Чайные листья можно использовать как минимум дважды или трижды для заваривания чая, увеличивая время заваривания чайных листьев, однако горький вкус, вероятно, уменьшится. Постоянные любители чая Кудин могут использовать больше листьев при заваривании чая.

Как хранить 

Чай Кудин следует хранить в водонепроницаемой таре, чтобы он не терял аромат, лечебные ингредиенты и не становился влажным.


Польза чая Кудин для здоровья

Этот чай очень популярен благодаря своим полезным свойствам и широко используется в традиционной китайской медицине.  Он широко используется для снижения артериального давления и способствует снижению веса, главным образом уменьшая задержку воды в организме. Он улучшает кровообращение, выводит токсины из организма, так как содержит антиоксиданты, а также помогает перевариванию пищи. Чай используется для улучшения концентрации во время работы и памяти, что повышает производительность. Некоторые люди используют чай для лечения различных заболеваний, таких как простуда, лихорадка и головная боль. Болезни дыхательных путей, такие как бронхит, носовые пазухи, также можно лечить с помощью кудинг ча. Тем не менее, рекомендуется, чтобы человек, потребляющий чай, проконсультировался с врачом, если у него или нее есть медицинские проблемы, такие как низкое кровяное давление, перенесена операция.

Таким образом, несмотря на горький вкус, кудин ча пользуется популярностью во всем мире благодаря своим целебным свойствам.

Обладая более чем 10-летним опытом производства и экспорта чая, Guangzhou Runming Tea Company специализируется на чае кудин.

Существуют некоторые основные конкурентные преимущества нашей компании kuding cha:

цена может быть ниже;

2. Контроль качества:  Опытная команда контроля качества всегда строго проверяет продукцию перед упаковкой, обеспечивает доставку высококачественной продукции клиентам;

3. Логотип и упаковка: упаковка OEM и ODM и индивидуальный логотип;

Мы являемся профессиональным поставщиком чая кудинг . Если вы хотите купить kuding cha. Почему вы не выбираете нас? Может быть, это хороший выбор для вас. Если вы заинтересованы в нашей kuding cha, пожалуйста, свяжитесь с нами, чтобы немедленно получить конкурентоспособную заводскую цену !!!

 

*Полезные свойства и побочные эффекты чая Кудин — The Mastermind Club

*Полезные свойства и побочные эффекты чая Кудин*

Вы слышали о чае Кудин? Это один из самых любимых чайных напитков в Китае.Эта культура много знает о пользе чайных напитков. Они не могут жить без чая. В древние времена китайцы использовали листья чая Кудин для лечения различных заболеваний. Сейчас, когда в мире продолжаются процессы глобализации, нигерийцы тоже получили доступ к этому чудесному напитку!

Что такое Кудинг?

Кудин — растение, произрастающее в Китае. Исторические документы содержат сведения о том, что кудин в качестве лекарственного растения использовался китайцами более 2000 лет. Тем не менее, только во времена династии Сун кудин представляли как чай.Правительственные чиновники и высшее общество династии Сун были первыми, кто попробовал чай кудин. С увеличением скорости производства чая кудин он стал популярным средством народной медицины. Чай Кудин также может называться Игольчатый Кудин. Он получил свое название из-за тонких листьев, скрученных в виде иголок. Кудинг на самом деле можно перевести на английский как горький или колючий.

Кудин и китайская медицина

Это растение имеет богатую историю как продукт для здоровья. Если вы заглянете в древние китайские манускрипты, то обнаружите множество лечебных свойств кудин.Согласно рукописям, Кудинг может помочь в борьбе с:

прыщами;
головокружение;
шум в ушах;
зубная боль;
красные глаза;
головная боль;
чрезмерный нагрев.
Тем не менее, когда китайские врачи прописывают Кудин, он обычно бывает в более концентрированной форме, например, в виде порошка. Больным можно давать травы, но они должны готовить лекарства сами. Кудинг следует варить в горячей воде в течение нескольких часов. Это способ приготовить традиционное китайское народное средство с очень горьким вкусом.Поэтому древние китайцы предпочитали пить чай Кудин для предотвращения болезней, а не пить сверхконцентрированное средство Кудин, когда возникала болезнь.

Польза чая кудин для здоровья

Китайцы любят пить более легкую версию чая кудин. На вкус намного лучше. Более того, неконцентрированная версия этого напитка идеально подходит для ежедневного употребления. Некоторым нравится чай за его послевкусие. Он описан как освежающий и сладкий.

Чай Кудин против диабета, холестерина и высокого кровяного давления

Другое название чая Кудин среди китайцев — 降三高, что означает «опуститься на три высоты».» Чай Кудин содержит много полезных элементов, таких как витамины, цинк, флавоноиды, полифенолы и кислоты, которые хороши для снижения артериального давления, холестерина и диабета.

Средство от неприятного запаха изо рта и прыщей

Чай Кудин также содержит антибактериальные элементы. помощники с неприятным запахом изо рта и прыщами.Некоторые китайцы в деревнях ежедневно жуют листья кудин.Китайские стоматологи сообщают, что антибактериальные свойства кудин могут помочь при кариесе и неприятном запахе изо рта, а также сохраняют чистоту полости рта.

Чай Кудин и фертильность

В зависимости от индивидуальных особенностей пациентов чай ​​Кудин может способствовать повышению фертильности. Тем не менее, нет никаких научных доказательств того, что это может помочь увеличить коэффициент фертильности у всех людей.

Чай Кудин и похудение

Некоторые любители крайних мер для похудения считают, что этот сорт чая может стать хорошим помощником для похудения. Это, безусловно, может помочь уменьшить вес тела и поддерживать здоровый вес после его достижения.Тем не менее, некоторые люди считают, что он не сжигает жир, но помогает увеличить вес воды в организме.

Чай Kuding для лечения простуды и гриппа

Этот чай содержит антиоксиданты, которые могут помочь в лечении любой простуды и мух. Это прекрасное средство для выведения жидкости и слизи из носовых пазух и головы. Антиоксиданты могут помочь очистить организм от вирусов.

Сколько чая Кудин можно выпить?

Количество ежедневно потребляемой порции чая Кудин, полезной для здоровья, может варьироваться от человека к человеку.Люди обычно начинают с трех иголок Кудинга на одну чашку чая. Они пьют не менее одной чашки один раз в день. Вы также можете повторно заваривать листья, пока они не потеряют свой аромат. Если вы пробуете чай впервые, то его вкус может показаться вам немного горьковатым. Просто попробуйте добавить еще немного воды, чтобы уменьшить горечь.

Если есть проблемы со здоровьем, то можно выпивать до трех чашек чая в день. Необходимо помочь своему организму избавиться от вирусов.

Чай Кудин Побочные эффекты и противопоказания

Чай Кудин в чистом виде является здоровым и эффективным китайским средством. Тем не менее, есть вероятность возникновения побочных эффектов чая.

Беременность

Из-за охлаждающих свойств чая Кудин не рекомендуется беременным женщинам. Особенно его следует избегать в период грудного вскармливания.

Кофеин

Если вы чувствительны к кофеину, то чай Кудин вам не подходит. Тем не менее чай Кудин содержит кофеин в минимальном количестве.

Низкое кровяное давление

Как уже упоминалось, чай Кудин обладает свойством понижать кровяное давление.Поэтому, если у вас уже были проблемы с низким кровяным давлением, вам следует воздержаться от употребления чая.

Операция

Хирурги не рекомендуют пить чай Кудин за месяц до и после операции. Чай кудин обладает лечебными свойствами для изменения артериального давления, что не рекомендуется, если вы собираетесь на операцию.
#kudingtea #kuding #чай #похудение #зубная боль #breathe #powerlifeinternational #powerlifekudingtea #лекарственные #китайскаямедицина #кровяное давление #холестерин #лечениедиабета

Стоимость чая Кудин в Нигерии (2022)

Чай Кудин стал очень популярным в последнее время. Чай, который происходит из Китая, сегодня является одним из высоко ценимых травяных чаев в Нигерии. Известно, что благодаря своим полезным для здоровья компонентам чай обладает многими целебными свойствами и особенно ценится многими людьми по всей стране.

Поскольку шумиха вокруг чая кудинг становится все громче, в этом посте рассматриваются некоторые важные факты о травяном чае. Здесь мы рассмотрим преимущества чая, возможные побочные эффекты и цену чая на текущем рынке.

Стоимость чая кудинг в Нигерии раскрыта

Оценить, сколько стоит чай кудинг, довольно сложно, поскольку чай бывает разных видов и размеров. Различные бренды производят чай кудин, и каждый из этих брендов упаковывает продукт разного размера и дизайна. Обычно чай для шуток выпускается в виде пакетиков или пачек. Самые маленькие пакетики продаются по цене от 600 до 1000 найр, в зависимости от бренда. Как правило, чай кудин стоит от 600 до 20 000 найр, в основном в зависимости от размера упаковки и марки производителя.

Чай Кудин можно приобрести в различных магазинах травяного чая по всей стране. Для удобства их можно приобрести непосредственно в популярных каналах электронной коммерции, доступных внутри страны и за ее пределами.

Польза чая кудин

Поскольку все говорят о чае кудин, возникает следующий вопрос: стоит ли покупать этот чай? Сегодня чай кудинг становится все более популярным в Нигерии, и хотя несколько человек свидетельствовали о различных преимуществах чая, некоторые другие все еще не знают, для чего именно этот чай является богом.Если вы относитесь к последней категории, этот раздел для вас. Здесь мы рассмотрим различные преимущества чая кудин и то, как он может быть полезен для вашего здоровья и общего самочувствия.

  • Помогает похудеть  — пожалуй, самое распространенное из многих полезных свойств чая кудин. Основываясь на различных исследованиях, проведенных диетологами и учеными в области здравоохранения по всему миру, многие обнаружили, что чай кудин очень полезен для людей, стремящихся похудеть. Они предположили, что кудинг может быть основным ингредиентом в препаратах и ​​добавках против ожирения.Хотя это не было полностью подтверждено ни одним медицинским источником, многие применения чая подтвердили эффект, особенно при правильном использовании.
  • Отлично подходит для печени —  Печень — одна из очень деликатных частей тела, и необходимо соблюдать особые меры предосторожности, особенно когда речь идет о том, что вы принимаете. Многие исследователи предположили, что полисахариды чая кудин очень полезны для печень. Опять же, хотя это не было подтверждено с медицинской точки зрения, многие исследователи предположили, что кудинг содержит полезные для печени компоненты.Однако следует отметить, что этот эффект может быть не очень эффективным для людей, употребляющих большое количество алкоголя, поскольку он может противодействовать эффекту чая.
  • Отлично подходит для лечения диабета и высокого кровяного давления  – Чай Кудин содержит несколько очень полезных компонентов, включая полифенолы, цинк, множество витаминов, аминокислот и флавоноидов. Согласно различным исследованиям, эти компоненты способствуют снижению уровня сахара в крови и значительно контролируют артериальное давление.Это также помогает поддерживать нормальный уровень холестерина. Следовательно, чай прописывают пациентам с высоким кровяным давлением и высоким уровнем холестерина, чтобы помочь им справиться с этим заболеванием. Однако следует отметить, что перед тем, как пациент примет чай, важно обсудить это с врачом, так как могут быть и другие меры предосторожности.
  • Помогает фертильности — Хотя это не было подтверждено в медицинском мире, многие предполагают, что чай в шутку помогает улучшить фертильность.Трава содержит ингредиенты, которые предполагают это, но это зависит от реакции системы организма человека на траву. Это не общее заявление и опять же, не было подтверждено. Если вы хотите принять его, пожалуйста, свяжитесь с вашим врачом.
  • Помогает уменьшить прыщи — Это одно из необычных преимуществ чая кудин. Многие люди считают, что чай помогает уменьшить прыщи и улучшает состояние кожи. Хотя это во многом зависит от реакции системы организма человека на травяной чай, все больше людей подтверждают тот факт, что он помогает уменьшить прыщи и улучшает состояние кожи.Кроме того, при постоянном приеме чай может помочь обуздать неприятный запах изо рта.
  • Отлично подходит при язве –  Еще одно преимущество чая кудин, которое многие заметили, заключается в том, что он содержит ингредиенты, которые могут сдерживать последствия травм желудка.

Меры предосторожности при употреблении чая кудин

Как и многие другие китайские травяные чаи, чай кудин в чистом виде, как правило, безопасен и полезен для здоровья. Тем не менее, есть еще несколько побочных эффектов и мер предосторожности, которые необходимо соблюдать, чтобы избежать осложнений при приеме чая.Например, не рекомендуется принимать чай кудин во время беременности. Это потому, что чай является охлаждающей травой и не подходит для беременных. Его также нельзя принимать кормящей маме.

Следует также отметить, что чай не следует принимать лицам, чувствительным к кофеину. Хотя сам чай содержит кофеин, его количество минимально. Кроме того, чай не следует принимать людям с низким кровяным давлением, так как он может даже снизить кровяное давление. Его следует избегать тем, кто только что перенес операцию или готовится к ней.

Похожие сообщения:

Кудин Ча

Кудин Ча 苦子

Чай Кудин, также известный как «Горький чай», является уникальным китайским чаем. В этом сорте используется более крупный лист, и он менее обработан, поэтому ему не хватает единообразия в представлении, которое предлагают сорта «Royal», но, тем не менее, он все еще очень хорошего качества. Он не попадает ни в одну категорию чая зеленого, черного, улунского или белого чая, которые все сделаны из листьев Camellia Sinensis.Он даже не обязательно попадает в категорию травяных отваров, но в то же время он демонстрирует качества, присущие всем этим категориям, а также проявляет качества эффективного травяного лекарственного средства. Сам чай Кудин изготавливается из листьев падуба категории Ilex или Ligustrum. Чай Кудин производится из листьев широколистного падуба, принадлежащего к семейству Folium Llicis Latifoliae. Согласно записи в Глоссарии доктора-травника, чай Кудин имеет горький вкус и обладает очищающим эффектом.Он лечит головную боль, помогает при зубной боли, конъюнктивите и шуме в ушах. Медицинские исследования показывают, что чай Кудин содержит много важных и терапевтических биоактивных химических веществ, таких как: 22 глицина Кудин, 1,4 аминофенола, 8,8 полифенолов, 41 витамин С, 1,2 флавоноидов и т. д. Было доказано, что чай Кудин является очень ценным напитком для здоровья, который обладает терапевтическими свойствами. обладает охлаждающим, очищающим, алексифармным, антибактериальным действием, снижает кровяное давление и улучшает пищеварение. Эти свойства кудинга наряду с наличием 41 витамина С недавно привели к более конкретным исследованиям, которые в настоящее время проводятся в отношении использования кудинга для эффективного лечения диабетических осложнений, поскольку было обнаружено, что 41 витамин С благотворно влияет на два механизма. диабетических осложнений; гликирование и сорбитоловый путь (Джо А.Винсон, Томас Б. Ховард III). В настоящее время проводится еще одно исследование в этом отношении, которое также выглядит весьма многообещающим, при изучении лечения общих диабетических осложнений с использованием комбинации чая Кудин вместе с американским женьшенем, еще одной полезной травой для пациентов с диабетом.

В китайском языке «Ку» означает горький, описывая вкус, а «Дин» означает гвоздь или небольшой кусочек, указывающий на форму чайного листа. Чай Кудин имеет особый тип горького вкуса, который людям иногда трудно принять при первой встрече.Однако чем больше человек пьет, тем больше он сможет оценить сладкий вкус, сопровождаемый горечью. Кудин, однако, является одним из самых известных сортов чая в истории Китая. Согласно Compendium of Materia Medica (Bencao Gangmu), составленному и написанному в течение двадцати семи лет известным врачом Ли Шичжэнем (1518-1593), лечебные свойства, связанные с чаем Кудин, включают его способность рассеивать тепло ветра, очищать головы и глаз, утоляет жажду, улучшает пищеварение, поддерживает бодрость духа, выводит токсины и уменьшает воспаление, а также то, что сегодня считается его способностью снижать кровяное давление и уровень липидов в крови.Чай Кудин содержит более 200 элементов, включая сапонины Кудин, аминокислоты, витамин С, полифенолы, флавоноиды, кофеин, белок.

Чай Кудин — это традиционный лечебный напиток, известный своими многочисленными целебными свойствами, как указано выше. Он также считается охлаждающим, детоксицирующим, улучшающим кровообращение и помогающим пищеварению. Чай Кудин ценится больше за его ценные целебные свойства, чем за вкус, так как это китайский чай с особенно горьким вкусом. Однако тех, кто любит пить черный кофе, например, это не отпугнёт.Традиционные китайские лечебные свойства, связанные с Кудин, включают его способность рассеивать тепло ветра, очищать голову и глаза и выводить токсины, поэтому он эффективно используется при простуде, рините, зуде глаз, красных глазах и головной боли. Также говорят, что он успокаивает нервозность и утоляет жажду, особенно когда человек страдает от болезни, вызывающей лихорадку или сильную диарею. Он помогает избавиться от мокроты и сырости, облегчает кашель, поэтому используется при лечении бронхита.Наконец, говорят, что он бодрит пищеварение и улучшает умственную концентрацию и память. Современные исследования в настоящее время предполагают, что кудинг способствует циркуляции крови, снижает кровяное давление и снижает содержание липидов в крови, включая холестерин. Он имеет репутацию противовоспалительного средства, предотвращает ухудшение функции сердца и мозга, а также помогает поддерживать правильный вес тела.

Чай Кудин бывает нескольких видов: рассыпной, в форме гвоздя или шарика.Для человека, потребляющего одну чашку за раз, одной чашки чая кудинг достаточно для одной чашки заваривания. Чай Кудин имеет репутацию «чая для здоровья», «чая долголетия» и «чая для похудения» в одной чашке. Было доказано, что чай кудин может уменьшить воспаление и облегчить боль, повысить бодрость, очистить от токсинов, уменьшить жировые отложения, снизить кровяное давление и поддерживать тело в форме.

Примечание: Тем, кто более прохладен, кто легче замерзает, но кто хочет ежедневно употреблять чай Кудин из-за его свойств для похудения, рекомендуется сочетать его потребление с согревающими травами, такими как женьшень хорошего качества, чтобы чтобы тело не замерзло.Это особенно рекомендуется в зимние месяцы. Пример одного традиционного использования можно увидеть в провинции Сычуань, где погода довольно иньская, прохладная и влажная, а жители имеют традицию употребления очень острой пищи. В то время как холодная и влажная погода может легко проникнуть в тело, она выводится через внезапный пот, который вызывает острая пища, и в качестве уравновешивающего фактора чай кудин очень часто употребляется после этих острых блюд, чтобы сбалансировать любое накопление избыточного тепла, которое может привести к расстройству желудка, кислотному рефлюксу и тому подобному.Таким образом, в этом смысле, хотя в летние месяцы, когда может быть довольно тепло и потребление кудинга является желанным охлаждающим фактором, в зимние месяцы следует иметь в виду, что ежедневное потребление должно быть сбалансировано либо с помощью диеты, добавляя дополнительное количество имбиря или базилика. к еде, или к нему можно подойти с согревающей тонизирующей травяной формулой, содержащей такие травы, как женьшень или астрагал.

Происхождение: Аньхой, Китай

Период сбора урожая: 2010

Руководство по завариванию: Заварите один или два шипа или кусочка Royal Kuding в горячей воде при температуре от 175 до 195 F в течение 1–2 минут для первого и второго заваривания.Постепенно увеличивайте время заваривания и температуру для последующего заваривания. Так как этот чай имеет очень концентрированный вкус, рекомендуется заваривать этот чай с меньшим количеством чайных листьев и большим количеством воды.

 

3 Польза чая Kuding для похудения

Все чаи естественным образом содержат большое количество полезных для здоровья веществ, называемых флавоноидами. Некоторые исследования даже показали, что чай может способствовать снижению веса и помогает бороться с жиром на животе. Чай также является напитком, не содержащим калорий, поэтому вы можете выпивать несколько чашек в день, не чувствуя себя виноватыми.Хотя чашка этого травяного чая каждый день вряд ли заставит вас похудеть мгновенно. Исследования показывают, что чай может помочь вам похудеть, если вы сочетаете его со здоровой диетой и физическими упражнениями.

Кудин — растение, произрастающее в Китае. Чай Кудин используется в качестве напитка в Китае более 2000 лет. Это растение применяется как лекарственное растение, а также используется для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Это не чай, а на самом деле приготовленный из листьев падуба категории илекс.В нем нет кофеина и очень горький вкус.

Эта трава имеет богатую историю как продукт для здоровья. К преимуществам чая кудин относятся уменьшение воспаления, выведение токсинов, улучшение пищеварения, улучшение внимания, памяти и других проблем со здоровьем. Регулярное употребление чая Кудин помогает снизить кровяное давление и контролирует ожирение. Чай Кудин считается эффективным средством для похудения. Есть некоторые исследования, которые предполагают, что чай кудин является полезной диетической терапией и потенциальным источником для разработки новых препаратов против ожирения и снижения липидов.

Польза чая кудин для похудения http://

1. Блокирование набора веса

Этаноловый экстракт чая кудин был протестирован и изучен на мышах с ожирением. При лечении ЭК блокировала увеличение массы тела, уменьшала размер адипоцитов, снижала уровень триглицеридов в сыворотке, холестерина, холестерина ЛПНП, уровень глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших диету с высоким содержанием жиров (1).

2. Снижение веса воды

Вода обычно составляет от 50 до 60 процентов от общей массы тела взрослого человека.Дополнительная вода, удерживаемая в организме, называется «массой воды». Эта дополнительная вода может вызвать вздутие живота и отечность, особенно в области живота, ног и рук. Полезные свойства чая Кудин для похудения уменьшают задержку воды. Он улучшает кровообращение, выводит токсины из организма, так как содержит антиоксиданты, а также помогает перевариванию пищи.

3. Ускоряет метаболизм

Употребление чая способствует ускорению метаболизма и детоксикации организма. Говорят, что польза чая кудин для похудения помогает подавить аппетит и повысить метаболизм.Регулярное его употребление может помочь ускорить процесс похудения. Хотя научных доказательств этому не так много, употребление чая увеличивает метаболизм и помогает насытиться перед едой. По крайней мере, горький вкус может удержать вас от желания есть что-либо потом.

Суть в том, что необходимо провести дополнительные исследования, чтобы подтвердить преимущества чая кудинг для похудения. Чай — невероятный напиток, который может улучшить общее состояние здоровья множеством способов. Большинство чаев обладают свойствами, которые могут ускорить обмен веществ и помочь вашему организму быстрее расщеплять жиры.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *