Гриб линчжи лечебные: Гриб Линчжи: лечебные свойства


Гриб Линчжи: лечебные свойства

В последние годы все более популярными становятся разные натуральные снадобья, приготовленные по древним рецептом восточной медицины. Одно из таких снадобий — гриб Линчжи (Рейши), лечебные свойства которого называют волшебными. Уникальность этого трутовика признают даже медики, а знахари называют его «грибом бессмертия».

Несколько слов о Линчжи (Рейши)

Линчжи или трутовик лакированный известен восточным лекарям многие тысячелетия. Найти его в дикой природе довольно проблематично, так как к условиям произрастания он капризен. Местонахождение зарослей дикой сливы, на которой любят селиться споры этого гриба, всегда держалось в секрете и не открывались никому.

За свои целебные качества грибы Линчжи ценились очень дорого, и тот, кому повезло его найти, мог долго жить безбедно. Сегодня открыта технология искусственного выращивания «грибов бессмертия», хотя народные целители утверждают, что лечебные свойства оранжерейных грибов не обладают достаточной силой.

Но ученые смогли доказать, что трутовики, выращенные в искусственных условиях, ничем не отличаются от тех, что выросли в дикой природе.

Уникальные свойства Линчжи

О целебных возможностях этого гриба восточные врачеватели знали давно, но и современные ученые подтвердили его уникальность.

Гриб-трутовик содержит в себе 13 видов необходимых человеку аминокислот, большое разнообразие витаминов — В, С, D, E, белки, бета-кератин, ненасыщенные жирные кислоты. В него входит широкий спектр минеральных веществ, таких как кальций, калий, железо, магний, цинк, марганец, а также более 80 различных ферментов.

Обладая таким богатым составом, он может повышать иммунитет, активизировать обмен веществ, улучшать общее самочувствие организма. А еще он наделен антивирусными, антистрессовыми, восстанавливающими, увлажняющими свойствами, а также возможностью омолаживать организм. Начните регулярно принимать капсулы линчжи Linh Chi OPC

, и скоро заметите их потрясающий эффект

Что лечит трутовик Рейши?

Широта его воздействия просто поражает! Он нормализует давление и обладает сильнейшим противоопухолевым эффектом, лечит аллергические заболевания и оказывает антимикробное действие. Хорошо известно благотворное влияние гриба Линчжи из Вьетнама на сердечнососудистую деятельность, нервную и иммунную системы.


Он может побеждать многие скрытые инфекции и болезни, которые признаны неизлечимыми официальной медициной. Врачи рекомендуют применять его при бронхиальной астме и сахарном диабете. Причем все это при полном отсутствии побочных эффектов.

А еще уникальный «природный целитель» укрепляет и тонизирует организм, заряжая его жизненной энергией. Выпейте чая с экстрактом гриба Линжи — вы сразу ощутите бодрость духа и состояние комфортности.

Научные исследования влияния грибов Линчжи на организм человека подтверждают, что они оказывают комплексное воздействие. Такое «открытие» еще раз подтвердило уникальность трутовика, и даже современные врачи рекомендуют применять его наряду с медикаментозными препаратами.

Гриб Линчжи в косметологии

Нашел гриб Линчжи применение и в косметологии. Он становится на защиту эпителий от разрушительного действия свободных радикалов, замедляет естественные окислительные процессы, что существенно влияет на состояние кожи. Начните прием капсул LING ZHI — F, содержащих высококонцентрированный препарат, и вы заметите, как за короткий срок ваша кожа станет красивой и здоровой.

Маски с экстрактом сделают ее упругой, разгладят мелкие морщины, а глубокие возрастные станут не такими заметными. Одновременно улучшится цвет лица, повысится тонус, сузятся поры, в результате кожа надолго сохранит молодость.

Экстракт гриба Линчжи обычно выпускается в капсулах. Из него делают спиртовые настройки, отвары или завариваю чай. И хотя он считается безвредным природным средством, перед употреблением Линчжи внимательно изучите инструкцию о его применении.

Гриб Линчжи — отзывы: Вся правда, Лечебные Свойства

Лечебные свойства гриба Линчжи объясняются его богатейшим составом, отзывы врачей, вся правда и как правильно принимать гриб Линчжи узнать в интернет магазине Товаров Тайланда OrganicThai.

Гриб Линчжи (Рейши) — сапрофит, живущий на деревьях в основном лиственных пород. В Китае Линчжи или Рейши назвают грибом долголетия, дарующим вечную молодость. В сборнике народной китайской медицины из 365 разных лекарственных препаратов имеет одно из высших мест и является более эффективным, чем женьшень. У него очень твердая структура, цвет от желто до красно-черного. При сушке гриб линчжи не дает усадки и полностью сохраняет свою первоначальную форму.

Из-за горького вкуса непригоден как просто съедобный гриб, его используют при лечении и предупреждении множества заболеваний, в виде порошка в капсулах, в лечебных чаях и в качестве добавки в косметике.

Традиционная медицина, как известно, весьма скромно относится к подобным препаратам и методикам народного лечения, однако к линчжи она оказалась благосклонна.

Китайский гриб линчжи по отзывам врачей:

  • рейши однозначно нетоксичен;
  • не имеет никаких побочных действий, а это крайне редкое явление;
  • ганодерма оказывает комплексное воздействие, а не лечит какой-то отдельный орган. 

Благодаря таким качествам китайские врачи, представители традиционной медицины, в отдельных случаях рекомендуют применять грибы линчжи наряду с медикаментозными препаратами в качестве поддерживающей терапии.

Лечебные свойства гриба Линчжи обуславливаются его богатым химическим составом. Гриб рейши содержит углеводы, белки, жиры, незаменимые для человека аминокислоты, богат витаминами В, С, D, отличается высоким содержанием минералов, таких как магний, кальций, цинк, марганец, железо, медь, германий, селен, фосфор, желез и кальций. Мякоть гриба линчжи насыщенна полисахаридами. Кроме того он не токсичен, не имеет побочных действий и воздействует комплексно. В народной китайской медицине он применяется при заболеваниях печени и почек, желудочно-кишечных расстройствах, ишемической болезни сердца.

С самого начала приема отвара значительно улучшается сон, повышается настроение, исчезают головные боли, повышается сопротивление организма к болезням и улучшается общий жизненный тонус, замедляя процесс старения. Человек более устойчив к различным нагрузкам и легче принимает эмоциональные переживания.

Гриб помогает при восстановлении после мышечного истощения, что особенно важно спортсменам. За счет изменения уровня холестерина в крови он применяется при профилактике атеросклероза, инсультов, связанных с гипертонией, препятствует появлению тромбов и улучшает снабжение мозга кровью. Снижение кровеносного давления происходит более плавно. Этот препарат обладает негормональным противоаллергическим действием, улучшает состояние при бронхиальной астме и аллергическом рините. Он улучшает обменные процессы в коже, стимулирует обновление и регенерацию тканей, замедляет процесс старения и заметно омолаживает кожу.
Купить капсулы гриба линчжи (Секрет вечной молодости), узнать отзывы здесь.

Первое свойство гриба линчжи — это мощное противоопухолевое действие. При приёме экстракта идет регресс различных опухолей и доброкачественных, и злокачественных. В Тайланде всегда не теряющие веру родственники больных с опухолью, которым медики объявили «смертный приговор», искали Линчжи, поскольку это был самый лучший путь спасения.

Гриб Линчжи как правильно принимать?

Традиционный способ использования «lingzhi» — это чай из сухого гриба, для приготовления нужно взять 3 — 4 ломтика сушеного продукта, замочить на ночь в 500 мл холодной воды. Затем, жидкость довести до кипения и варить на слабом огне 5 – 10 минут, остудить, профильтровать, хранить в холодильнике, принимать по 0,5 стакана 2 раза в день за 30 минут до еды. Чай имеет горький вкус, можно добавить мед или фруктовый сок.

Купить Линчжи (гриб сухой, нарезанный) для заваривания чая, узнать отзывы можно здесь.

Грибы линчжи: лечебные свойства, применение.

Что такое линчжи

Научное название гриба – трутовик лакированный. Среди корейских и китайских лекарей он тысячелетиями пользовался уважением. Само название «линчжи» с китайского переводится как «растение бессмертия». Японцы относились к нему тоже с большим почтением и именовали грибом духовной силы («рейши»). В природе этот трутовик найти достаточно сложно – он капризен к условиям произрастания. Поэтому знахари, нашедшие его заросли, держали их в большом секрете: плантации, где размножаются грибы линчжи, становились бесценным приданым и могли обеспечить безбедное существование нескольким поколениям. Стоили они дороже, чем золото аналогичного веса. И до 1972 года, пока не был открыт секрет оранжерейного выращивания ганодермы, она была доступна только очень богатым людям. Правда, традиционные знахари не слишком одобряют «искусственный» гриб линчжи: лечебные свойства его, как они считают, не набирают полной силы из-за определенных ограничений условий произрастания. Однако, с научной точки зрения, оранжерейный трутовик ничем не отличается от выросшего в дикой природе.

Что лечит рейши

Как показывает практика восточных целителей, спектр применения ганодермы весьма широк. Вы готовы довериться азиатской мудрости и попробовать гриб линчжи? Лечебные свойства его таковы, что растение может помочь в следующих случаях:

  1. Профилактика и лечение раковых заболеваний. Еще более успешно его воздействие на доброкачественные опухоли.
  2. Нормализация сердечной деятельности. Особенно эффективны грибы линчжи при стенокардии и аритмии.
  3. Выраженный эффект наблюдается при разного рода патологиях легких и бронхов.
  4. Явные результаты дает лечение ганодермой вирусных и бактериальных инфекций. Причем ему поддаются герпес, хламидиоз, трихомонелез – скрытые протекающие инфекции, которые официальная медицина признает неизлечимыми.
  5. При лечении остеопороза, артроза, остеохондроза, полиартрита также полезным может оказаться гриб линчжи. Отзывы людей, испытавших на себе действие этого средства, гласят, что после курса терапии улучшилось состояние, симптомы стали не такими выраженными.
  6. Наиболее сильно проявляются свойства гриба линчжи в отношении аллергических реакций. Для борьбы с аллергиями это народное лекарство особенно активно и охотно используют в Таиланде.
  7. Действуют грибы линчжи и на нервную систему. Восточные целители уверяют, что трутовики в состоянии устранить мигрень, которая признана неизлечимой, значительно ослабляют и отдаляют болезнь Альцгеймера, делают более мягким протекание вегетососудистой дистонии, способствуют устранению депрессии, успешно борются с проявлениями болезни Паркинсона и нормализуют память при возрастном ее ослаблении.

“Побочным явлением” принятия экстрактов из трутовика является повышение стрессоустойчивости человека.

Купить препараты из гриба Линчжи можно на нашем сайте https://asiarf.ru/?s=линчжи&post_type=product&dgwt_wcas=1

Гриб линчжи: отзывы врачей

Официальная медицина, как известно, весьма настороженно относится к излюбленным препаратам и методикам народной. Однако к трутовику она оказалась благосклонна. “Официалами” признаны целых три особенности, которыми обладает китайский гриб линчжи. Отзывы медиков в этом плане единодушны: рейши однозначно нетоксичен; трутовик не имеет никаких побочных действий, а это крайне редкое явление; ганодерма оказывает комплексное воздействие, а не лечит какой-то отдельный орган. Благодаря таким качествам китайские врачи, представители традиционной медицины, в отдельных случаях рекомендуют применять грибы линчжи наряду с медикаментозными препаратами в качестве поддерживающей терапии.

Правила приема

Сразу скажем: как бы ни был хорош гриб линчжи, отзывы целителей о нем предупреждают, что не стоит это средство воспринимать как панацею от всех бед. Помимо употребления лекарств на основе трутовика, стоит прислушиваться к рекомендациям врача, не забывать о правильном питании и здоровом образе жизни. Если беспрестанно гробить организм, то никакое чудо-средство его не спасет. Мало того, нужно помнить о разумном употреблении любых народных средств и препаратов, к которым, несомненно, относится и гриб линчжи. Применение его будет действенно только в том случае, если принимать снадобье долго – как минимум полгода. Стоит заметить, что обычно в упаковке лежит инструкция, регламентирующая режим применения. И в большинстве случаев там предлагается сразу принимать по 2 таблетки (капсулы) трижды в день. Однако люди, знакомые с принципами тибетской медицины, такие предписания называют сомнительными: в ней приветствуется постепенность и плавность. Так что начинать лучше, по их словам, с одной таблетки дважды в сутки, спустя неделю переходить к двум по тому же расписанию, и только после – к приему по рекомендациям производителя. Не стоит также употреблять грибы линчжи после четырех часов дня. Они в значительной мере стимулируют физическую активность, что может привести к бессоннице или ночному беспокойству.

Кому нужно соблюдать осторожность

Как таковых противопоказаний экстракт гриба линчжи не имеет. Однако некоторые ограничения все же вводятся, как и в случае использования любого лекарственного средства.

  1. На значительных сроках беременности объемы принимаемого снадобья должны быть снижены. Допустимый максимум – одна капсула в сутки. Нанести ущерб плоду или здоровью будущей матери грибы линчжи не в состоянии, но могут спровоцировать очистку организма, что осложнит протекание беременности.
  2. Если пациент перенес геморрагический инсульт, прием препарата разрешен только через полгода после него. Ишемический вариант допускает начало немедленного лечения.
  3. Не стоит принимать экстракт гриба линчжи слишком долго: вы можете “разбаловать” свой организм, и он переложит все свои защитные функции на препарат. Иногда иммунная система должна вспоминать о том, что ей положено работать. Так что между курсами целители рекомендуют делать длительные перерывы. Это обязательно.

И не стоит забывать, что существует такая неприятность, как индивидуальная непереносимость. Если грибы линчжи для вас в новинку, вводите их в рацион понемногу, прислушиваясь к своим ощущениям.

Грибы против рака

Обратим внимание на специфические направления использования трутовика. Почти на официальном уровне признан высокий противоопухолевый эффект линчжи. Грибы содержат два компонента, которые противостоят раку. Первый – активные антионкологические полисахариды, которые активизируют макрофаги и стимулируют деятельность Т-лимфоцитов. И те, и другие являются мощным препятствием для образования метастаз и губительно действуют на уже существующие раковые клетки. Второй помощник – терпеноиды. Они предотвращают накопление свободных радикалов, тем самым не давая опухоли возможности зародиться. Конечно, в качестве единственного средства борьбы с раком грибы линчжи вряд ли можно рекомендовать, поскольку заболевание это очень опасно и коварно. Однако ряд исследований убедительно доказал: если один раз в год употреблять курсом экстракт ганодермы, можно защитить себя от возникновения опухолей. Так что в качестве профилактики рейши однозначно успешен. В процессе же лечения поддерживающий курс эффективно локализует опухоли, замедляет их развитие и облегчает общее состояние больного.

Скажем аллергии «Нет!»

В основе антиаллергенного воздействия лежат противомикробные способности, которыми обладает экстракт гриба линчжи. Отзывы пациентов и врачей в этом отношении сходятся: трутовик не подавляет активность микробов, а убивает сами микроорганизмы. Параллельно улучшаются все виды обмена веществ человека. Конечно, лечение аллергии с помощью рейши – процесс затяжной и займет не меньше года, а скорее, даже два. Зато, по словам практиков восточной медицины, он не сопровождается никакими побочными проявлениями, а аллергия уходит навсегда. Причем вместе со своими последствиями вроде бронхиальной астмы или атопического дерматита.

Борьба с сахарным диабетом

За нее отвечают входящие в состав линчжи полисахариды, получившие название Ganoderan A, B и С. Единым фронтом вместе с ними выступают и белковые производные. Они естественным образом выравнивают содержание сахара в крови и поддерживают его на нужном уровне. По словам специалистов, огромным достоинством экстракта этого гриба является то, что он может применяться постоянно, поскольку не накапливается в организме человека и не несет с собой никаких побочных воздействий. В плюсы можно записать и невозможность передозировки. Кроме того, пропуск приема не скажется моментально на здоровье, поскольку предыдущие дозы имеют пролонгированное действие. Еще одним бонусом можно счесть улучшение заживляемости тканей. Как известно, диабетики часто страдают даже от небольших ранок, которые зарастают с большим трудом. Препараты, имеющие в основе грибы линчжи, ускоряют и налаживают этот процесс. Еще одно благоприятное воздействие экстракта – постепенное приведение в норму обмена веществ у больного. В результате удается избежать огромного количества типичных осложнений, вызванных данными нарушениями и характерных для сахарного диабета.

Линчжи в косметологии

Раз трутовик – “гриб бессмертия”, значит, эти качества он должен передавать и внешности человека, ну хотя бы в некоторой мере. Китайские косметологи широко используют его для создания чудо-кремов для кожи. Специалисты говорят, что ганодерма предотвращает проникновение в эпителий разрушительных свободных радикалов, стабилизирует на нужном уровне синтез необходимых нуклеиновых кислот и снижает интенсивность естественных окислительных процессов. В результате замедляется старение кожных покровов, клеточное деление усиливается, регенерация покровов возвращает кожу к молодому состоянию. Отзывы людей, испытавших действие гриба-трутовика на себе, подчеркивают, что кожа становится заметно более упругой, мелкие морщинки разглаживаются, а возрастные становятся менее глубокими. Параллельно улучшается ее цвет, сужаются поры. В результате кожа становится более гладкой и здоровой на вид.

Трутовик для похудения

Это направление больше всего испортило репутацию целительного гриба в глазах международного (и российского в том числе) общества. Тем не менее, гриб линчжи для похудения применяется довольно активно. Действовать он, теоретически, должен сразу в нескольких направлениях. Во-первых, подавлять аппетит, в результате чего в первую же неделю должно снизиться потребление продуктов питания. Во-вторых, нормализовать и стимулировать работу печени, которая за счет этого будет эффективнее расщеплять поступающие в организм высокопитательные вещества. В-третьих, ускорять метаболизм, включая в сферу его действия имеющуюся жировую прослойку, которая должна фактически сгорать под воздействием рейши. Судя по отзывам, для достижения желаемого эффекта можно пойти тремя путями:

  1. Употреблять настой гриба. Растертый трутовик заливается теплой водой из расчета полстакана на чайную ложечку и во взболтанном состоянии выпивается залпом (трижды за световой день).
  2. Напар. Две ложечки измельченного линчжи заливаются стаканом кипятка и парятся на водяной бане четверть часа. Снадобье принимается перед едой по большой ложке.
  3. Готовые капсулы – между прочим, самый простой, но наименее одобряемый знахарями способ. Пьют препарат три раза, перед каждым приемом пищи, с небольшим количеством воды. И не меньше, чем за полчаса до того, как вы возьметесь за ложку.

Уже есть довольно много людей, использовавших гриб линчжи для похудения. Отзывы прошедших подобный курс далеко не однозначны. Впрочем, особо восторженных найти не удалось. Обещанных 20 килограммов за два месяца не потерял никто, а утрату трех можно списать и на эффект плацебо. Снижение аппетита отмечено незначительное. И, может быть, оно вызвано памятью о том, во сколько обошелся экстракт гриба линчжи. Метаболические изменения, если они и произошли, замерить в домашних условиях невозможно. Одним словом – сплошные разочарования. С другой стороны, это же можно сказать и о любом средстве для похудения. Желающие сбросить лишние килограммы как-то выпускают из виду, что прием таблеток/капсул/экстрактов должен сопровождаться активными телодвижениями, без которых высвобожденной энергии не на что расходоваться. И указаниями производителя на необходимость занятий спортом или просто регулярных прогулок большинство из нас пренебрегают. Так стоит ли в этом случае нарекать на то, что гриб линчжи (для похудения якобы – самое то!) не обеспечил желаемого результата? Все же без малейших усилий со стороны хозяина, с помощью только “волшебных таблеток”, тело вряд ли в состоянии похудеть.

Особая благодарность за предоставленный материал fb.ru – огромное количество интересных и полезных статей обо всем!

фото, лечебные свойства, биологическое описание, выращивание, применение, отзывы врачей, видео

Грибы Линчжи очень популярны в Тайланде, Китае и Вьетнаме. Из них делают различные снадобья, обладающие поистине уникальными свойствами. Интересно, что силу грибов подтверждает даже официальная медицина.

Описание вида

Китайский гриб линчжи по-другому называют трутовиком лакированным. Его издавна называют «растением бессмертия». В Японии гриб тоже в почете, считается, что он придает духовную силу.

В природе найти линчжи непросто. Поэтому раньше местонахождение гриба держалось в строгом секрете. Его умели искать только избранные, а свои знания они передавали из поколения в поколение. С 1972 года линчжи стали выращивать в оранжереях. Однако считается, что природный гриб обладает более сильными лечебными свойствами.

Химический состав гриба очень сложный. В нем присутствуют микроэлементы, полисахариды и органические кислоты. Также в нем есть витамины и кумарины, фитонциды. Самые важные соединения Рейши – это тритерпины, германий, ганодермовые кислоты. Именно они придают грибу лечебные характеристики.

Основные элементы гриба и их действие

Чем обусловлена полезность линчжи? Некоторые его элементы обладают уникальными свойствами:

  • Полисахариды. Очищают организм от токсинов, укрепляют иммунитет, балансируют концентрацию сахара в крови.
  • Германий. Повышает метаболизм, увеличивают концентрацию кислорода в крови, помогает контролировать свободные радикалы.
  • Ганодермная эссенция. избавляет от ранок во рту, помогает органам работать нормально, лечит заболевание кожи.
  • Тритерпеноид. Облегчает болевые ощущения, защищает от аллергии, сжигает жиры.
  • Аденозин. Повышает жизненный тонус, уменьшает концентрацию холестерина, регулирует обмен веществ, повышает циркуляцию крови, предотвращает формирование тромбов.

Гриб линчжи: выращивание (видео)

Лечебные свойства

Применение рейши (линчжи, ганодермы) идет очень активно. Гриб может помочь в ряде случаев:

  • Как профилактическое средство от рака;
  • Нормализует деятельность сердца;
  • Помогает справиться с патологиями легких;
  • Применяется против бактериальных инфекций;
  • Используется при лечении остеопороза;
  • Против аллергических реакций;
  • Для воздействия на нервную систему;
  • Для устранения мигрени;
  • Для ослабления болезни Альцгеймера;
  • Устраняет депрессию;
  • Ослабляет выраженность симптомов болезни Паркинсона;
  • Нормализует память.

Что касается побочных действий – оно одно, да и то, рассматривать его как побочное многие постесняются. Это повышение устойчивости человека к стрессам.

Особенности выращивания

В основном для того чтобы получить экстракт гриба, его выращивают в промышленных масштабах. Для развития рейши важна экологическая чистота места и правильный посев. Важно имитировать те условия, которые получает гриб в природе.

Можно вырастить линчжи и в пробирке. Но такой способ является незатратным. Выращивание при помощи гидропоники набирает большую популярность, в особенности при разведении лечебных грибов. Процесс идет следующим образом – в специальные пробирки помещают нити грибов. Они стоят в течение нескольких дней, затем появляется нужная биомасса. Затем ее соскабливают для дальнейшей обработки.

Тем не менее, наиболее ценными остаются линчжи, выращенные в природе, в особенности на горе Тайшань. Продают гриб в разных формах – порошок, целыми, порезанными, в качестве экстракта, в составе добавок, в чае.

Как правильно употреблять Ганодерму

Всего существует больше 10 рецептов употребления гриба. Но чаще всего принимать его рекомендуют следующими способами:

  • Заварить в термосе на несколько часов и пить.
  • Измельчить гриб (2 столовые ложки), залить 350 мл. воды, поставить на огонь и прокипятить. Проварить 5 минут, залить отвар в термос и настаивать 12 часов. Отвар можно хранить в холодильнике 2 дня.
  • Взять одну столовую ложку порошка гриба, залить 0,5 л. воды, поставить на огонь и варить в продолжение часа. Принимать 3 раза в день во время еды по 1 ст. ложке.
  • Просто добавлять порошок, состав которого очень полезен, в разные блюда за 7 мину до готовности.

Отзывы врачей

Отзывы врачей о Рейши по большей части положительные. В основном гриб применяют те, кто страдает от аллергии и болезней печени. При приеме препаратов с экстрактом гриба в капсулах следует строго следовать схеме – по 1 капсуле пару раз в день. Через неделю дозировку средства увеличивают до 2 капсул.

Важно! В начале приема средства пациенты могут чувствовать легкое недомогание, к примеру тошноту. Но такой эффект проходит уже спустя неделю. При этом за неделю можно увидеть и множество положительных изменений:

  • Пропадает пигментация на коже;
  • Исчезает герпес;
  • Исчезают головные боли;
  • Нормализуется сон;
  • Пропадает запах пота.

Однако вместе с выводом вредных веществ при использовании Линчжи могут возникать грибковые поражения. Стоит отметить, что также не стоит пить иммуностимулятор долгое время, иначе ваш иммунитет перестанет работать.

Особенности линчжи (видео)

Противопоказаний к применению гриба немного. Не стоит использовать в пищу линчжи тем, у кого есть склонность к кровотечениям, беременным женщинам и детям до 1 года. Также не стоит есть гриб тем, кто кормит грудью.

Итак, рейши – уникальный гриб, который способен существенно повысить ваш иммунитет. Но чтобы эффект от него был положительным, применять его стоит правильно. 

Ученые обнаружили новые целебные свойства древесного гриба


Ученые обнаружили новые целебные свойства древесного гриба

Ученые обнаружили новые целебные свойства древесного гриба — РИА Новости, 08.10.2020

Ученые обнаружили новые целебные свойства древесного гриба

Трутовик, или галодерму лакированную давно применяют как в традиционной восточной медицине, так и в официальных иммуномодулирующих и противовоспалительных… РИА Новости, 08.10.2020






южная корея





МОСКВА, 8 окт — РИА Новости. Трутовик, или галодерму лакированную давно применяют как в традиционной восточной медицине, так и в официальных иммуномодулирующих и противовоспалительных препаратах. Теперь же корейские ученые доказали, что этот гриб можно использовать и для лечения кожных заболеваний. Результаты исследования опубликованы в журнале Food Chemistry.Трутовик лакированный Ganoderma lucidum широко известен как лекарственный гриб под названием линчжи в Китае, рейши в Японии и ёнджи в Корее. В традиционной медицине этих стран его используют уже более двух тысяч лет. Экстракты и порошки из высушенных грибов применяют для лечения астмы, неврастении, гастрита, диабета, болезней печени и всех видов аллергии. В России гриб занесен в Красную книгу.Исследования последних десятилетий показали, что активный ингредиент гриба — ганодеровые кислоты — прекрасно усиливают иммунную функцию клеток, оказывают противоопухолевое, противовирусное, антибактериологическое, гепатопротекторное, противовоспалительное, противоаллергенное, антиоксидантное действие, регулируют работу сердечно-сосудистой, дыхательной и нервной систем. Ученые из Корейского института науки и технологий (KIST), которые проводили исследования противовоспалительного, антидиабетического и антиоксидантного эффектов Ganoderma lucidum, обнаружили, что ганодеровые кислоты эффективны против воспалений кожи и могут применяться при лечении таких кожных заболеваний, как псориаз и атопический дерматит.Кроме того, ученые определили оптимальные условия извлечения активного компонента из гриба. Они выяснили, что при длительной сушке или экстракции при высокой температуре — более 80 градусов Цельсия — активный ингредиент разрушается.Наиболее эффективной с точки зрения объема извлечения ганодеровых кислот оказалась сушка горячим воздухом при 60 градусах Цельсия, а наибольшая антиоксидантная и противодиабетическая активность была достигнута при сублимационной сушке гриба при минус 50 градусах Цельсия.»Поскольку эффективность грибов ёнджи зависит от условий извлечения, методы сушки и экстракции следует выбирать в соответствии с целью использования, — приводятся в пресс-релизе института слова руководителя исследования, доктора Хо Ён Ким (Ho-Youn Kim). — Мы надеемся, что результаты этого исследования не только повысят полезность гриба, но и приведут в будущем к разработке терапевтических средств для лечения воспалительных заболеваний кожи».Для изучения противовоспалительного действия гриба на клетки кожи авторы провели лабораторный эксперимент на кератиноцитах — основных клетках эпидермиса человека. Результаты показали, что экстракт Ganoderma lucidum, полученный сушкой горячим воздухом, эффективно подавляет воспаление.



южная корея

РИА Новости


7 495 645-6601

ФГУП МИА «Россия сегодня»



РИА Новости


7 495 645-6601

ФГУП МИА «Россия сегодня»






РИА Новости


7 495 645-6601

ФГУП МИА «Россия сегодня»



РИА Новости


7 495 645-6601

ФГУП МИА «Россия сегодня»


РИА Новости


7 495 645-6601

ФГУП МИА «Россия сегодня»


здоровье, южная корея, питание

МОСКВА, 8 окт — РИА Новости. Трутовик, или галодерму лакированную давно применяют как в традиционной восточной медицине, так и в официальных иммуномодулирующих и противовоспалительных препаратах. Теперь же корейские ученые доказали, что этот гриб можно использовать и для лечения кожных заболеваний. Результаты исследования опубликованы в журнале Food Chemistry.Трутовик лакированный Ganoderma lucidum широко известен как лекарственный гриб под названием линчжи в Китае, рейши в Японии и ёнджи в Корее. В традиционной медицине этих стран его используют уже более двух тысяч лет. Экстракты и порошки из высушенных грибов применяют для лечения астмы, неврастении, гастрита, диабета, болезней печени и всех видов аллергии. В России гриб занесен в Красную книгу.

Исследования последних десятилетий показали, что активный ингредиент гриба — ганодеровые кислоты — прекрасно усиливают иммунную функцию клеток, оказывают противоопухолевое, противовирусное, антибактериологическое, гепатопротекторное, противовоспалительное, противоаллергенное, антиоксидантное действие, регулируют работу сердечно-сосудистой, дыхательной и нервной систем.

Ученые из Корейского института науки и технологий (KIST), которые проводили исследования противовоспалительного, антидиабетического и антиоксидантного эффектов Ganoderma lucidum, обнаружили, что ганодеровые кислоты эффективны против воспалений кожи и могут применяться при лечении таких кожных заболеваний, как псориаз и атопический дерматит.

24 января 2020, 17:29НаукаУченые нашли древнейшие грибы на Земле

Кроме того, ученые определили оптимальные условия извлечения активного компонента из гриба. Они выяснили, что при длительной сушке или экстракции при высокой температуре — более 80 градусов Цельсия — активный ингредиент разрушается.

Наиболее эффективной с точки зрения объема извлечения ганодеровых кислот оказалась сушка горячим воздухом при 60 градусах Цельсия, а наибольшая антиоксидантная и противодиабетическая активность была достигнута при сублимационной сушке гриба при минус 50 градусах Цельсия.

«Поскольку эффективность грибов ёнджи зависит от условий извлечения, методы сушки и экстракции следует выбирать в соответствии с целью использования, — приводятся в пресс-релизе института слова руководителя исследования, доктора Хо Ён Ким (Ho-Youn Kim). — Мы надеемся, что результаты этого исследования не только повысят полезность гриба, но и приведут в будущем к разработке терапевтических средств для лечения воспалительных заболеваний кожи».

Для изучения противовоспалительного действия гриба на клетки кожи авторы провели лабораторный эксперимент на кератиноцитах — основных клетках эпидермиса человека. Результаты показали, что экстракт Ganoderma lucidum, полученный сушкой горячим воздухом, эффективно подавляет воспаление.

3 декабря 2019, 08:59НаукаУченые открыли соединения с гербицидным потенциалом из морского гриба

Польза, лечебные свойства гриба Рейши Ганодерма,

Гриб Линчжи или Ганодерма в Китае называют грибом Бессмертия.  Давайте будем рассматривать этот гриб, только с научной точки зрения и доказательной медицины.

В Японии этот гриб называют Рейши, а в Корее Енжи. А другое его название трутовик лакированный и гриб Ганодерма. Выпускается он в виде капсул, где очень удобно, уже подобрана дозировка. А так же есть в виде нарезанных цельных пластинок гриба. Тогда от вас требуется строго по инструкции заваривать и настаивать такой чай.

И так, в чем такая уникальность и польза данного гриба Линчжи?

Что мы видим в составе этого азиатского чуда Ganoderma lucidum? Он содержит: углеводы, аминокислоты, пептиды, белки, тритерпены, включая стероиды, липиды, алкалоиды, гликозиды, летучие эфирные масла, витамины, микроэлементы, такие как магний, марганец, молибден, кальций, цинк, калий, натрий, железо, медь, сера, германий и еще порядка 200 соединений.

И чем же так интересны научному миру тритерпены, которых в составе гриба очень много?

Уже десятки лет назад научный мир получил подтверждение тому, что тритерпены способный токсично действовать на опухолевые клетки, так же они обладают свойствами анти вич ктивностью, противовоспалительными свойствами, противомалярийной активностью и улучшают стрессоустойчивость.

Тритерпены, выделенные из гриба Линчжи, изучались как противоопухолевое средство при быстротекущем опухолевом заболевании меланома. Где показали прекрасные результаты. На их основе ведется разработка новых медицинских препаратов. Это вещество активно запускает процесс гибели (апоптоз) опухолевых клеток.

Ганодерновые кислоты уменьшают аллергические реакции, защищают клетки печени от токсинов, способствуют снижению артериального давления, тормозят синтез холестерина в печени.

Германий, который в достаточном количестве содержится в этом грибе, обладает доказанной противоопухолевой активностью, повышает устойчивость к вирусам, уменьшает кислородное голодание, выводит токсины из тканей и улучшает проводимость нервных импульсов в головном мозге. И заметьте, его содержится в грибе в десятки раз больше, чем в корне женьшеня.

Первые упоминания о грибе Линчжи находим в традиционной китайской медицине, аж 2000 лет назад. Азиатская медицина считает его наивысшим грибом, с мощными целебными свойствами.

Нуклеозиды в спорах гриба Рейши включают в себя аденин, аденозин и урацил, обладающие активным физиологическим эффектом. Аденозин великолепно препятствует образованию тромбов, улучшает нервную проводимость. Он обладает способностью расширять коронарные артерии и улучшать кровоток, особенно в сердечной мышце.

Остальные вещества в составе, каждый сам по себе, обладают массой полезных свойств. Причем состав сбалансирован настолько, что восхищает.

Когда ученые узнали о таком колоссальном наборе полезных свойств гриба Ганодерма, его стали выращивать в специальных теплицах. И от этого гриб Линьчжи не потерял своих чудесных свойств.

И так, при каких заболеваниях гриб Ганодерма может вам помочь?

  • Снижение иммунитета,
  • аутоиммунные заболевания,
  • в период лечения опухолевых заболеваний,
  • аллергия,
  • гипертония,
  • высокий холестерин
  • коррекция сахара крови,
  • уменьшает вязкость крови,
  • неврологические дегенеративные заболевания,
  • заболевания печени (гепатоз, цирроз),
  • снижает уровень свободных радикалов,
  • аритмия, стенокардия,
  • астма, бронхиты
  • профилактика обострений герпеса,вируса Эпштейн Барр,
  • вегетососудистая дистония, тревожные расстройства,
  • атеросклероз сосудов,
  • терапия после инфаркта и инсульта,
  • во время прохождения лучевой терапии, для снижения вредного воздействия радиации.

Вот такой вот он чудесный гриб GANODERMA LUCIDUM. Конечно, что бы получить результат от лечения, его необходимо принимать длительно, так как он обладает эффектом накопления.   Здесь можно подробно почитать и купить капсулы гриба из Таиланда. 

Гриб рейши правда и ложь о свойствах, лечение онкологии и чистка печени

Грибы рейши борются с раком, укрепляют иммунитет и очищают печень

Рейши, или трутовик лакированный, — это съедобный лекарственный гриб. За его целебные свойства, известные уже не одно столетие, его по праву можно назвать супередой; на китайском языке его название звучит как «лин чжи». Эти грибы оказывают противовоспалительный эффект, укрепляют иммунитет и ментальное здоровье, поэтому его часто называют «королем грибов».

В холистической медицине рейши считается адаптогенным растением. Это означает, что он помогает организму бороться с такими последствиями стресса, как воспаление, упадок сил, повреждение кровеносных сосудов и гормональный сбой. Исследования не раз подтверждали, что трутовик обладает антиоксидантными свойствами, которые помогают организму бороться с раком, аутоиммунными заболеваниями и болезнями сердца, а также аллергиями и инфекциями.

Что такое грибы рейши?

Как и другие лечебные грибы, рейши растут в дикой природе. Они родом из Азии (Китая, Кореи и Японии). На вкус они горькие с грубой текстурой, поэтому их часто употребляют в виде пищевых добавок, настоя или порошка.

Научное название грибов — Ganoderma lucidum, они растут над землей и производят «плодовое тело» с соединительными тканями (мицелием), которое и  становится фитопрепаратом, настоем, чаем, порошком и экстрактом.

В традиционной китайской медицине трутовик сушат, измельчают, отваривают и готовят из него суп или чай. Сейчас производители продуктов с содержанием грибов подвергают их воздействию высокого давления несколько раз, высвобождая активные ингредиенты для создания настоев.

Высокая концентрация полезных веществ позволяет грибам препятствовать формированию опухолей, улучшать состояние печени, следить за уровнем сахара в крови, сокращать частоту приступов астмы, аллергических высыпаний и инфекций.

Как работают грибы рейши

За последние несколько десятилетий множество исследований, проведенных Японией, Китаем, США и Великобританией, показали, что трутовик способен защитить от множества болезней, в том числе от:

  • воспаления
  • усталости (включая хроническую усталость)
  • частых инфекций (мочевыводящих путей, бронхита, респираторных инфекций и т. д.)
  • заболеваний печени
  • пищевой аллергии и астмы
  • проблем с пищеварением, язв желудка, синдрома дырявого кишечника
  • роста опухолей и развития рака
  • воспалений кожи
  • аутоиммунных расстройств
  • диабета
  • вирусов (в том числе гриппа, СПИД/ВИЧ, гепатита)
  • заболеваний сердца, гипертонии, повышенного кровяного давления и высокого уровня холестерина
  • проблем со сном и бессонницы
  • тревоги и депрессии

Выступая в роли «иммунномодулятора», рейши может восстановить гормональный баланс, вернуть организм к гомеостазу и отрегулировать работу иммунной системы, что помогает бороться с новообразованиями и раковыми клетками. Исследования говорят о том, что эти грибы работают как нормализующее вещество, регулирующее различные функции клеток и систем, в том числе эндокринной (гормональной), иммунной, сердечно-сосудистой, центральной нервной и пищеварительной системы.

Одно из наиболее ценных свойств грибов рейши — огромная польза практически без каких-либо побочных действий. Трутовик намного менее токсичен многих традиционных препаратов. Так, во время употребления этих грибов многие отмечают прилив энергии, улучшение концентрации и настроения, а также уменьшение боли, проблем с пищеварением и инфекционных воспалений.

В чем же секрет рейши? В активных веществах, присутствующих в их составе. К этим веществам относятся сложные сахара (бета-глюканы), растительные стеролы, которые являются основой при формировании гормонов, полисахариды, которые препятствуют развитию раковых клетки кислотных веществ, «отключающих» реакцию организма на аллергены.

Недавние наблюдения позволяют предположить, что рейши могут снимать воспаление и увеличивать производство клеток, убивающих различные типы мутировавших клеток в организме. Таким образом, трутовик может стать прекрасным средством для профилактики болезней сердца и выступать в роли природного лекарства от рака. Грибы рейши способны:

  • активировать рецепторы цитотоксичности (NKG2D/NCR)
  • замедлять распространение клеток
  • подавлять факторы роста эндотелия сосудов
  • увеличивать количество антиоксидантов в плазме
  • улучшить иммунный ответ
  • преобразовывать избыток тестостерона в дигидротестостерон

Польза для здоровья

1. Обладает мощными противораковыми свойствами

Как и другие противораковые продукты, рейши имеют в своем составе такие питательные вещества, как антиоксиданты, бета-глюканы и аминокислоты. Ученые полагают, что наиболее полезными компонентами грибов являются полисахариды. Эти водорастворимые вещества содержатся в продуктах, богатых углеводами и обладающих противоопухолевым действием.

Полисахариды, присутствующие в сладком картофеле и свекле, оказывают иммунномоделирующее действие. Компоненты, входящие в состав грибов, защищают ДНК и блокируют мутацию клеток, оберегая здоровые. Согласно исследованиям, некоторые виды лечебных грибов помогают бороться с раком; полисахариды обладают множеством важных полезных свойств, в том числе антиоксидантным, нейропротекторным, радиопротекторным, антидиабетическим, антиостеопорозным и тонизирующим свойствами.

Кроме того, лабораторные тесты продемонстрировали, что тритерпены, присутствующие в рейши, тоже обладают противораковыми свойствами. Именно благодаря им такие продукты, как тыква, ягоды и черный рис, обладающие ярким цветом, горьковатым привкусом и большим количеством антиоксидантов, отлично подходят для здорового питания. Соединения тритерпены замедляют формирование опухолей и метастаз, мешая раковым клеткам прикрепляться к эндотелиальным. Бета-глюканы также способны предотвращать развитие рака, блокируя рост и распространение раковых клеток и увеличивая активность иммунной системы.

Исследования показали, что грибы рейши могут эффективно способствовать предотвращению онкологических заболеваний. Они были успешно использованы в ходе исследований in vitro при борьбе с раком молочной железы, яичников, предстательной железы, печени и легких, иногда в сочетании с другими препаратами. Исследования с участием раковых больных говорят о том, что рейши обладают антипролиферативным и химиопрофилактическим эффектами. Они помогают облегчить побочные действия химиотерапии (например, бессонницу, снижение иммунитета) и, возможно, улучшить эффективность лучевой терапии. Все это позволяет назвать грибы рейши одним из наиболее мощных противораковых продуктов.

2. Способствует работе печени

Печень — один из наиболее важных органов в теле. Она помогает выводить из организма токсины, усваивать питательные вещества и чистить кровь.

Грибы рейши выступают в роли адаптогена, улучшая работу печени и предотвращая возникновение болезней печени. Они способствуют более эффективному выведению вредных веществ и бактерий и укреплению иммунитета. Исследование, опубликованное в 2013 году в «Международном журнале о лечебных грибах», показало, что благодаря своим антиоксидантным свойствам рейши оказывает гепатопротекторный эффект при остром воспалении печени и блокирует иммунные ответы, замедляющие работу печени.

3. Улучшает здоровье сердца

Тритерпены, присутствующие в трутовике, способны нормализовывать кровяное давление, уровень холестерина и свертываемость крови. Это происходит благодаря снижению воспаления в кровеносных сосудах и восстановлению гормонального баланса. Высокое кровяное давление и холестерин могут быть результатом гормональных проблем, в том числе заболевания щитовидной железы, или стресса. Рейши помогает поддерживать гормональный фон, укрепляя сердечно-сосудистую систему.

Кроме этого, экстракт рейши улучшает циркуляцию крови, снимает воспаление и предотвращает закупорку сосудов, контролируя уровень холестерина в крови.

4. Регулирует гормональный уровень

Трутовик — это адаптоген. Он помогает справиться со стрессом и нормализовать уровень гормонов в организме. На данный момент исследования ученых ограничены моделями животных, однако они говорят о том, что экстракт рейши может нормализовать некоторые гормон-рецепторные комплексы, что может быть полезно при лечении рака.

Другие исследования показывают, что грибы способны защищать и оказывать положительный эффект на эндокринную систему, которая охватывает железы, отвечающие за производство гормонов, во всем организме. Этот факт может быть важным для здоровья по многим причинам: эндокринная система оказывает непосредственное действие на метаболизм, рост, сон, настроение и сексуальную активность.

Преимущества Рейши

5. Нормализует уровень сахара в крови

Высокий уровень сахара в крови может оказывать пагубное действие на весь организм, вызывая усталость, потерю веса и частое мочеиспускание. Некоторые исследования показывают, что рейши имеют противодиабетические свойства, помогая нормализовывать уровень сахара и предотвращать появление побочный эффектов.

Так, один обзор, проведенный в Тайване, обнаружил, что грибы рейши способны снизить уровни холестерина и инсулина у мышей. Они также помогли изменить количетво некоторых ферментов, участвующих в контроле сахара, и способствовали более эффективной транспортировке сахара к тканям для использования его в качестве топлива.

6. Борется с аллергией и астмой

Тритерпены — это активные компоненты грибов рейши. Они являются типом ганодериевой кислоты, способствующей снижению чувствительности к аллергенам и гистаминовой реакции, связанной с астмой. По этой причине рейши часто используются в качестве эффективного и безопасного природного средства при астме. Тритерпены способны уменьшать аллергическую реакцию, так как они влияют на иммунную систему, улучшают работу пищеварительных органов, защищают слизистую кишечника, снимают воспаление, замедляют выработку гистамина, улучшают работу печени и способствуют более эффективному использованию кислорода.

7. Защищает от инфекций и вирусов

Благодаря своим активным компонентам, грибы рейши обладают противовирусным, антибактериальным и противогрибковым свойствами. Так, тритерпены способны не только снимать симптомы аллергии, но и бороться с микробами, вирусами и грибковыми инфекциями. Эти соединения можно встретить во многих растениях, имеющих горьковатый привкус (так растения защищает себя от вредителей).

Улучшая циркуляцию крови и снимая воспаление, грибы способны быстро справиться с инфекцией, снять боль и усталость. Трутовик часто используется для лечения симптомов и причин возникновения инфекций мочевыводящих путей, гепатита и даже ВИЧ/СПИД.

Питательные свойства и использование в традиционной медицине

В качестве пищевой добавки рейши практически не содержит калорий, лишь небольшое количество клетчатки и белка. Однако своей пользой грибы обязаны ингредиентам, которые не описаны в составе.

Грибы содержат огромное количество антиоксидантов и полезных соединений, таких как полисахариды и тритерпены. Эти соединения обладают множеством полезных свойств, придающих рейши противовоспалительные, противораковые и антидиабетические свойства.

Этими свойствами пользуется и холистическая медицина для лечения множества недомоганий. Рейши особенно популярны в традиционной китайской медицине уже тысячи лет. Считается, что они питают сердце, защищают печень, замедляют старение, придают энергию, выносливость и силу. Они также способны успокаивать, из-за чего грибы часто применяют в духовных практиках.

Грибы рейши, траметес разноцветный, чага, ежовик гребенчатый и шиитаке

Давайте сравним грибы рейши с другими популярными лечебными грибами:

  • Рейши: нормализует гормональный фон, укрепляет сердце, способствует работе печени, нормализует уровень сахара в крови, борется с аллергией, приступами астмы и инфекциями.
  • Траметес разноцветный: способствует развитию полезных бактерий в кишечнике, предотвращает развитие инфекций и борется с раковыми клетками.
  • Ежовик гребенчатый: поддерживает работу мозга, снимает воспаление, поддерживает здоровье желудочно-кишечного тракта и борется с образованием свободных радикалов.
  • Чага: повышает выносливость, снимает воспаление, укрепляет иммунитет и обладает противовирусными свойствами.
  • Шиитаке: укрепляет иммунитет, борется с раковыми клетками, улучшает состояние кожи, содержит большое количество витамина В6 для поддержания энергии.

Кроме того, разные виды грибов можно употреблять по-разному. Так, рейши, траметес разноцветный или чага чаще используют в форме пищевой добавки, а более вкусные грибы (ежовик гребенчатый и шиитаке) вполне можно добавить в Ваше любимое блюдо.

Где купить и как использовать

Благодаря своей растущей популярности, рейши в форме порошка, капсул или экстракта можно найти в магазинах здорового питания, фитоаптеках или онлайн. Перед употреблением тщательно изучите инструкцию, так как дозировка может меняться в зависимости от концентрации вещества в добавке. Вероятность возникновения побочных эффектов может возрасти при приеме слишком большого количества продукта.

Трутовик произрастает в южных регионах России, а значит его вполне можно собрать самостоятельно или даже вырастить из грибницы, купленной онлайн.

При покупке обратите внимание на  гарантию качества, лучше всего, если экстракт или эфирное масло было произведено в Азии. Разные формы добавок имеют разную концентрацию активных компонентов, которая зависит от условий выращивания, состояния грибницы и метода обработки. Наиболее чистыми считаются добавки из Японии, где используются технологии, защищающие вещества от распада. Изучите этикетку на предмет видового названия (Ganoderma lucidum), соотношение экстрактов, страны производства и наличия каких-либо добавок.

Лучше всего употреблять грибы рейши с утра на голодный желудок, запивая водой или заедая продуктами, богатыми витамином С. Это способствует более быстрому усвоению активных веществ и антиоксидантов. Вы также можете приготовить себе чашку чая или коже из грибов рейши. Чем не хорошее начало дня?


Существует множество способов добавить грибы в свой рацион. Вот несколько простых, но вкусных рецептов для начала:

  • грибной бульон из рейши с имбирем
  • чай из рейши
  • грибной суп из рейши с морковью и капустой кале
  • зеленый смузи с рейши и какао
  • болоньезе с рейши и коричневыми шампиньонами

Форма выпуска и дозировка

Рекомендованная дозировка рейши варьируется в зависимости от пищевой добавки. В свежем виде можно употреблять от 25 до 100 г ежедневно. Капсулы, порошок и экстракт содержат более высокую концентрацию полезных веществ, а значит дозировка пищевых добавок должна быть ниже.

Большинство исследований показали, что 2-9 г экстракта грибов рейши в порошке, капсулах или настое достаточно, чтобы ощутить на себе их благотворное действие. Однако концентрация этого экстракта может быть различна, поэтому перед употреблением ознакомьтесь с инструкцией на Вашей упаковке.


Первые известные нам записи об использовании рейши были сделаны еще 2 000 лет назад. В древних текстах его часто называли «грибом бессмертия». В 200-250 гг н. э. Китайская книга о целебных травах «Классика фитотерапии» классифицировала виды грибов, основываясь на их влиянии на различные части тела.

Согласно этой книге «Лин чжи (Ganoderma rubra) горький и сбалансированный. Он преимущество лечит сплетение в груди, повышает сердечную Ци, дополняет центр, обостряет ум и [заставляет людей] не забывать [то есть улучшает память]. Продолжительный прием делает тело легким, предотвращает старение, продлевает жизнь и даже может сделать бессмертным. Его другое название Дан Чжи (Cinnabar Ganoderma). Он растет в горах и долинах».

Сегодня грибы рейши знамениты благодаря своим полезным лечебным свойствам, а каждое новое исследование лишь доказывает потенциальный эффект, который они могут оказывать на весь организм. Они стоят в одном ряду с такими лечебными грибами, как чага и портобелло, и имеют репутацию богатого источника питательных веществ.

Риски и побочное действие

Грибы рейши используют уже несколько тысяч лет при разных заболеваниях, при этом они практически не вызывали побочных эффектов. Они относятся к 1 классу целебных растений, то есть они безопасны при умеренном приеме. Иногда может возникнуть легкое пищевое расстройства или раздражение на коже при повышенной чувствительности и ослабленном иммунитете.

Однако в некоторых случая все же стоит проконсультироваться со специалистом перед употреблением трутовика. Согласно исследованиям, рейши безопасны для взрослых при употреблении в рекомендованном количестве в течение года. Пищевые добавки в виде порошка могут быть более концентрированными или содержать дополнительные ингредиенты, это увеличивает риск возникновения неблагоприятных последствий. Мы рекомендуем приобретать добавки надежных компаний.

Если у Вас появились какие-либо из ниже  приведенных побочных симптомов, немедленно прекратите употребление продукта и обратитесь к врачу, чтобы убедиться, что у Вас нет аллергии или интоксикации:

  • сухость во рту
  • сухость или раздражение в горле
  • зуд в полости носа
  • кровотечение из носа
  • расстройство желудка или изжога
  • кровь в стуле
  • сыпь на коже

В период беременности и кормления грудью стоит употреблять рейши под наблюдением врача, так как с учетом данных условий пока не было проведено достаточного количества исследований. Более того, воздержитесь от употребления грибов рейши, если у Вас существуют какие-либо проблемы с кровью, Вы недавно перенесли операцию, принимаете лекарства для нормализации давления, разжижения крови или иммунодепрессанты, так как рейши могут вызвать повышение кровяного давления, повлиять на свертываемость крови и увеличить риск кровотечения.

  • Грибы рейши являются лечебными грибами, обладающими большим количеством полезных свойств.
  • Грибы способны улучшать здоровье печени и сердца, защищать от аллергии, приступов астмы и инфекций и предотвращать рак. Рейши также способствуют нормализации гормонального фона и уровня сахара в крови.
  • Хотя свежие грибы рейши съедобны, их чаще можно встретить в виде пищевых добавок, в форме капсул, порошка, экстракта и настоя.
  • Рейши безопасны, однако в отдельных случаях они могут вызывать побочную реакцию и взаимодействовать с другими препаратами.
  • Если Вы хотите увеличить питательную ценность своих любимых блюд и напитков, то добавьте эти лечебные грибы при приготовлении супов, чая, кофе или бульонов.

Оставьте свою заявку на нашем сайте, и мы с Вами свяжемся.

Ganoderma lucidum (Линчжи или Рейши) — Фитотерапия

  • Акихиса Т., Накамура Ю., Тагата М., редакторы. и другие. Противовоспалительное и противоопухолевое действие тритерпеновых кислот и стеролов из грибка Ganoderma lucidum. Chem Biodivers. 2007. 4: 224–31. [PubMed: 17311233]
  • Бао X, Лю С., Фанг Дж., Ли X. Структурные и иммунологические исследования основного полисахарида из спор Ganoderma lucidum (Fr.) Karst. Carbohydr Res. 2001; 332: 67–74. [PubMed: 11403089]
  • Бао Х, Ван Х, Донг Кью, Фанг Дж, Ли Х.Структурные особенности иммунологически активных полисахаридов Ganoderma lucidum. Фитохимия. 2002; 59: 175–81. [PubMed: 11809453]
  • Бензи И. Ф. Ф., Вахтель-Галор С. Биомаркеры долгосрочных вегетарианских диет. Adv Clin Chem. 2009; 47: 169–220.

  • Бох Б., Берович М., Чжан Дж., Жи-Бин Л. Ganoderma lucidum и его фармацевтически активные соединения. Biotechnol Annu Rev.2007; 13: 265–301. [PubMed: 17875480]
  • Борчерс А. Т., Кришнамурти А., Кин К. Л., Мейерс Ф.Дж, Гершвин М. Э. Иммунобиология грибов. Exp Biol Med. 2008. 233: 259–76. [PubMed: 182]
  • Борчерс А. Т., Стерн Дж. С., Хакман Р. М., Кин С. Л., Гершвин М. Е. Мини-обзор: грибы, опухоли и иммунитет. Proc Soc Exp Biol Med. 1999; 221: 281–93. [PubMed: 10460691]
  • Budavari S. The Merck Index. Elevan. Нью-Джерси: Merck & Co., INC; 1989. с. 845.

  • Цао Л. З., Лин З. Б. Регулирование созревания и функции дендритных клеток полисахаридами Ganoderma lucidum.Immunol Lett. 2002; 83: 163–9. [PubMed: 120]
  • Cao Q. Z, Lin Z. B. Противоопухолевая и антиангиогенная активность пептида полисахаридов Ganoderma lucidum. Acta Pharmacol Sin. 2004. 25: 833–8. [PubMed: 15169641]
  • Cao Q. Z, Lin Z. B. Пептид полисахаридов Ganoderma lucidum ингибирует рост эндотелиальных клеток сосудов и индукцию VEGF в клетках рака легких человека. Life Sci. 2006; 78: 1457–63. [PubMed: 16269156]
  • Cao Q. Z, Lin S. Q, Wang S. Z. Влияние пептида полисахаридов Ganoderma lucidum на инвазию клеток карциномы легкого человека in vitro.Пекин Да Сюэ Сюэ Бао. 2007. 39: 653–6. [PubMed: 18087562]
  • Чанг С. Т., Басуэлл Дж. А. Нутрицевтики грибов. Мир J Microbiol Biotechnol. 1996; 12: 473–6. [PubMed: 24415377]
  • Чанг С. Т., Басуэлл Дж. А. Ganoderma lucidum (Curt .: Fr.) P. Karst. (Aphyllophoromycetideae): грибной лекарственный гриб. Int J Med Mushrooms. 1999; 1: 139–46.

  • Чанг С. Т., Басвелл Дж. А. Безопасность, контроль качества и нормативные аспекты, касающиеся грибных нутрицевтиков.Proc. 6-й международный Конф. Грибная биология и грибные продукты. 2008: 188–95. GAMU Gmbh, Крефельд, Германия.

  • Чанг Ю. Х, Ян Дж. С., Ян Дж. Л., редакторы. и другие. Экстракт Ganoderma lucidum стимулирует иммунные ответы у нормальных мышей BALB / c in vivo. Vivo. 2009. 23: 755–9. [PubMed: 111]
  • Chen Y, Bicker W, Wu J, Xie M. Y, Lindner W. Различение видов Ganoderma с помощью двухрежимного хроматографического снятия отпечатков пальцев: исследование эффектов стационарной фазы в хроматографии с гидрофильным взаимодействием и снижение уровня ошибочной классификации образцов за счет дополнительного использования обращенно-фазовой хроматографии.J Chromatogr. 2010; 1217 (8): 1255–65. [PubMed: 20031144]
  • Chen T. Q, Li K. B, He X. J, Zhu P. G, Xu J. Микроморфология, химические компоненты и идентификация культивируемых спор Ganoderma lucidum. Лу М., Гао К., Си Х. -Ф, Чен М. -Дж. Proc ’98 Nanjing Intl Symp Science & Fushrooms. 1998 214. Нанкин, Китай. JSTC-ISMS.

  • Chen D. H, Shiou W. Y, Wang K. C, редакторы. и другие. Хемотаксономия тритерпеноидного паттерна ВЭЖХ Ganoderma lucidum и Ganoderma tsugae.J Chin Chem Soc. 1999; 46: 47–51.

  • Чен Х. С., Цай Ю. Ф., Лин С., редакторы. и другие. Исследования иммуномодулирующей и противоопухолевой активности полисахаридов Ganoderma lucidum (Reishi). Bioorg Med Chem. 2004; 12: 5595–601. [PubMed: 15465337]
  • Чен Й, Чжу С. Б., Се М. И, редакторы. и другие. Контроль качества и оригинальное различение Ganoderma lucidum на основе высокоэффективной жидкостной хроматографии и комбинированных методов хемометрии. Анальный Чим Акта. 2008; 623: 146–56.[PubMed: 18620918]
  • Чиен К. М., Ченг Дж. Л., Чанг В. Т., редакторы. и другие. Полисахариды Ganoderma lucidum изменяют иммунофенотипическую экспрессию клеток и усиливают цитотоксичность CD56 + NK-клеток в пуповинной крови. Bioorg Med Chem. 2004; 12: 5603–9. [PubMed: 15465338]
  • Чиу С. В., Ван З. М., Люнг Т. М., Мур Д. Пищевая ценность экстракта Ganoderma и оценка его генотоксичности и антигенотоксичности с использованием кометных анализов лимфоцитов мыши. Food Chem Toxicol. 2000; 38: 173–8. [PubMed: 10717357]
  • Чанг В.Т., Ли С. Х, Ким Дж. Д. и др. Влияние бульона культуры мицелия Ganoderma lucidum на характеристики роста линий клеток человека. J Biosci Bioeng. 2001; 92: 550–5. [PubMed: 16233144]
  • Коллинз А. Р. Вмешательство антиоксидантов как путь к профилактике рака. Eur J Cancer. 2005; 41: 1923–30. [PubMed: 16111883]
  • Донк М. А. Конспект семейств Aphyllophorales. Персония. 1964; 3: 19–24.

  • Du M, Wang C, Hu X. C, Zhao G. Положительное влияние селена на активность иммунной регуляции лекарственных грибов линчжи или рейши, Ganoderma lucidum (W.Курт .: Пт.) П. Карст. (Aphyllophoromycetideae), белки in vitro. Int J Med Mushrooms. 2008; 10: 337–44.

  • Эль-Меккави С., Меселхи М. Р., Накамура Н., редакторы. и другие. Вещества против ВИЧ-1 и анти-ВИЧ-1-протеазы из Ganoderma lucidum. Фитохимия. 1998; 49: 1651–7. [PubMed: 40]
  • Эо С. К., Ким Ю. С., Ли К. К., Хан С. С. Противовирусная активность различных веществ, растворимых в воде и метаноле, выделенных из Ganoderma lucidum. J Ethnopharmacol. 1999. 68: 129–36. [PubMed: 10624872]
  • Эванс С., Дизеи Н., Абрахамссон П.A, Persson J. Влияние нового ботанического агента TBS-101 на инвазивный рак простаты на животных моделях. Anticancer Res. 2009; 29: 3917–24. [PubMed: 129]
  • Фаландыш Дж. Селен в съедобных грибах. J. Environ Sci Health C Environ Carcinog Ecotoxicol Rev. 2008; 26 (3): 256–99. [PubMed: 18781538]
  • Fang Q. H, Zhong J. J. Двухстадийный процесс культивирования для улучшенного производства ганодериновой кислоты путем жидкой ферментации высших грибов Ganoderma lucidum. Biotechnol Prog. 2002; 18: 51–4. [PubMed: 11822899]
  • Фукудзава М., Ямагути Р., Хидэ И., редакторы.и другие. Возможное участие длинноцепочечных жирных кислот в спорах Ganoderma lucidum (Reishi Houshi) в его противоопухолевой активности. Биол Фарм Булл. 2008; 31: 1933–7. [PubMed: 18827358]
  • Furusawa E, Chou S. C., Furusawa S, Hirazumi A, Dang Y. Противоопухолевое действие Ganoderma lucidum, съедобного гриба, на внутрибрюшинно имплантированную карциному легкого Льюиса синергенным мышам. Phytother Res. 1992; 6: 300–4.

  • Гао Й, Гао Х, Чан Э, редакторы. и другие. Противоопухолевая активность и основные механизмы ганополии, очищенных полисахаридов, экстрагированных из Ganoderma lucidum, у мышей.Иммунол Инвест. 2005; 34: 171–98. [PubMed: 158]
  • Gao Y, Lan J, Dai X, Ye J, Zhou S. Исследование фазы I / II экстракта гриба Lingzhi Ganoderma lucidum (W. Curt .: Fr.) Lloyd (Aphyllophoromycetideae) у пациентов при сахарном диабете II типа. Int J Med Mushrooms. 2004; 6: 33–40.

  • Гао Дж. Дж., Мин Б. С., Ан Э. М., Накамура Н., Ли Х. К., Хаттори М. Новые тритерпеновые альдегиды, люциальдегиды А-С из Ganoderma lucidum и их цитотоксичность в отношении опухолевых клеток мыши и человека.Chem Pharm Bull. 2002; 50: 837–40. [PubMed: 12045343]
  • Gao Y. H, Sai X. H, Chen G. L, Ye J. X, Zhou SF. Рандомизированное плацебо-контролируемое многоцентровое исследование Ganoderma lucidum (W. Curt .: Fr.) полисахариды Ллойда (Aphyllophoromycetideae) (Ganopoly) у пациентов с распространенным раком легких. Int J Med Mushrooms. 2003; 5: 368–81.

  • Gao Y, Tang W, Gao H, Chan E, Lan J, Zhou S. Полисахаридные фракции Ganoderma lucidum ускоряют заживление язв, вызванных уксусной кислотой, у крыс.J Med Food. 2004. 7 (4): 417–21. [PubMed: 15671683]
  • Гао Ю., Чжоу С. Профилактика и лечение рака с помощью Ganoderma, гриба с лечебными свойствами. Food Rev Int. 2009. 19: 275–325.

  • Гао Ю. Х., Чжоу С. Ф., Чен Г. Л., Дай Х. Х., Йе Дж. Х. Исследование фазы I / II Ganoderma lucidum (Curr .: Fr.) P. Karst. Экстракт (Ганополия) у больных раком на поздних стадиях. Int J Med Mushrooms. 2002; 4: 207–14.

  • Гао Ю. Х, Чжоу С. Ф., Цзян В. К., Хуанг М., Сай Х.Влияние ганополии (экстракт полисахарида Ganoderma lucidum) на иммунные функции у больных раком на поздней стадии. Иммунол Инвест. 2003. 32: 201–15. [PubMed: 129]
  • Гонсалес А. Г., Леон Ф., Ривера А., Муньос К. М., Бермехо Дж. Ланостаноидные тритерпены из Ganoderma lucidum. J Nat Prod. 1999; 62: 1700–1.

  • Готтлиб А. М., Ферреф Э., Райт Дж. Э. Анализ рДНК в помощь систематике видов Ganoderma. Mycol Res. 2000; 104: 1033–45.

  • Готлиб А.М., Саидман Б. О., Райт Дж. Э. Изоферменты видов Ganoderma из южной части Южной Америки. Mycol Res. 1998. 102: 415–26.

  • Хабиджанич Дж., Берович М. Актуальность увлажнения твердого субстрата при культивировании биомассы Ganoderma lucidum. Food Technol Biotechnol. 2000; 38: 225–8.

  • Харалампидис К., Трояновская М., Осборн А. Э. Биосинтез тритерпеноидных сапонинов в растениях. Adv Biochem Eng Biotechnol. 2002; 75: 31–49. [PubMed: 11783842]
  • Хидзиката Ю., Ямада С.Влияние Ganoderma lucidum на постгерпетическую невралгию. Am J Chin Med. 1998. 26: 375–81. [PubMed: 25]
  • Хидзиката Ю., Ямада С., Ясухара А. Травяные смеси, содержащие гриб Ganoderma lucidum, улучшают время выздоровления у пациентов с генитальным и губным герпесом. J Altern Complement Med. 2007. 13: 985–7. [PubMed: 18047445]
  • Hikino H, Ishiyama M, Suzuki Y, Konno C. Механизмы гипогликемической активности ганодерана B: гликан плодового тела Ganoderma lucidum. Planta Med. 1989; 55: 423–8.[PubMed: 2682700]
  • Hikino H, Konno C, Mirin Y, Hayashi T. Изоляция и гипогликемическая активность ганодеранов A и B, гликанов плодовых тел Ganoderma lucidum. Planata Med. 1985; 4: 339–40. [PubMed: 3840903]
  • Ho Y. W, Yeung J. S, Chiu P. K, Tang W. M, Lin Z. B, Man R. Y, Lau CS Полисахаридный пептид Ganoderma lucidum снижал выработку провоспалительных цитокинов в активированный ревматоидный синовиальный фибробласт. Mol Cell Biochem. 2007; 301: 173–9. [PubMed: 17219061]
  • Хонг К.Дж., Данн Д. М., Шен С. Л., Пенс Б. С. Влияние Ganoderma lucidum на апоптотическую и противовоспалительную функцию в клетках карциномы толстой кишки человека HT-29. Phytother Res. 2004; 18: 768–70. [PubMed: 15478180]
  • Хсеу Р.С., Ван Х., Ван Х. Ф., Монкальво Дж. М. Дифференциация и группировка изолятов комплекса Ganoderma lucidum с помощью случайной амплифицированной полиморфной ДНК-ПЦР по сравнению с группировкой на основе внутреннего транскрибируемого спейсера последовательности. Appl Environ Microbiol. 1996; 62: 1354–63. [Бесплатная статья PMC: PMC167902] [PubMed: 87]
  • Hsiao W.L, Li Y. Q, Lee T. L, Li N, You M. M, Chang S. T. Экстракты лекарственных грибов ингибируют трансформацию клеток, индуцированную ras, и для ингибирующего эффекта требуется присутствие нормальных клеток. Канцерогенез. 2004. 25: 1177–83. [PubMed: 15205366]
  • Hu H, Ahn N.S, Yang X, Lee Y.S, Kang K. S. Экстракт Ganoderma lucidum индуцирует остановку клеточного цикла и апоптоз в клетках рака молочной железы человека MCF-7. Int J Cancer. 2002; 102: 250–3. [PubMed: 123]
  • Хюн Дж. У, Чой Э. С., Ким Б. К. Исследования компонентов высших грибов Кореи (LXVII), противоопухолевых компонентов базидиокарпа Ganoderma lucidum.Корейский J Mycol. 1990; 18: 58–69.

  • Ji Z, Tang Q, Zhang J, Yang Y, Jia W, Pan Y. Иммуномодуляция макрофагов RAW264.7 с помощью GLIS, протеополисахарида из Ganoderma lucidum. J Ethnopharmacol. 2007; 112: 445–50. [PubMed: 17524580]
  • Jia J, Zhang X, Hu Y.S, редакторы. и другие. Оценка антиоксидантной активности полисахаридов Ganoderma lucidum in vivo у крыс с СТЗ-диабетом. Food Chem. 2009. 115: 32–6.

  • Jiang J, Grieb B, Thyagarajan A, Sliva D.Ганодерные кислоты подавляют рост и инвазивное поведение клеток рака груди, модулируя передачу сигналов AP-1 и NF-kappaB. Int J Mol Med. 2008; 21: 577–84. [PubMed: 18425349]
  • Цзян Дж., Сливова В., Слива Д. Ganoderma lucidum ингибирует пролиферацию клеток рака груди человека путем подавления регуляции рецептора эстрогена и передачи сигналов NF-kappaB. Int J Oncol. 2006; 29: 695–703. [PubMed: 16865287]
  • Цзян Дж., Сливова В., Валаховикова Т., Харви К., Слива Д. Ganoderma lucidum ингибирует пролиферацию и индуцирует апоптоз в клетках рака предстательной железы человека PC-3.Int J Oncol. 2004; 24: 1093–9. [PubMed: 15067330]
  • Джонстон Н. Лекарственный гриб перекрывает кровоснабжение клеток рака простаты. Drug Discov сегодня. 2005; 10: 1584. [PubMed: 16376814]
  • Кавагиси Х., Мицунага С. И., Ямаваки М., редакторы. и другие. Лектин из мицелия гриба Ganoderma lucidum. Фитохимия. 1997; 44: 7–10. [PubMed: 83]
  • Keypour S, Riahi H, Moradali M. F, Rafati H. Исследование антибактериальной активности хлороформного экстракта лекарственных грибов Линчжи или Рейши, Ganoderma lucidum (W.Курт .: Пт.) П. Карст. (Aphyllophoromycetideae). Int J Med Mushrooms. 2008. 10 (4): 345–34.

  • Ким Б. К., Чунг Х. С., Чунг К. С., Ян М. С. Исследования противоопухолевых компонентов корейских базидиомицетов. Корейский J Mycol. 1980; 8: 107–13.

  • Ким И. С., Эо С. К., О К. В., Ли К. К., Хан С. С. Антигерпетическая активность связанного с кислотным белком полисахарида, выделенного из Ganoderma lucidum, отдельно и в комбинациях с интерферонами. J Ethnopharmacol. 2000; 72: 451–8. [PubMed: 109]
  • Ким К.С., Ким Дж. С., Сон Дж. К., Ким И. Г. Усиленная индукция митохондриального повреждения и апоптоза в клетках HL-60 лейкемии человека экстрактами Ganoderma lucidum и Duchesnea chrysantha. Cancer Lett. 2007. 246: 210–17. [PubMed: 16574319]
  • Ким С. Д., Нхо Х. Дж. Выделение и характеристика ингибитора альфа-глюкозидазы из грибка Ganoderma lucidum. J Microbiol. 2004; 42: 223–7. [PubMed: 15459652]
  • Ким Х. М., Парк М. К., Юн Дж. У. pH культуры влияет на продукцию экзополисахаридов в погруженной мицелиальной культуре Ganoderma lucidum.Appl Biochem Biotechnol. 2006. 134: 249–62. [PubMed: 163]
  • Ким Д. Х., Шим С. Б., Ким Н. Дж., Джанг И. С. Ингибирующая активность β-глюкуронидазы и гепатопротекторный эффект Ganoderma lucidum. Биол Фарм Булл. 1999; 22: 162–4. [PubMed: 10077435]
  • Кимура Ю., Танигучи М., Баба К. Противоопухолевое и антиметастатическое действие тритерпеноидных фракций Ganoderma lucidum на печень: механизм действия и выделение активного вещества. Anticancer Res. 2002; 22: 3309–18. [PubMed: 12530080]
  • Колесникова О.П, Тузова М.Н., Козлов В.А. Скрининг иммуноактивных свойств производных алканкарбоновых кислот и германийорганических соединений in vivo. Иммунология. 1997; 10: 36–8.

  • Кубота Т., Асака Ю., Миура И., Мори Х. Структуры ганодеровых кислот А и В, двух новых горьких тритерпенов типа ланостана из Ganoderma lucidum (Fr.) Karst. Helv Chim Acta. 1982; 65: 611–9.

  • Куо М.К., Вен С.И, Ха С.Л., Ву М.Дж. Мицелий Ganoderma lucidum усиливает врожденный иммунитет путем активации NF-kappaB.J Ethnopharmacol. 2006; 103: 217–22. [PubMed: 16169168]
  • Лакшми Б., Аджит Т. А., Хосе Н., Джанардханан К. К. Антимутагенная активность метанольного экстракта Ganoderma lucidum и его влияние на повреждение печени, вызванное бензо [а] пиреном. J Ethnopharmacol. 2006. 107 (2): 297–303. [PubMed: 16713154]
  • Ли Дж. М., Квон Х., Чжон Х., редакторы. и другие. Ингибирование перекисного окисления липидов и окислительного повреждения ДНК Ganoderma lucidum. Phytother Res. 2001; 15: 245–9. [PubMed: 11351361]
  • Ли К.М., Ли С. И, Ли Х. Ю. Двухступенчатый контроль pH для улучшения продукции экзополисахаридов из мицелия Ganoderma lucidum в эрлифтном ферментере. J Biosci Bioeng. 1999; 88: 646–50. [PubMed: 16232678]
  • Ли С. С., Вей Ю. Х, Чен С. Ф., Ван С. И, Чен К. Ю. Противоопухолевые эффекты Ganoderma lucidum. J Chin Med. 1995; 6: 1–12.

  • Ли К. Х, Чен П. И, Чанг У. М., редакторы. и другие. Ганодерная кислота X, тритерпен-ланостаноид, ингибирует топоизомеразы и индуцирует апоптоз раковых клеток.Life Sci. 2005; 77: 252–65. [PubMed: 15878354]
  • Li Y. Q, Wang S. F. Активность ганодерной кислоты из Ganoderma lucidum против гепатита B. Biotechnol Lett. 2006. 28 (11): 837–41. [PubMed: 16786250]
  • Li Z, Liu J, Zhao Y. Возможный механизм, лежащий в основе антигерпетической активности протеогликана, выделенного из мицелия Ganoderma lucidum in vitro. J Biochem Mol Biol. 2005. 38 (1): 34–40. [PubMed: 15715944]
  • Лин С. К. Пекин, Китай: Китайская сельскохозяйственная пресса; Лекарственные грибы китайского производства и разработки продуктов.2000

  • Lin S. B, Li C. H, Lee S. S, Kan LS Обогащенные тритерпеном экстракты из Ganoderma lucidum подавляют рост клеток гепатомы посредством подавления протеинкиназы C, активации митоген-активируемых протеинкиназ и G2-фазы клеточного цикла арестовать. Life Sci. 2003. 72: 2381–90. [PubMed: 12639703]
  • Лин Дж. М., Лин К. С., Чен М. Ф., Удзи Т., Такада А. Уборщик радикалов и антигепатотоксическая активность Ganoderma formosanum, Ganodermalucidum и Ganoderma neo-japonicum. J Ethnopharmacol.1995; 47: 33–41. [PubMed: 7564419]
  • Лю К. С., Фунсаван С. Ф., Хуанг Р. Л., Ляо С., Хсу С. И, Ван К. Дж. Фармакологические исследования и функциональные исследования печени мицелия Ganoderma lucidum. Чин Фарм Дж. 1998; 40: 21–9.

  • Лю Дж, Симидзу К., Кониси Ф., редакторы. и другие. Антиандрогенная активность тритерпеноидной фракции Ganoderma lucidum. Food Chem. 2007a; 100: 1691–6.

  • Лю Дж, Симидзу К., Кониси Ф., Кумамото С., Кондо Р. Антиандрогенный эффект ганодерола В, выделенного из плодового тела Ganoderma lucidum.Bioorg Med Chem. 2007b; 15: 4966–72. [PubMed: 17499997]
  • Лю Дж, Ян Ф, Йе Л. Б., Ян X. Дж, Тимани К. А., Чжэн Й, Ван Й. Возможный механизм действия антигерпетической активности протеогликана, выделенного из мицелия Ganoderma lucidum in vitro. J Ethnopharmacol. 2004. 95: 265–72. [PubMed: 15507347]
  • Лю Ю. В., Гао Дж. Л., Гуань Дж., Цянь З. М., Фэн К., Ли С. П. Оценка антипролиферативной активности и механизмов действия экстрактов двух видов Ganoderma на линиях опухолевых клеток.J. Agric Food Chem. 2009; 57: 3087–93. [PubMed: 149]
  • Лю X, Юань Дж. П., Чунг К. К., Чен X. Дж. Противоопухолевая активность проросших спор Ganoderma lucidum, разрушенных спородермой. Cancer Lett. 2002. 182: 155–61. [PubMed: 12048161]
  • Лю Ц. И, Цзинь Ю. С., Чжан Ц., редакторы. и другие. Экстракты Ganoderma lucidum подавляют рост и индуцируют полимеризацию актина в клетках рака мочевого пузыря in vitro. Cancer Lett. 2004; 216: 9–20. [PubMed: 15500944]
  • Лу Х, Кио Э, Уэсака Т., Като О, Ватанабэ Х.Водорастворимый экстракт из культуральной среды мицелия Ganoderma lucidum (Reishi) подавляет азоксиметановую индукцию рака толстой кишки у самцов крыс F344. Онкол Реп. 2003; 10: 375–9. [PubMed: 12579275]
  • Лу Х., Уэсака Т., Катох О., Кио Э. Ватанабэ Х. Предотвращение развития пренеопластических поражений, аберрантных очагов крипт с помощью водорастворимого экстракта из культуральной среды Ganoderma lucidum (Rei-shi ) мицелий у самцов крыс F344. Онкол Реп. 2001; 8: 1341–5. [PubMed: 11605062]
  • Ma C, Guan S.H, Ян М., Лю X, Го Д. А. Дифференциальная экспрессия белка в мононуклеарных клетках селезенки мышей, обработанных полисахаридами из спор Ganoderma lucidum. Фитомедицина. 2008; 15: 268–76. [PubMed: 18222673]
  • Ма Дж, Йе Кью, Хуа Й, редакторы. и другие. Новые ланостаноиды гриба Ganoderma lucidum. J Nat Prod. 2002; 65: 72–5. [PubMed: 11809071]
  • Махато С. Б., Сен С. Достижения в исследованиях тритерпеноидов, 1990–1994 гг. Фитохимия. 1997. 44: 1185–236. [PubMed: 95]
  • Мао Т., Ван де Уотер Дж., Кин К.L, Stem J.S, Hackman R, Gershwin M.E. Два гриба, Grifola frondosa и Ganoderma lucidum, могут стимулировать экспрессию и пролиферацию генов цитокинов в Т-лимфоцитах человека. Int J Immunother. 1999; 15: 13–22.

  • Машур Н. К., Лин Г. И., Фришман В. Х. Фитотерапия для лечения сердечно-сосудистых заболеваний: клинические аспекты. Arch Intern Med. 1998. 158: 2225–34. [PubMed: 02]
  • Мау Дж. Л., Лин Х. С., Чен С. С. Нелетучие компоненты некоторых лекарственных грибов.Food Res Int. 2001; 34: 521–6.

  • Mau J. L, Lin H. C, Chen C. C. Антиоксидантные свойства некоторых лекарственных грибов. J. Agric Food Chem. 2002; 50: 6072–7. [PubMed: 12358482]
  • Майзуми Ф., Окамото Х., Мизуно Т. Выращивание рейши. Food Rev Int. 1997. 13: 365–73.

  • МакМикин Д. Восприятие Ganoderma lucidum в китайской и западной культуре. Миколог. 2005; 18: 165–9.

  • Мин Б. С., Гао Дж. Дж., Накамура Н., Хаттори М. Тритерпены из спор Ganoderma lucidum и их цитотоксичность в отношении опухолевых клеток мет-А и LLC.Chem Pharm Bull. 2000; 48: 1026–33. [PubMed: 105]
  • Мин Б. С., Накамура Н., Мияширо Н., Бэ К. В., Хаттори М. Тритерпены из спор Ganoderma lucidum и их ингибирующая активность против протеазы ВИЧ-1. Chem Pharm Bull. 1998. 46: 1607–12. [PubMed:

  • Мино Й, Ота Н., Сакао С., Ши момура С. Определение германия в лекарственных растениях с помощью атомно-абсорбционной спектрометрии с электротермической атомизацией. Chem Pharm Bull. 1980; 28: 2687–91. [PubMed: 7460098]
  • Миура Т., Юань Л., Сунь Б., редакторы.и другие. Изофлавоновый агликон, продуцируемый культивированием экстрактов соевых бобов с базидиомицетами, и его антиангиогенная активность. Biosci Biotechnol Biochem. 2002; 66: 2626–31. [PubMed: 125]
  • Миядзаки Т., Нисидзима М. Исследования полисахаридов грибов. XXVII. Структурное исследование водорастворимого противоопухолевого полисахарида Ganoderma lucidum. Chem Pharm Bull. 1981; 29: 3611–16. [PubMed: 7340947]
  • Монкальво Дж. М. Систематика Ganoderma. В кн .: Ганодермальные болезни многолетних культур.Уоллингфорд, Великобритания: CAB International; 2000. С. 23–45.

  • Монкалво Дж. М., Ван Х. Ф., Ван Х. Х., Хсеу Р. С. Использование данных нуклеотидной последовательности рДНК для идентификации видов и филогении у Ganodermataceae. В кн .: Ганодерма: Систематика. Фитопатология и фармакология. Тайбэй: факультет сельскохозяйственной химии, Национальный университет Тайваня; 1995.

  • Muller C.I, Kumagai T., O’Kelly J, Seeram N.P, Heber D., Koeffler H.P. Ganoderma lucidum вызывает апоптоз лейкозных, лимфомных и множественных миеломных клеток.Leuk Res. 2006; 30: 841–8. [PubMed: 16423392]
  • Нишитоба Т., Сато Х., Касаи Т., Кавагиси Х., Сакамура С. Новые горькие терпеноиды С27 и С30 из гриба Ganoderma lucidum (Рейши). Agric Biol Chem. 1984; 48: 2905–7.

  • Нонака Ю., Шибата Х, Накаи М., редакторы. и другие. Противоопухолевая активность роговой формы Ganoderma lucidum у аллогенных и сингенных мышей, несущих опухоль. Biosci Biotechnol Biochem. 2006; 70: 2028–34. [PubMed: 166]
  • О К. У., Ли К. К., Ким Ю.S, Eo S. K, Han S. S. Антигерпетическая активность связанного с кислым белком полисахрида, выделенного только из Ganoderma lucidum и в сочетании с ацикловиром и видарабином. J Ethnopharmacol. 2000; 72: 221–7. [PubMed: 105]
  • Оно Н., Миура Н. Н., Сугавара Н., Токунака К., Киригая Н., Ядомаэ Т. Иммуномодуляция горячей водой и этанольными экстрактами Ganoderma lucidum. Pharm Pharmacol Lett. 1998. 4: 174–7.

  • Оои В. Э., Лю Ф. Иммуномодуляция и противораковая активность полисахаридно-белковых комплексов.Curr Med Chem. 2000; 7: 715–29. [PubMed: 10702635]
  • Парк Э. Дж., Ко Дж., Ким Дж., Донг Х. С. Антифибротические эффекты полисахарида, экстрагированного из Ganoderma lucidum, глицирризина и пентоксифиллина у крыс с циррозом, вызванным обструкцией желчевыводящих путей. Биол Фарм Булл. 1997; 20: 417–20. [PubMed: 21]
  • Патерсон Р. Р. Ганодерма — лечебная биофабрика грибов. Фитохимия. 2006. 67 (18): 1985–2001. [PubMed: 165]
  • Риу Х., Роиг Дж., Санчо Дж. Производство карпофоров Lentinus edodes и Ganoderma lucidum, выращенных на остатках пробки.Microbiologia SEM. 1997; 13: 185–92. [PubMed: 58]
  • Ryvarden L. Можем ли мы доверять морфологии Ganoderma? Бьюкенен П. К., Хсеу Р. С., Монкалво Дж. М. Ганодерма: систематика, фитопатология и фармакология. Материалы симпозиума. 1994: 19–24. 59A, B, 5-й Международный микологический конгресс, 14-21 августа 1994 г.

  • Садава Д., Стилл Д. В., Мудри Р. Р., Кейн С. Э. Влияние Ganoderma на лекарственно-чувствительные и мультирезистентные мелкоклеточные клетки карциномы легких. Cancer Lett.2009; 277: 182–9. [PubMed: 116]
  • Saltarelli R, Ceccaroli P, Iotti M, редакторы. и другие. Биохимическая характеристика и антиоксидантная активность мицелия Ganoderma lucidum из Центральной Италии. Food Chem. 2009; 116: 143–51.

  • Санодия Б. С., Такур Г. С., Багел Р. К., Прасад Г. Б., Бисен П. С. Ganoderma lucidum: мощный фармакологический макрогриб. Curr Pharm Biotechnol. 2009. 10 (8): 717–42. [PubMed: 192]
  • Сато Х., Нишитоба Т., Ширасу С., Ода К., Сакамура С.Ганодериол А и В, новые тритерпеноиды гриба Ganoderma lucidum (Рейши). Agric Biol Chem. 1986; 50: 2887–90.

  • Сето С. В., Лам Т. И, Там Х. Л., редакторы. и другие. Новые гипогликемические эффекты водного экстракта Ganoderma lucidum у мышей с ожирением / диабетом (+ db / + db). Фитомедицина. 2009. 16 (5): 426–36. [PubMed: 100]
  • Шан Д., Чжан Дж., Вэнь Л., Ли И, Цуй К. Получение, характеристика и антипролиферативная активность Se-содержащего полисахарида SeGLP-2B-1 из Se-enriched Ganoderma lucidum.J. Agric Food Chem. 2009; 57: 7737–42. [PubMed: 186]
  • Шина М., Аджит А., Джанардханан К. Профилактика нефротоксичности, вызванной противоопухолевым препаратом Цисплатин, с использованием Ganoderma lucidum, лечебного гриба, произрастающего в Южной Индии. Curr Sci. 2003. 85: 478–82.

  • Ши Ю.Л., Джеймс А.Е., Бензи И.Ф., Басвелл Дж.А.Препараты, полученные из грибов, для предотвращения окислительного повреждения клеточной ДНК, вызванного h3O2. Teratog Carcinog Mutagen. 2002; 22: 103–11. [PubMed: 11835288]
  • Ши Й, Сун Дж, Хе Х, Го Х, Чжан С.Гепатопротекторные эффекты пептидов Ganoderma lucidum против D-галактозамин-индуцированного поражения печени у мышей. J Ethnopharmacol. 2008; 117: 415–19. [PubMed: 18406549]
  • Shi X. M, Zhang J. S., Tang Q. J, Yang Y, Hao R. X, Pan YJ. Анализ отпечатков пальцев штаммов lingzhi (Ganoderma) с помощью высокоэффективной жидкостной хроматографии в сочетании с хемометрическими методами . Мир J Microbiol Biotechnol. 2008; 24: 2443–50.

  • Ши Ю. Х, Лю К. Ф., Хуан Ю. К., Ян Дж. И, Ву И. Л., Лин К. Х, Лин С.C. Оценка защитных эффектов Ganoderma lucidum на печень и почки у мышей. Am J Chin Med. 2001; 29: 501–7. [PubMed: 11789593]
  • Слива Д. Клеточные и физиологические эффекты Ganoderma lucidum (Reishi). Mini Rev Med Chem. 2004; 4: 873–9. [PubMed: 15544548]
  • Слива Д., Лабаррер С., Сливова В., Седлак М., Ллойд Ф. П. младший, Хо Н. В. Ganoderma lucidum подавляет подвижность высокоинвазивных клеток рака груди и простаты. Biochem Biophys Res Commun. 2002; 298: 603–12. [PubMed: 12408995]
  • Сонг Ю.С., Ким С. Х, Са Дж. Х, Джин С., Лим С. Дж., Парк Е. Х. Антиангиогенная и ингибирующая активность в отношении индуцибельной продукции оксида азота грибом Ganoderma lucidum. J Ethnopharmacol. 2004; 90: 17–20. [PubMed: 146]
  • Song C. H, Yang B. K, Ra K. S, Shon D. H, Park E. J, Go G. I, Kim YH Гепатопротекторный эффект внеклеточного полимера, продуцируемого погруженной культурой Ganoderma lucidum WK-003. J Microbiol Biotechnol. 1998. 8: 277–9.

  • Стэнли Дж., Харви К., Сливова В., Цзян Дж., Слива Д.Ganoderma lucidum подавляет ангиогенез за счет ингибирования секреции VEGF и TGF-beta1 из клеток рака простаты. Biochem Biophys Res Commun. 2005; 330: 46–52. [PubMed: 15781230]
  • Су К. Х., Ян Й. З., Хо Х, Хью С. Х., Шеу М. Т. Высокоэффективный жидкостный хроматографический анализ для характеристики тритерпеноидов из Ganoderma. J Chromatogr Sci. 2001; 39: 93–100. [PubMed: 11277258]
  • Sun S. J, Gao W., Lin S. Q, Zhu J, Xie B.G, Lin Z. B. Анализ генетического разнообразия популяций Ganoderma с новым молекулярным маркером SRAP.Appl Microbiol Biotechnol. 2006. 72: 537–43. [PubMed: 16411085]
  • Sun J, He H, Xie B.J. Новые антиоксидантные пептиды из ферментированного гриба Ganoderma lucidum. J. Agric Food Chem. 2004. 52: 6646–52. [PubMed: 15479035]
  • Tang W, Liu J. W, Zhao W. M., Wei D. Z, Zhong J. J. Ганодерная кислота T из мицелия Ganoderma lucidum индуцирует опосредованный митохондриями апоптоз в клетках рака легких. Life Sci. 2006; 80: 205–11. [PubMed: 17007887]
  • Тхакур А., Рана М., Лакханпал Т. Н., Ахмад А., Хан М.I. Очистка и характеристика лектина из плодового тела Ganoderma lucidum: Лектин из Ganoderma lucidum. Biochim Biophys Acta. 2007; 1770: 1404–12. [PubMed: 17629405]
  • Государственная фармакопейная комиссия П. Р. Китая. Государственная фармакопейная комиссия Китайской Народной Республики. Пекин, Китай: Химическая промышленность Press; 2000.

  • Tomasi S, Lohezic-Le D. F, Sauleau P, Bezivin C, Boustie J. Цитотоксическая активность метанольных экстрактов из грибов базидиомицетов на линиях раковых клеток мыши.Pharmazie. 2004; 59: 290–3. [PubMed: 15125575]
  • Tomoda M, Gonda R, Kasahara Y, Hikino H. Гликановые структуры ганодератов B и C, гипогликемические гликаны плодовых тел Ganoderma lucidum. Фитохимия. 1986; 25: 2817–20.

  • Аптон Р. Американская травяная фармакопея и терапевтический сборник: гриб рейши, Ganoderma lucidum. Стандарты анализа, контроля качества и терапии. США, Канада: Санта-Крус; 2000.

  • Van Der Hem L, Van Der Vliet A, Bocken C.Ф. М., Кино К., Хойцма А. Дж., Такс В. Дж. М. Линчжи-8: исследования нового иммуномодулирующего агента. Трансплантация. 1995. 60: 438–43. [PubMed: 7676490]
  • Wachtel-Galor S, Buswell J. A, Tomlinson B., Benzie I. F. F. Полифористый гриб Линчжи. В кн .: Травы и народная медицина: молекулярные аспекты здоровья. Нью-Йорк: Марсель Деккер Инк; 2004. С. 179–228.

  • Wachtel-Galor S, Choi S.W, Benzie I. F. F. Действие Ganoderma lucidum на ДНК человека зависит от дозы и опосредуется перекисью водорода.Редокс-отчет 2005; 10 (3): 145–9. [PubMed: 16156953]
  • Вахтель-Галор С., Сзето И. Т., Томлинсон Б., Бензи. F I. F. Ganoderma lucidum (Lingzhi): острый и краткосрочный биомаркерный ответ на добавки. Int J Food Sci Nutr. 2004; 1: 75–83. [PubMed: 14630595]
  • Ван С. И, Сюй М. Л., Сюй Х. С., редакторы. и другие. Противоопухолевый эффект Ganoderma lucidum опосредуется цитокинами, высвобождаемыми активированными макрофагами и Т-лимфоцитами. Int J Cancer. 1997; 70: 699–705. [PubMed: 52]
  • Ван Ю.Y, Khoo K. H, Chen S. T, Lin C. C, Wong C. H, Lin CH. Исследования иммуномодулирующей и противоопухолевой активности полисахаридов Ganoderma lucidum (Reishi): функциональные и протеомные анализы фракции гликопротеинов, содержащих фукозу отвечает за деятельность. Bioorg Med Chem. 2002; 10: 1057–62. [PubMed: 11836115]
  • Ван Х., Нг Т. Б. Ганодермин, противогрибковый белок из плодовых тел лекарственного гриба Ganoderma lucidum. Пептиды. 2006; 27: 27–30. [PubMed: 16039755]
  • Wang H, Ng T.B, Ooi V. E. C. Лектины из грибов. Mycol Res. 1998. 102: 897–906.

  • Wang G, Zhao J, Liu J, Huang Y, Zhong J. J, Tang W. Повышение экспрессии IL-2 и IFN-гамма и активности NK-клеток, участвующих в противоопухолевом эффекте ганодеровой кислоты Me in vivo . Int Immunopharmacol. 2007; 7: 864–70. [PubMed: 17466920]
  • Вассер С. П., Коутс П., Блэкман М., Крэгг Г., Левин М., Мосс Дж., Уайт Дж. Энциклопедия диетических добавок. Нью-Йорк: Марсель Деккер; 2005. Рейши или Линчжи (Ganoderma lucidum) стр.680–90.

  • Вассер С. П., Вейс А. Л. Лечебные свойства веществ, присутствующих в грибах высших базидиомицетов: современные перспективы. Int J Med Mushrooms. 1999; 1: 31–62.

  • Вен Х, Кан С., Сонг Й, Сонг Й, Сунг С. Х, Пак С. Дифференциация источников культивирования Ganoderma lucidum с помощью подхода метаболомики на основе ЯМР. Фитохим Анал. 2010; 21: 73–9. [PubMed: 148]
  • Weng C.J, Chau C.F, Yen G.C, Liao J. W, Chen D. H, Chen KD. Ингибирующие эффекты Ganoderma lucidum на онкогенез и метастазирование клеток гепатомы человека в клетках и модели на животных.J. Agric Food Chem. 2009. 57: 5049–57. [PubMed: 127]
  • ВОЗ (Всемирная организация здравоохранения). Статистика смертности. 2008. Отчет о состоянии здравоохранения в мире.

  • Ву Ю. А., Ким Х. Дж., Чо Дж. Х., Чунг Х. Дискриминация лекарственных трав по географическому происхождению с помощью спектроскопии отражения в ближней инфракрасной области и методов распознавания образов. J Pharm BiomedAnal. 1999; 21: 407–13. [PubMed: 10703997]
  • Wu Y. W, Fang H. L., Lin W. C. Последующая обработка Ganoderma lucidum уменьшала фиброз печени, индуцированный тиоацетамидом у мышей.PhytotherRes. 2010. 24 (4): 494–9. [PubMed: 143]
  • Wu Y, Wang D. Новый класс природных гликопептидов с сахарозависимой антиоксидантной активностью, полученных из плодовых тел Ganoderma lucidum. J Proteome Res. 2009; 8: 436–42. [Бесплатная статья PMC: PMC2656399] [PubMed: 185]
  • Wu Q. P, Xie Y. Z, Li S. Z, редакторы. и другие. На адгезию опухолевых клеток и экспрессию интегрина влияет Ganoderma lucidum. Enzyme Microb Technol. 2006; 40: 32–41.

  • Се Ю.З., Ли С. З., Йи А., редакторы. и другие. Ganoderma lucidum подавляет пролиферацию опухолевых клеток и вызывает гибель опухолевых клеток. Enzyme Microb Technol. 2009. 40: 177–85.

  • Xie J. T, Wang C. Z, Wicks S, редакторы. и другие. Экстракты Ganoderma lucidum подавляют пролиферацию клеток колоректального рака человека SW 480. Exp Oncol. 2006; 28: 25–9. [PubMed: 16614703]
  • Ян Ф. С., Ляу К. Б. Влияние условий окружающей среды на образование полисахаридов Ganoderma lucidum в погруженных культурах.Process Biochem. 1998. 33: 547–53.

  • Юн С. И, Эо С. К., Ким И. С., Ли К. К., Хан С. С. Противомикробная активность экстракта Ganoderma lucidum отдельно и в сочетании с некоторыми антибиотиками. Arch Pharm Res. 1994; 17: 438–42. [PubMed: 10319155]
  • Юэ К. Х, Се Ф. Б., Гуань С. Х, редакторы. и другие. Взаимодействие тритерпенов Ganoderma с доксорубицином и протеомная характеристика возможных молекулярных мишеней тритерпенов Ganoderma. Cancer Sci. 2008; 99: 1461–70. [PubMed: 18422750]
  • Юэн Дж.W, Gohel M. D. Противораковые эффекты Ganoderma lucidum: обзор научных данных. Nutr Cancer. 2005; 53: 11–7. [PubMed: 16351502]
  • Юэн Дж. У., Гохель М. Д. Двойная роль антиоксидантов Ganoderma в ДНК уротелиальных клеток при канцерогенной атаке. J Ethnopharmacol. 2008. 118: 324–30. [PubMed: 18550308]
  • Юен Дж. У., Гохель М. Д., Ау Д. В. Теломераза-ассоциированные апоптотические события гриба Ganoderma lucidum на предраковых уротелиальных клетках человека. Nutr Cancer. 2008; 60: 109–9. [PubMed: 18444142]
  • Юн Т.K. Новости из Азии: азиатские исследования химиопрофилактики рака. Ann N Y Acad Sci. 1999; 889: 157–92. [PubMed: 10668493]
  • Зайдман Б. З., Ясин М., Махаджна Дж., Вассер С. П. Лекарственные грибовидные модуляторы молекулярных мишеней в качестве терапевтических средств против рака. Appl Microbiol Biotechnol. 2005. 67: 453–68. [PubMed: 15726350]
  • Zhang Q. H, Lin Z. B. Противоопухолевая активность Ganoderma lucidum (Curt .: Tr.) P.Karst. (Lingzhi) (Aphyllophoromycetideae) полисахариды связаны с фактором некроза опухоли альфа и интерферонгаммой.Int J Med Mushrooms. 1999; 1: 207–15.

  • Zhang W, Tang Y. J. Новая трехступенчатая стратегия светового облучения при глубокой ферментации лекарственного гриба Ganoderma lucidum для эффективного производства ганодерной кислоты и полисахаридов Ganoderma. Biotechnol Prog. 2008; 24: 1249–61. [PubMed: 138]
  • Чжан Л., Чжан М., Чен Дж. Свойства раствора противоопухолевых карбоксиметилированных производных а- (1 → 3) -D-глюкана из Ganoderma lucidum. Chin J Polym Sci. 2001; 19: 283–9.

  • Zhao L, Dong Y, Chen G, Hu H. Экстракция, очистка, характеристика и противоопухолевая активность полисахаридов из Ganoderma lucidum. Carbohydr Polym. 2010. 80 (3): 783–9.

  • Чжао Дж. Д., Чжан Х. В. Важность, распространение и таксономия Ganodermataceae в Китае. Материалы симпозиума, организованного B 5-м Международным микологическим конгрессом, Ванкувер. 1994 1994 14-21 августа;

  • Zheng L, Jia D, Fei X, Luo X, Yang Z. Оценка генетического разнообразия внутри штаммов Ganoderma с AFLP и ITS PCR-RFLP.Microbiol Res. 2009. 164: 312–21. [PubMed: 17629688]
  • Чжун Дж. Дж., Сяо Дж. Х. Вторичные метаболиты высших грибов: открытие, биоактивность и биопродукция. Adv Biochem Eng Biotechnol. 2009. 113: 79–150. [PubMed: 176]
  • Чжоу X, Линь Дж., Инь И, Чжао Дж., Сунь X, Тан К. Ganodermataceae: Натуральные продукты и связанные с ними фармакологические функции. Am J Chin Med. 2007; 35: 559–74. [PubMed: 17708623]
  • Чжу Ю. П. Китайская Materia Medica. Сингапур: Harwood Academic Publishers; 1998 г.

  • Zhu X. L, Chen A. F, Lin Z. B. Полисахариды Ganoderma lucidum усиливают функцию иммунологических эффекторных клеток у мышей с подавленным иммунитетом. J Ethnopharmacol. 2007; 111: 219–26. [PubMed: 17182202]
  • Zhu X, Lin Z. Модуляция продукции цитокинов, гранзима B и перфорина в клетках CIK мышей полисахаридами Ganoderma lucidum. Carbohydr Polym. 2006; 63: 188–97.

  • Гриб рейши | Мемориальный онкологический центр им. Слоуна Кеттеринга

    Гриб рейши — гриб, занимающий важное место в традиционных медицинских системах Китая, Японии, Кореи и других азиатских стран благодаря своим свойствам, способствующим укреплению здоровья.Он используется в качестве иммуностимулятора больными СПИДом и раком. Активные компоненты включают полисахариды бета-глюкана и тритерпены (46) (47) .

    Экстракты рейши обладают иммуномодулирующими (2) (4) (5) , ренопротекторными (9) , противовоспалительными (36) и гепатопротекторными (37) свойствами. in vitro и in vivo. Клинические исследования показывают его преимущества в улучшении симптомов нижних мочевыводящих путей (СНМП) у мужчин (10) (20) , а также в проявлении легкого противодиабетического эффекта и уменьшении дислипидемии (29) .Однако рандомизированные контролируемые исследования не поддерживают использование рейши для устранения сердечно-сосудистых факторов риска, связанных с диабетом 2 типа (38) (43) . Пилотное исследование порошка спор рейши не показало его полезным при лечении пациентов с болезнью Альцгеймера (БА) (1) .

    Рейши также исследовали на предмет его противоракового потенциала. Доклинические данные показывают, что он обладает иммуномодулирующим (45) и химиопрофилактическим действием (21) (46) , облегчает тошноту, вызванную химиотерапией (13) , повышает эффективность лучевой терапии (22) и увеличивает чувствительность клеток рака яичников к цисплатину (27) .Это также может помочь предотвратить нефротоксичность, вызванную цисплатином (28) .

    В небольших клинических исследованиях рейши увеличивал антиоксидантную способность плазмы (6) (7) , усиливал как иммунный, так и опухолевый ответ у онкологических больных (8) (40) (44) и подавлял развитие колоректальных аденом (41) . Ремиссия гепатоцеллюлярной карциномы также сообщалась в нескольких случаях в одном исследовании (23) , а формула, содержащая рейши и лигуструм, помогла сохранить качество жизни у пациентов с немелкоклеточным раком легкого, проходящих химиотерапию (48) .

    Но было обнаружено, что экстракт рейши оказывает токсическое действие на лейкоциты (14) . Пациенты, проходящие лечение рака желудочно-кишечного тракта, имели более высокие уровни сывороточного онкомаркера CA72-4 после приема добавок со спорами рейши (42) . Необходимы дальнейшие исследования, чтобы определить безопасность и эффективность рейши в качестве дополнительного лечения рака.

    Гриб Линчжи — обзор

    3.13.4 Ганодерма (Lingzhi)

    Линчжи ( Ganoderma lucidum (Leyss.ex Fr.) Karst, Polyporaceae), хорошо известная ТКМ, клинически применялась в Китае и других странах Азии в течение нескольких тысяч лет. 148,163–165 Он был классифицирован как один из первого класса традиционных китайских лекарственных материалов в Shennong Bencaojing . Древние китайцы верили, что он может лечить различные болезни, и поклонялись ему как «бессмертной траве». Он зарегистрирован в Китайской фармакопее .

    Было заявлено, что он обладает противомикробной, 166,167 противовирусной активностью, в том числе против вируса иммунодефицита человека (ВИЧ), 168 активностью против старения, 169–171 антиоксидантной активностью, 172,173 противовоспалительной активностью, 174 , 175–186 свойства роста против HUC-PC, 187 противоопухолевая активность за счет ингибирования пролиферации и индукции апоптоза раковых клеток, 148,164,188–195 снижение инвазивности опухоли, 196–198 иммуномодулирующий эффект, 199–20 и модулирующая сигнализация. 205,206 Также сообщалось, что цитотоксичность доксорубицина (DOX) в сочетании с тритерпенами Ganoderma (GTS) или люциденовой кислотой N оказывает синергетический эффект на клетки HeLa, а молекулярные мишени GTS были идентифицированы с помощью двумерного гель-электрофореза. сравнительная протеомика. 207 Водные экстракты G. lucidum могут оказывать благотворное влияние при лечении сахарного диабета 2 типа (СД2) за счет снижения уровня глюкозы в сыворотке за счет подавления экспрессии гена PEPCK 208 в печени и других механизмов. 209 Он может значительно снизить накопление галактита 210 и ингибировать активность тирозиназы (уход за кожей). 211 Его можно использовать для лечения артрита 212–214 и гипогликемоза. Он действует на систему кровеносных сосудов 215 и защищает от повреждения печени у крыс. 216 Издавна восточная медицина стала популярной для лечения заболеваний печени. Экстракт, богатый тритерпеноидами, ингибировал пролиферацию HSC, активированных PDGF-BB, возможно, за счет блокирования фосфорилирования PDGFbetaR, тем самым указывая на его эффективность для предотвращения и лечения фиброза печени. 217 Ганодеровые кислоты обладают активностью против гепатита В. 218 219 Он также влияет на повреждение печени за счет антимутагенной активности. 220 Пептиды и протеогликаны G. lucidum могут защитить от повреждения печени у мышей. 221 222 Протеогликаны G. lucidum также обладают улучшающим действием на фиброз печени, вызванный тетрахлорметаном.

    Экстракты Ganoderma lucidum могут стимулировать поглощение глюкозы в клетках скелетных мышц L6 крыс. 223 Он также обладает мощным химиопрофилактическим действием, 224 и, связанный с его нейропротекторной ролью, имеет потенциал для терапевтического лечения болезни Паркинсона. 225 Ganoderma lucidum может быть полезным ингредиентом при лечении андроген-индуцированных заболеваний, включая доброкачественную гиперплазию предстательной железы и рак простаты. 226 227 Экстракты нескольких видов Ganoderma были цитотоксичны как для лекарственно-чувствительных, так и для лекарственно-устойчивых клеток SCLC, а также были проапоптотическими, индуцированными паттернами экспрессии генов, которые были аналогичны клеткам SCLC, обработанным химиотерапевтическими препаратами, и могли обращать резистентность. к химиотерапевтическим препаратам. 228

    В G. lucidum есть много видов компонентов, включая тритерпены, полисахариды, стерины, 174 белки, 229 алкалоиды, 230 длинноцепочечные жирные кислоты, 190 гликопептиды. 172 полисахаридных пептидов , 231 пептидов. 232 Основными группами биологически активных соединений в G. lucidum являются тритерпены и полисахариды. 162–232 Более 200 сильно оксигенированных и фармакологически активных тритерпеноидов ланостанового типа были выделены из плодовых тел, спор и мицелия G . lucidum (см. Рисунок 6, и , Таблица 2, ). 233–282

    Рис. 6. Четырнадцать скелетов тритерпеноидов Ganoderma lucidum .

    Таблица 2. Тритерпеноиды, выделенные из Ganoderma lucidum

    38 9 0690 907 OH 90 741 CH 3 907 907 907 907 907 907 907 O CH 907 OAc H 907 907 907 907 907 907 O 907 907 907 907 907 907 907 α OH 90 741 CH 2 OH 907 907 907 907 907 907 907 907 9074 1 Канал 3 907 907 907 907 907 907 907 907 3 907 41
  • 7 907 907 CH 3
  • 907 907 3 907 β OH 7 907 907 907 O 907 907, 257, 27 907 907 9069 0 907, 237 237 907 907 907 907 907 β 3 3 1 β OH 907 907 41 CH 3 α OH 907 41 CH 3 907 907 907 907 907 907 907 907 907 907 907 907 3 907 41 H 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 H H41 907 907 907 907 2 907 3 CH1 90 769 9 0741 α OAc 9074 1 COOH 9 0741 α OH 9 0737
    Скелет R 1 R 2 R 3 9069 5 R 6 R 7 R 8 R 9 R 10 Каталожный номер (s)
    OH CH 3 OH OH O CH 3 H CH 3 234 7 907 907 907 907 907 907 CH 3 OH OH O CH 3 H H 234
    192 O CH 3 O β OH H CH 3 H H 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 907 β OH CH 3 β OH β OH O CH 3 H H 236
    CH 3 O β OH O CH 3 H H 236
    1 195 907 907 β OH H H CH 3 H H 236
    196 β OH CH 3 β OH H H CH 3 H CH 3 236 44
    236 44
    CH 3 β OH H α OH CH 3 H H 236
    907 3 β OH H H CH 3 H H 236
    199 907 907 H α OH α CH 3 H H 241
    200 OH OH H α OH α CH 3 H H 241
    1 O β OAc β OH α CH 3 H H 243
    202 1 β OAc β OAc α CH 3 H H 243
    203 O 907 907 H O α CH 3 H H 243
    204 β OH CH 3 β OH β OH O α CH 3 H H 243
    205 205 β OH β OAc O α CH 3 H H 243
    206 β OH β OH β OH β OH α CH 3 H H 243
    207 β OH CH 3 O CH 3 OH H 249
    208 O CH 3 α OH O CH 3 O CH 3 252
    209 907 907 907 907 907 907 907 H O CH 3 OH CH 3 252
    210 O CH 3 OH CH 3 252
    211 β OH CH 3 CH 3 H CH 3 252
    212 β OH CH 3 α OH H α OH CH 3 H CH 3 252
    1 3 907 907 907 907 α OH H α OAc CH 3 H CH 3 252
    1 214 907 44 907 907 907 907 3 4 4 907 907 907 907 O H α OH CH 3 H H 253
    215 O CH 3 H CH 3 253
    216 β OH H H α OH CH 3 H H 253
    217 907 H H α OH CH 3 H CH 3 253
    218 O β OAc O CH 3 H H 254
    219 ОН 907 β OH 907 907 907 907 907 907 907 907 907 β OAc O CH 3 H H 254
    220 β OH CH 3 β OH H α OH CH 3 H CH 3 255
    1 221 907 907 3 907 β OH H O CH 3 H CH 3 96
    222 β OAc O CH 3 H CH 3 96
    223 223 ОН 907 907 H α OH CH 3 OH H 97
    224 β OH β OH H α OH Канал 3 OH Канал 3 97
    3 β OH β OH O CH 3 H H 98
    226 β OH H O CH 3 OH CH 3 100
    227 907 907 907 907 907 H α OH CH 3 H CH 3 100
    228 β OH CH 3 H H α OH CH 3 H CH 3 259
    H H O CH 3 H CH 3 259
    9071 β OH H α OH α CH 3 H CH 3 260
    231 907 β OH H O α CH 3 H CH 3 260
    232 β OH CH 3 O OAc O α CH 3 H CH 3 907 907 907 O CH 3 β OAc H α OAc α CH 3 H CH 3

    2606 907 907 2606 907 907 β OAc CH 3 β OAc H O α CH 3 H CH 3 2604 7 907 907 907 OAc CH 3 O OAc O α CH 3 H CH 3 260 9074 4
    236 O CH 3 O H O α CH 3 H CH1 3 237 O CH 3 β OAc H α OAc CH 3 H CH 3 9075 238 O CH 3 O H O α CH 3 H H 2704 44 907 907 2704 44 907 OH CH 3 O H α OH α CH 3 H H 270
    240 β OH CH 3 α OH H α OH α CH 3 111 H 241 O CH 3 H H α OH CH 3 H H 903 907 907 907 907 907 OH CH 3 H H α OH CH 3 H H 112
    9044 907 3 β OH OH O CH 3 H H 113
    244 O CH 3 β OH OH O CH 3 H CH 3 903 113 907 907 907 O CH 3 O OAc O CH 3 H H 272
    907 44 907 906 O OAc O CH 3 H H 272
    247 β 907 907 907 907 907 907 907 OH O CH 3 H CH 3 272
    248 β OH CH 3 β OH H O CH 3 H H 277
    β OH H O α CH 3 H H 243, 250, 270
    250 OH CH 3 β OH H α OH α CH 3 H H 250, 270
    1 251 α OH H α OH α CH 3 H H 250, 270
    252 CH 3 O β OAc O CH 3 H CH 3 25041 255
    CH 3 β OH H α OH CH 3 H CH 3 255, 259, 262 44 907 O CH 3 O H O CH 3 H CH 3 2556257 9044 907 β OH CH 3 β OH H O CH 3 H CH 3 255, 259, 259, 259
    256 O CH 3 β OH H O CH 3 H H
    257 β OH CH 3 β OH H α OH CH 3 H H 907, 26 277
    258 β OH CH 3 β OH H O CH 3 H
    259 O CH 3 O H O CH 3 H H 907, 23 4
    260 O CH 3 O O O CH 3 H H 261 O CH 3 β OH H α OH CH 3 H H 26902 907 O CH 3 O H O CH 3 H CH 3 236 907 264 907 907 907 907 907 907 907 907 O CH 3 O β OAC O CH 3 H H 236, 254
    264 β OH CH 3 β OH H α OH CH 3 H H
    265 β OH CH 3 β OH β OH O CH 3 H CH 3 CH 3
    266 β OH CH 3 O β OAc O α CH 3 H 907 907 907 907 267 O CH 3 β OH H α OH α CH 3 H H 2 699, 50
    268 β OH CH 3 O O O α Ch4 H H 2 β OH O O H O CH 3 OH H COOH CH 3 907 909 O O H H α OH α CH 3 H H COOH CH 3 O β OH O H α OH α CH 3 H β OH COOH CH 3 250
    272 O α OH O H α OH α CH 3 H 250
    273 β OH β OH O H O α CH 3 H 250
    274 β OH O O H O α CH 3 H 250
    275 O H O H α OH α CH 3 H COOH CH 3 250
    276 β OH β OH O β OH CH O 907 β OH COOH CH 3 250
    277 β OH O O β OH β OH COOH CH 3 250
    278 O H O H 41 907 907 907 907 α OH COOH CH 3 256
    279 O H O H α OH H OH COOCH 3 CH 3 256
    280 α41 α H44 907 OAc CH 3 H H COOH CH 3 264
    281 9041 α OAc7 907 907 α OAc CH 3 OAc H COOH CH 3 264
    282 9044 9044 907 907 907 907 907 907 904 H44 α OH CH 3 OAC H COOH CH 3 264
    283 α OAc α OCH 3 H H H CH 3 H H COOH CH 3 267 907 907 904 907 907 904 907 907 907 907 α OAc α OCH 3 H H α OH CH 3 OAc H COOH CH 3 907 44 CH 3 907 α OAc α OH H H α OH CH 3 OAc H COOH CH1 3
    α OAc α OCH 3 H H α OH CH 3 H H COOH 265
    287 α OH α OCH 3 H H H CH1 3 COOH CH 3 265
    288 O α OH H H H CH41 CH 3 274
    289 β OH O H H H CH 3 9041 H44
    290 β OH O H H H CH 3 H CH 2 OH CH 3 281
    291 β OH O H H H CHO CH 3 281
    292 O O H H H COOH CH 3 241, 242
    293 O O O β OH COOH CH 3 282
    294 3 α OAc α OAc 9 α CH 9 α 0751 β OAc H H CH 3 239
    295 α OH41 H H CH 3 239
    296 α OAc H α CH 3 H α CH 3 9075 CH 3 239
    297 O H CH 3 H H 907 254
    298 O H CH 3 H H CH 2 O H CH 3 254
    299 β OH H CH 3 H 254
    300 O H CH 3 H H 9069 H 907 4
    301 β OH H CH 3 H H COOH CH 3 30744 7 3 907 α OAc α OAc α CH 3 β OAc H COOH CH 3 266, 269
    303 α OH H α CH 3 β OAc H COO7
    304 α OAC H α CH 3 β OAc H COOH CH 907 907 907 907 907 α OAC α OH α CH 3 β OAc H COOH CH 3 30741 906 907 907 907 907 907 907 907 907 907 OH α OAc α CH 3 β OAc H COOH CH 3 266 9074 4
    307 α OH α OH α CH 3 β OH H CH 2 OH CH 26
    308 O H α CH 3 H H CH 2 OH CH 2 OH 267
    309 OH H α CH 3 H H CH 2 OH CH 2 OH 267
    310 H H α CH 3 H H CH 3 CH 2 OH 267 90 744
    311 H H α CH 3 β OAc H COOH CH 3 269
    312 α OAc H α CH 3 β OAc H COOH CH 3 269
    313 β OH α OAc CH 3 OAc H COOH CH 3 275
    314 O α OH CH 3 H H COOH CH 3 280
    315 α OAc α OAc CH 3 H H COOH CH 3 233, 240, 263, 264
    316 α OH α OAc CH 3 H H COOH CH 3 233, 240
    317 β OH α OAC CH 3 H H COOH CH 3 233, 240
    318 β OAc α OH CH 3 H H COOH CH 3 233, 240
    319 O CH 3 H H COOH CH 3 233, 240
    320 α OAc α OH CH 3 β OAc H COOH CH 3 233, 240
    321 β OH α OAc CH 3 β OAc H COOH CH 3 233, 240
    322 α OAc α OAc CH 3 β OAc H COOH CH 3 233, 240
    323 β OAc α OAc CH 3 β OAc H COOH CH 3 233, 240
    324 α OH α OAc CH 3 H O COOH CH 3 233, 240
    325 α OAc α OAc CH 3 H O COOH CH 3 233, 240
    326 α OAc α OH CH 3 H O COOH CH 3 233, 240
    327 α OAc α OH CH 3 907 44 α OH H COOH CH 3 233, 240
    328 α OH H CH 3 H H COOH CH 3 233, 240
    329 α OAc H CH 3 H H COOH CH 3 233, 240
    330 β OAc α OAc CH 3 H H COOH CH 3 233, 240, 263
    331 α OAc α OH CH 3 H H 907 44 COOH CH 3 233, 240, 264
    332 α OH α OH CH 3 H H COOH CH 3 233, 240, 275
    333 β OH α OH CH 3 H H COOH CH 3 233, 240, 275
    334 α OH α OH CH 3 α OH H COOH CH 3 233, 240, 276
    335 β OH α OH CH 3 β OH H COOH CH 3 233, 240, 276
    336 α OAc α OAc CH 3 α OH H COOH CH 3 233, 240, 276
    337 β OAc α OAc CH 3 α OH H COOH CH 3 233, 240, 276
    338 α OH α OH CH 3 β OAc H COOH CH 3 233, 240, 276
    339 β OH α OH CH 3 β OAc H CH 3 233, 240, 276
    340 α OAc α OH CH 3 OAc H COOH CH 3 265, 275
    341 4 O H CH 3 α OH CH 2 OH CH 3 β OH 235
    342 β OH H α CH 3 OH CH 2 OH CH 3 OH 237
    343 β OH H α CH 3 α OH CH 3 CH 2 OH OH 243
    344 O H α CH 3 α OH CH 3 CH 2 OH OH 243
    345 O H α CH 3 α OH CH 2 OH CH 3 OH 244
    346 β OH H α CH 3 Δ 24(25) CHO CH 3 Δ 24(25) 247
    347 O H α CH 3 O H CH 3 CH 3 OH 247
    348 O H α CH 3 α OH CH 3 CH 3 OH 278
    349 O H α CH 3 Δ 24(25) CH 2 OH CH 2 OH Δ 24(25) 243, 244
    350 O H α CH 3 α OH CH 3 CH 3 OH 244, 273
    351 β OH H α CH 3 α OH CH 3 CH 3 OH 244, 273, 278
    352 β OH H α CH 3 Δ 24(25) CH 2 OH CH 3 Δ 24(25) 247, 273, 278
    353 O H α CH 3 Δ 24(25) CH 2 OH CH 3 Δ 24(25) 273, 278
    354 O H α CH 3 α OH CH 2 OH CH 3 OH 9076 9 273, 278
    355 O α OH α CH 3 24(25) CH 2 OH CH 2 OH 24(25) 237, 243
    356 O H α CH 3 OH CH 2 OH CH 3 OH 237, 247
    357 β OH H α CH 3 24(25) CH 2 OH CH 2 OH 24(25) 237, 278
    358 5 O O H H α CH 3 H OH CH 2 OH CH 3 α OH 241
    359 O O H H α CH 3 H α OH CH 3 CH 3 OH 244
    360 β OH β OH O H α CH 3 H 24(25) COOH CH 3 H 244
    361 O β OH O α OH α CH 3 O H COOH CH 3 H 244
    362 β OH β OH O O α CH 3 O H COOH CH 3 H 244
    363 O β OH O O α CH 3 O H COOH CH 3 H 244
    364 O H O O α CH 3 O H COOH CH 3 H 244
    365 O O H H α OH H 24(25) CHO CH 3 2 4(25) 247
    366 β OH O H H α OH H 24(25) CHO CH 3 24(25) 247
    367 O β OH O α OH α OH O H COOH CH 3 H 247
    368 O α OH O α OH α OH O H COOH CH 3 H 247
    369 O β OH O O α OH O H COOH CH 3 H 247
    370 6 O CH 3 CH 3 OH OH O CH 3 H 234
    371 β OCHO CH 3 CH 3 OH OH O CH 3 H 234
    372 O CH 3 CH 3 O β OAc O CH 3 H 236
    373 β OH CH 3 CH 2 OH β OH H = H 245
    374 B OH CH 3 CH 3 βOH H O α OH H 246
    375 O CH 3 CH 3 O H O α OH CH 3 246
    376 O CH 3 CH 3 OH H O α CH 3 H 248
    377 β OH CH 3 CH 3 OH H O α CH 3 H 248
    378 β OH CH 3 CH 3 OH β OH O α CH 3 H 248
    379 β OH CH 3 CH 2 OH β OH H O CH 3 CH 3 252
    380 β OH CH 3 CH 2 OH O H O CH 3 CH 3 252
    381 β OH CH 3 CH 2 OH O β OH O CH 3 CH 3 252
    382 O CH 3 CH 3 O α OH O CH 3 CH 3 252
    383 β OH CH 3 CH 3 O β OH O CH 3 CH 3 252
    384 β OH CH 3 CH 3 α OH H α OH CH 3 CH 3 252
    385 β OH CH 3 CH 3 O β OAc O CH 3 CH 3 252
    386 O CH 3 CH 3 O β OAc O H CH 3 255
    387 β OH CH 3 CH 3 O β OAc O H CH 3 255
    388 O CH 3 CH 3 O H O CH 3 CH 3 9075 1 255
    389 O CH 3 CH 3 β OH H O CH 3 CH 3 255
    390 O CH 2 OH H β OH H α OH CH 3 H 256
    391 O CH 3 CH 3 O H O α CH 3 H 270
    392 O CH 3 CH 3 O OAc O CH 3 H 272
    393 β OH CH 3 CH 3 O OAc O CH 3 H 272
    394 β OH CH 3 CH 3 β OH β OH O CH 3 H 257, 258
    395 O CH 3 CH 3 β OH β OH O CH 3 H 257, 258, 268
    396 O CH 3 CH 3 O O O CH 3 H 257, 268
    397 O CH 3 CH 3 β OH α OH O CH 3 H 257, 268
    398 O CH 3 CH 3 β OH H O CH 3 H 258, 261, 268
    399 O CH 3 CH 3 β OH H O CH 3 H 236, 257
    400 O CH 3 CH 9075 0 3 β OH OH O CH 3 H 236, 261
    401 β OH CH 3 CH 3 β OH OH O CH 3 H 236, 261
    402 β OH CH 3 CH 3 O H O α CH 3 H 251
    403 β OH CH 3 CH 3 O H O α CH 3 H 251
    404 7 β OH β OH α OH 256
    405 β OH β OH O 257
    406 O β OH O 257
    407 8 O OH H α OH H 236
    408 β OH OH H O H 236
    409 β OH OH H α OH H 236
    410 O OH H O H 236
    411 O β OH β OH O CH 3 252
    412 β OH O β OAc O H 282
    413 9 O β OH β OH 238
    414 β OH β OH β OH 238
    415 10 H H 9 0744 279
    416 H CH 3 279
    417 OAc H 279
    418 12 H 249
    419 CH 3 249
    420 14 O 274
    421 β OH 274

    Ganoderic acid D ( 203 ) (GAD) is one of the major components in GTS.Он может связывать шесть изоформ семейства белков, аннексин A5 и аминопептидазу B. Была сконструирована возможная сеть, связанная с белками-мишенями GAD, и обсуждается возможный вклад этих белков в цитотоксичность GAD. 283

    DM ганодериновой кислоты ( 292 ) может подавлять рост клеток рака простаты и блокировать остеокластогенез. 284 DM ганодеровая кислота особенно подавляла экспрессию c-Fos и ядерного фактора активированных Т-клеток c1 (NFATc1).Это подавление приводит к ингибированию экспрессии трансмембранного белка, специфичного для дендритных клеток (DC-STAMP), и снижает слияние остеокластов. 285

    Влияние люциденовых кислот (A, B, C и N), выделенных из нового G . lucidum (YK-02) на индукцию апоптоза клеток и путь апоптоза в клетках HL-60. Люциденовая кислота B ( 395 ) (LAB) не влияла на профиль клеточного цикла; тем не менее, это увеличивало количество клеток с ранним и поздним апоптозом, но не некротических клеток.Это открытие может иметь решающее значение для химиопрофилактического потенциала LAB. 286

    Ганодерол B ( 299 ) с активностью ингибирования 5-α-редуктазы и способностью связываться с рецептором андрогенов (AR) может подавлять индуцированный андрогенами рост клеток LNCaP и подавлять повторный рост вентральной простаты, индуцированный тестостероном. у крыс. Подавление передачи сигналов AR ганодеролом B обеспечивает важный механизм его антиандрогенной активности. 287

    Ганодеровая кислота Me ( 315 ) (GA-Me) представляет собой тритерпеноид ланостана, очищенный из мицелия Ganoderma lucidum .GA-Me может ингибировать как рост опухоли, так и метастазы в легкие карциномы легких Льюиса у мышей C57BL / 6. По сравнению с контрольной группой, активность естественных клеток-киллеров (NK) была значительно усилена внутрибрюшинным введением GA-Me (28 мг / кг -1 ). Результаты ELISA и RT-PCR показали, что экспрессия интерлейкина-2 (IL-2) и интерферона гамма (IFN-γ) также увеличивалась ( p <0,05). Кроме того, экспрессия ядерного фактора-kappaB (NF-κB) повышалась после обработки GA-Me, который мог участвовать в продукции IL-2.В заключение, результаты этого исследования предполагают, что GA-Me может эффективно ингибировать рост опухоли и метастазирование в легкие за счет повышения иммунной функции. 288

    Ганодеровая кислота T ( 302 ) (GA-T) представляет собой тритерпеноид ланостана, очищенный из метанольного экстракта G . lucidum мицелий, который, как было обнаружено, проявлял цитотоксичность в различных клеточных линиях карциномы человека дозозависимым образом, в то время как он был менее токсичным для нормальных клеточных линий человека. Эксперименты на животных in vivo также показали, что GA-T подавляет рост солидных опухолей человека у бестимусных мышей.GA-T индуцировал апоптоз метастатических опухолевых клеток легких по внутреннему пути, связанному с митохондриальной дисфункцией и экспрессией p53, и он может иметь потенциал в качестве химиотерапевтического агента. 289

    Ганодериол F ( 308 ) (GolF), как было обнаружено, индуцирует старение линий раковых клеток. GolF индуцировал остановку роста линий раковых клеток HepG2, Huh7 и K562, но оказывал гораздо меньшее влияние на клетки гепатомы Hep3B и нормальные клетки MRC5 фибробластов легких и не влиял на мононуклеарные клетки периферической крови.Обработка GolF раковых клеток, за исключением Hep3B, привела к быстрому ингибированию синтеза ДНК и остановке цикла клеточной прогрессии в фазе G1. Было обнаружено, что GolF ингибирует активность топоизомеразы in vitro , что может способствовать ингибированию синтеза клеточной ДНК. Активация митоген-активируемой протеинкиназы EKR и повышающая регуляция ингибитора циклин-зависимой киназы p16 были обнаружены на ранних стадиях лечения GolF и, как предполагалось, вызывают остановку клеточного цикла и запускают преждевременное старение клеток HepG2.Возможность остановки роста и индукции старения раковых клеток предполагает противораковый потенциал GolF. 290

    Грибы рейши: король фитотерапии

    Некоторые из других названий этой невероятно мощной пищи — Лин Чжи, что означает «духовное растение», «растение десятилетней давности», «грибное бессмертие», потому что оно, кажется, способствует долголетию, «лакированный конк» из-за его сияния. внешний вид, и «гриб-призрак» из-за его редкости. Латинское название гриба рейши — Ganoderma lucidum.Ган означает «блестящий». Дерма означает «кожа». Lucidum означает «блестящий». Гриб рейши известен как «король всех лечебных трав». Профессор Хиросоки Хикино из Университета Тохоку, Япония, — «один из самых важных эликсоров на Востоке».

    В 1995 году исследователям удалось выделить ДНК Gandoderma tsugae и Granoderm lucidum. Эти два вида очень трудно различить. Более поздние исследования классифицировали Ganoderma lucidium из Азии как отдельную группу. Ganoderma lucidum из Европы и Америки более тесно связана с Ganoderma tsugae.Существует два разных типа грибов рейши, один с традиционным широким, похожим на полку плодовым телом, а другой имел форму рога и известен как Роккда-Рейши. Роккда-рейши страстно желали древние даосы. Этот вид грибов широко используется в произведениях искусства, датируемых веками. По слухам, эти два типа обладают разными лечебными свойствами. Однако эти два типа имеют по существу одни и те же фармакологически активные соединения. Гриб рейши не является кулинарным, так как он имеет очень горький древесный вкус.Гриб рейши употребляют строго в лечебных целях. Он содержит 119 различных тритерпеноидов, которые обладают противовоспалительным, противоопухолевым и противовирусным действием.

    Древний китайский текст под названием Shan Nang Ben Jiug 9 (около 500 г. н.э.) классифицирует Ganoderma lucidum как «полезный для жизненной энергии, повышения способности мыслить и предотвращения забывчивости», и может «освежить тело и разум, замедлить старение и активизировать его. жить долго »,« стабилизирует психическое состояние ». Современные травники используют рейши для лечения различных заболеваний, включая хроническую усталость, диабет, детоксикации печени, лечения гепатита, снижения уровня холестерина, предотвращения роста опухолей и предотвращения образования тромбов.В традиционной китайской медицине рейши используется для лечения астмы, язвы желудка, бессонницы, артрита и бронхита.

    Рейши: Антиастматический. Недавнее исследование, проведенное в больнице Маунт-Санаи, Нью-Йорк, с использованием китайских формул (ASHMI), в которых Ganaderma lucidum была заметным активным фактором, оказалось столь же эффективным, как и системные кортикостероиды для контроля астмы. Авторы пришли к выводу, что это лекарственное средство на травах, рейши, является безопасной и эффективной альтернативой для лечения астмы.ASHMI не оказал отрицательного влияния на функцию надпочечников и положительно повлиял на баланс Т-лимфоцитов. Рейши также используется для облегчения симптомов, связанных со стрессом, в качестве тонизирующего средства, может укреплять энергию и повышать выносливость, а также действует как успокаивающее средство на короткое время. Считается, что витамин С увеличивает усвоение рейши, поэтому многие врачи и травники рекомендуют витамин С в сочетании с грибами.

    Рейши в дикой природе встречается в густых влажных прибрежных провинциях Китая и предпочитает гниющие пни каштана, дуба и других широколиственных деревьев.В Японии рейши обычно встречается на старых сливовых деревьях. Рейши — это шляпка в форме почки, которая не теряет форму после высыхания. Поставляется в шести цветах; красный, белый, синий, черный, желтый и фиолетовый. Сейчас это крайне редко и трудно найти в дикой природе. Для прорастания требуется правильное сочетание кислорода и влаги. Рейши можно выращивать в старых бревнах, закопанных в тенистых влажных местах.

    История рейши. Даосские жрецы в первом веке были первыми, кто экспериментировал с рейши, включив грибы в волшебные зелья, которые давали долголетие, вечную молодость и бессмертие.Рейси входит в состав старейшего медикамента Китая — Herbal Classic (около 200 г. н.э.). Этот текст делит 365 трав на 3 категории; высшее, среднее и среднее. В категории «высший» рейши занимал первое место над женьшенем. Чтобы попасть в высшую категорию, трава должна демонстрировать сильные лечебные качества, не вызывать побочных или побочных эффектов при длительном приеме. В Herbal Classic говорится о рейши: «Вкус горький, его атмосферная энергия нейтральна, он не токсичен.Лечит скопление болезнетворных факторов в груди. Это хорошо для ци головы, в том числе для умственной деятельности. Он тонизирует селезенку, увеличивает мудрость, улучшает память, чтобы вы не забыли. Длительное употребление осветлит тело, вы никогда не станете старым. Это удлиняет годы. Он обладает духовными силами и развивает дух, так что вы становитесь «духовным существом, подобным бессмертным».

    Рейши и китайское искусство. Гриб рейши — символ крепкого здоровья и долгой жизни.Изображения рейши находятся на дверях, арках и перилах резиденций Императора в Запретном городе и Летнем дворце. В целом, изображения рейши, по-видимому, использовались как талисман или талисман на удачу. По изображению гриба рейши выполнены рисунки пером, гобелены, картины, украшения и нефритовые изделия. Гуань Инь, китайская богиня исцеления и милосердия, иногда изображается с грибом резиши.

    Исследования рейши. Рейши был частью китайской фармакопеи на протяжении многих веков. В 1980-х годах начались многочисленные исследования самых разных приложений.

    Рейши и рак кожи. Корейские ученые выделили ДНК, а затем поместили ДНК в экстракт рейши и подвергли воздействию ультрафиолетового излучения. Ученые пришли к выводу, что resihi проявляет «радиозащитную активность», защищает от повреждений ДНК. Употребление в пищу рейши может замедлить старение кожи и защитить от рака кожи. Китайские женщины принимают рейши, чтобы сохранить красоту своей кожи.Рейши содержится во многих японских патентованных формулах от выпадения волос.

    Рейши и лучевая терапия. Ученые из Академии медицинских наук Хебер в Шуйцзячжоу, Китай провели эксперимент, в котором они облучили мышей, которых кормили грибами реши. У мышей, которых кормили грибами рейши, не наблюдалось снижения количества лейкоцитов, а у мышей, которых кормили рейши, наблюдалось повышение выживаемости. Рейши улучшает иммунную функцию, предотвращая снижение выработки белых кровяных телец, несмотря на радиацию.

    Рейши и опухоли. Тайваньские ученые выделяют полисахариды из рейши и тестируют их in vitro. Ученые обнаружили, что макрофаги, моноциты и Т-лимфоциты увеличивают выработку некротического фактора опухоли, альфа, интерлейкина-1-бета, интерлейкина-6, но все в пределах нормы. Это демонстрирует иммуномодулирующие свойства рейши, активизируя иммунную систему, но не чрезмерно стимулируя активность. Рейши подавляет ангеогены при раке простаты, модулируя специфические сигналы.Рейши был одной из восьми трав, используемых в формуле, известной как PC-SPES, которая показала большой успех в борьбе с раком простаты. Считается, что рейши может индуцировать выработку природных химиотерапевтических агентов, таких как интерферон, интерлейкин-1 и интерлейкин-2. Рейши подавляет рост и увеличивает активность полимеризации в клетках мочевого пузыря in vitro. Он подавляет рост клеток рака груди, модулируя некоторые сигналы, что делает его эффективной дозозависимой дополнительной терапией. Было показано, что экстракт Ganoderma lucidum подавляет рост раковых клеток печени человека.Исследователи обнаружили, что активное соединение в полисахаридах экстракта рейши является активным механизмом действия на экспрессию цитокинов. Было обнаружено, что этим соединением, содержащимся в резихиполисахаридах, активируются различные иммунные клетки. Было обнаружено, что цитотоксичность, опосредованная естественными клетками-киллерами, значительно усиливается, и было показано, что она эффективно убивает опухолевые клетки.

    Рейши как антиоксидант. Ученые из Китайского университета Гонконга выделили в рейши вещества, принадлежащие к группе тритерпенов, ганодермальные кислоты A, B, C, D, глюциденовую кислоту B и гамодерматрол, все очень мощные антиоксиданты.В 2004 году двойное слепое плацебо-контролируемое перекрестное исследование, проведенное в Гонконгском университете Поликачена, изучало эффекты 4-недельного приема рейши в качестве антиоксиданта для пациентов с риском ишемической болезни сердца, повреждением ДНК, иммунными проблемами, воспалениями, маркерами для печеночная и почечная токсичность. Последующее исследование показало, что уровни антиоксидантов в плазме после приема рейши внутрь. Десятидневный прием добавок был связан с улучшением маркеров профиля биомаркеров ишемической болезни сердца.В другом исследовании образцы крови и мочи натощак были взяты у здоровых взрослых до и после 4 недель приема коммерчески доступного продукта рейши в дозе 1,44 грамма рейши в день, что эквивалентно 1,2 грамму свежих грибов в день. Наблюдалась небольшая тенденция к снижению липидов, увеличивалась антиоксидантная способность мочи. Нет доказательств токсичности для печени, почек или ДНК при приеме рейши. Анестезиологи из больницы Mackay Memorial, Тайбэй, Тайвань, недавно продемонстрировали, что экстракт Ganoderma lucidum обладает антиоксидантным действием против сердечной токсичности и действует как поглотитель супероксидов свободных радикалов.

    Рейши и инфекция. Из рейши был извлечен ряд веществ, которые показали интересные антиинфекционные свойства. Белок, обозначенный как ганодермин, является мощным противогрибковым средством. Протеогликан активен против вируса простого герпеса 1 или 2 типа, вмешиваясь в определенные события, которые ингибируют всасывание и проникновение в клетки-мишени. Было показано, что ганодермадиол действует против вируса простого герпеса 1 типа, вызывая волдыри на губах.

    Ганодериол f и ганодеманотриол подавляли циопатические эффекты, вызванные ВИЧ-1, при очень низких концентрациях.Генодерная кислота B ингибирует протеазу ВИЧ-1. Ганодермадиол обладает противовирусной активностью in vitro против вируса гриппа типа А. Три новых тритерпина ингибируют вирус Эпштейна-Барра, вызывающий инфекционный мононуклеоз и опухоли.

    Грибы рейши — часть моей личной стратегии функционального старения. Я использую его в масляном экстракте, с льняным маслом, сафлоровым маслом и кокосовым маслом, которые являются отличными источниками линолевой кислоты, которая превращается в омега-6, и альфа-линоленовой кислоты, которая превращается в омега-3.Для получения дополнительной информации о том, как это удивительное блюдо может помочь вам, свяжитесь с нашим офисом.

    Дополнительные ссылки:

    1. El-Mckkany, S. rt al. «Анти-Hiv-1 и анти-Hiv-1-протеазные вещества из Ganoderma lucidium» Фотохимия 49 (1998) 1651-1657
    2. Iwatsuky, K. et al. «Люциденовые кислоты P и Q, метиллюциденат P. и другие терпеноиды из грибка Ganoderma Lucidum и их ингибирующие эффекты на активацию вируса Эпштейна-Барра» J. National Prod66. 12 (2003) 1582-1585.
    3. Мин, Б.С. и другие. «Тритерпины из спор Ganoderma lucidum и их цитотоксология в отношении метокислоты и опухолевых клеток LLCT». Chem. Очарование. Бык. (Токио) 48. 79 (2000) 1226-1033

    Келли Миллер, округ Колумбия NMD FASA FBAARM CFDMP *, врач клиники оптимального здоровья Хоффмана.

    * В настоящее время нет лицензий для врачей-натуропатов в штате Флорида, и Совет хиропрактики в настоящее время не признает стипендию по старению и регенеративной медицине (FBAARM) Бразильско-американского совета по старению и регенеративной медицине или Сертификат в Функциональная диагностическая медицина (CFDMP) от Университета функциональной медицины.

    границ | Идентификация «гриба бессмертия»: оценка видового состава ганодермы в коммерческих продуктах рейши


    Ganoderma — большой и разнообразный, глобально распространенный род грибов, вызывающих гниение древесины, который включает виды, вызывающие белую гниль на различных древесных породах. Кроме того, практикующие восточную традиционную медицину прописали использование лакката (блестящего) вида Ganoderma , обычно называемого «рейши» или «линчжи», в качестве профилактического противовоспалительного лечения или для повышения иммунитета (Wang et al., 2012; Хеннике и др., 2016). В азиатских странах продукты рейши (этот термин будет использоваться в данной статье для обозначения как рейши, так и линчжи) используются уже более 2000 лет, а Ganoderma почитается как «гриб бессмертия» (Stamets, 2000). . Рейши является центральным элементом древних китайских и японских произведений искусства и ассоциируется с королевской властью, мудростью, сексуальным мастерством и вечной жизнью (Stamets, 2000). Согласно китайской и американской фармакопеям, рейши считается эликсиром от самых разных недугов (Sanodiya et al., 2009).

    Упоминания о рейши как о превосходной траве, укрепляющей здоровье человека, можно найти еще в 100 г. до н. Э. (Cao et al., 2012). В настоящее время представители комплекса видов G. lucidum продолжают назначаться в традиционной медицине, для которой плодовые тела обычно выращиваются, измельчаются и превращаются в таблетки, настойки или чаи (Stamets, 2000). В Американской травяной фармакопее G. lucidum sensu lato в основном рекомендуется для повышения иммунитета (Upton and Petrone, 2000; Jin et al., 2012). Кроме того, восточная традиционная медицина становится популярной во всем мире, а индустрия рейши довольно прибыльна, ее объем мировой торговли превышает 2,16 миллиарда долларов (Lai et al., 2004; Cao et al., 2012). Индустрия пищевых добавок, которая состоит из витаминов, минералов, растений и т. Д., Является растущим рынком с глобальными продажами на уровне 109 миллиардов долларов, при этом ожидается, что к 2020 году продажи увеличатся почти вдвое (Binns et al., 2017). Исходя из этих цифр, на промышленность рейши приходится примерно 2% мировых продаж диетических добавок.

    Недавние исследования показали, что G. lucidum sensu lato содержит около 400 биоактивных соединений, которые в основном представляют собой полисахариды и тритерпены (Sanodiya et al., 2009; Basnet et al., 2017). Эти соединения обладают противовоспалительным, радикальным поглощением кислорода, противоопухолевым, иммуностимулирующим и антимикробным действием (Paterson, 2006; Boh et al., 2007; Sanodiya et al., 2009; Jin et al., 2012). G. lucidum sensu lato продуцирует противогрибковый белок ганодермин, который оказывает ингибирующее действие на распространенные грибы, такие как Botrytis cinerea и Fusarium oxysporum (Wang and Ng, 2006), а также производит другие химические вещества с антибактериальным действием (Isaka et al. al., 2015; Basnet et al., 2017). Было показано, что противовирусные свойства тритерпенов, продуцируемых другим видом лаккатов, Ganoderma pfeifferi, , активны против вируса гриппа A (Mothana et al., 2003). Наконец, нематацидные свойства наблюдались при применении экстрактов Ganoderma к Heterodera glycines (Zhao et al., 2009). Помимо этих ингибирующих эффектов против других микробов, рейши в основном рекомендуется для повышения иммунитета (Upton and Petrone, 2000; Jin et al., 2012), с профилактическими свойствами, такими как противовоспалительное, противоаллергенное, радикальное поглощение кислорода, а также с ингибирующим действием на рост опухоли (Lin et al., 1991; Paterson, 2006; Powell, 2006; Boh et al., 2007; Джозеф и др., 2009; Санодия и др., 2009; Джин и др., 2012). Химические и биологические свойства многих грибов вызвали интерес исследователей-фармацевтов, изучающих вторичные метаболиты, продуцируемые грибами, которые могут привести к биопроизводству новых лекарственных форм (Zhong and Xiao, 2009).

    Таксономия лаккатных видов Ganoderma довольно запутанна, а таксономия и филогенетические отношения между таксонами все еще активно исследуются (Moncalvo et al., 1995a; Hong and Jung, 2004; Cao et al., 2012; Wang et al., 2012; Wang et al. др., 2012; Чжоу и др., 2015). В течение последнего столетия во многих исследованиях Ganoderma использовалось название G. lucidum для любого вида лаккат Ganoderma , произрастающего на деревьях лиственных пород (Pirone, 1957; Gilbertson and Ryvarden, 1986; Sinclair and Lyon, 2005; Zhou et al. al., 2015). Точно так же коммерчески доступные наборы для выращивания рейши (GYO) и витаминные добавки, производимые и продаваемые как традиционная медицина, широко продаются как G. lucidum. Молекулярные исследования установили, что G. lucidum sensu stricto (Curtis) Karst имеет естественное географическое распространение в Европе и некоторых частях Китая, а Ganoderma lingzhi Sheng H. Wu, Y. Cao и Y.C. Дай родом из Восточной Азии (Cao et al., 2012). Кроме того, на момент написания статьи G.lucidum sensu lato был разделен на множество различных видов (Welti, Courtecuisse, 2010; Cao et al., 2012; Wang et al., 2012; Zhou et al., 2015; Dai et al., 2017). Наиболее широко используемым лекарственным видом является G. lingzhi , который имеет морфологические и генетические характеристики, отличные от G. lucidum .

    Ожидается, что химические составные части грибов будут различаться для разных видов в пределах одного рода. Например, Kalogeropoulos et al. (2013) обнаружили значительные различия между тремя видами Lactarius в производстве стеринов, фенольных кислот, гидроксикоричных кислот, фенолов, флавоноидов, стильбенов и терпеновых кислот.У лекарственных грибов, таких как Fomes fomentarius, Fomitopsis pinicola, и Piptoporus betulina, отдельных изолятов, растущих в различных средах, также различались по фармакологическим компонентам, продуцируемым в плодовых телах (Dresch et al., 2015). Химические профили G. lucidum sensu stricto, европейского вида, и G. lingzhi, азиатского вида, значительно различаются по количеству тритерпеновой кислоты, продуцируемой базидиомами (Hennicke et al., 2016). Хотя тщательный анализ химического состава еще не проводился, вероятно, что тритерпены и другие биоактивные химические составы различаются в зависимости от различных филогенетически поддерживаемых таксонов Ganoderma , ранее включенных под названием G. lucidum (Hennicke et al., 2016) .

    В США Управление по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA) не регулирует маркетинг лекарственных средств против грибка. Как и в случае с другими травяными добавками, отсутствие регулирования может создать рынок, на котором «покупатель остерегается», поскольку целостность продукта лежит на производителе (Paterson, 2006; Raja et al., 2017). В связи с текущим быстро меняющимся пониманием характеристик Ganoderma среди видов, даже благонамеренные производители могут столкнуться с трудностями в обеспечении того, чтобы их продукт содержал указанные виды. Несколько китайских видов, которые когда-то назывались G. lucidum , теперь считаются принадлежащими к другим видам, включая Ganoderma flexipes, G. lingzhi, Ganoderma multipileum, Ganoderma sichuanense, G. sinense, и Ganoderma tropicum (Wang et al., 2009, 2012; Cao et al., 2012; Хеннике и др., 2016; Raja et al., 2017). Опросы потребителей грибных добавок пролили некоторый свет на таксономическую идентификацию рейши; в обзоре продуктов с множеством грибковых добавок ни один из шести продуктов рейши, успешно протестированных с помощью методов штрих-кодирования ДНК, не содержал G. lucidum, , несмотря на то, что они были помечены как « G. lucidum » (Raja et al., 2017). Кроме того, исследование химических профилей, идентифицированных с помощью хроматографии, показало, что примерно 75% продуктов рейши, продаваемых в США, не соответствуют химическим профилям G.lucidum sensu stricto (Wu et al., 2017). Цель этого исследовательского проекта состояла в том, чтобы изучить, какие вида Ganoderma присутствовали в наборах GYO и производили продукты рейши, продаваемые в качестве пищевых добавок, с использованием традиционных молекулярных методов на основе ДНК и следующего поколения.

    Материалы и методы

    Сбор проб

    Семнадцать наборов GYO, которые продавались для медицинского использования, были приобретены у компаний по выращиванию грибов в Соединенных Штатах.Эти наборы продавались в виде колонизированных деревянных дюбелей ( n = 8), инокулята опилок ( n = 7) или суспензий мицелия в шприцах ( n = 2). Все наборы были помечены как содержащие G. lucidum, , за исключением одного, который был помечен как содержащий Ganoderma curtisii. Однако один набор GYO был помечен G. lucidum sensu lato, признавая неоднозначность этого вида. Кроме того, два производимых продукта рейши были помечены как содержащие комбинацию видов грибов: (1) G.lucidum и Lentinula edodes, или шиитаке (продукт AL-R4) и (2) Ganoderma tsugai (предположительно неправильное написание G. tsuage ), G. lucidum, и G. изделие AL-R11). Кроме того, двадцать коммерчески доступных промышленных продуктов рейши были приобретены на основании следующих критериев: (i) были доступны для покупки в Интернете, (ii) помечены как включающие G. lucidum , и (iii) продавались с лечебными свойствами.Готовые продукты рейши продавались в виде капсул ( n = 13), порошков ( n = 3), таблеток ( n = 1), кофе ( n = 1) или чая ( n = 1). . За исключением двух продуктов, помеченных как G. lucidum sensu lato, признавая неоднозначность вида G. lucidum, все продукты были помечены как « G. lucidum » с маркетинговыми заявлениями, способствующими укреплению здоровья, например долголетие »,« поддерживает иммунную систему »,« детоксификатор »и« ботаническую поддержку иммунитета ».Кроме того, все производимые продукты имели следующую этикетку: « Эти утверждения не были оценены Управлением по контролю за продуктами и лекарствами. Этот продукт не предназначен для диагностики, лечения или предотвращения каких-либо заболеваний.

    Культивирование и ваучеринг наборов GYO reishi — Изоляция каждого набора GYO была произведена путем вырезания небольших кусочков (<1 мм 3 ) инокулята нереста стерильным скальпелем и помещения их на 2% агар с солодовым экстрактом (MEA) (Difco Laboratories, Франклин Лейкс, штат Нью-Джерси, США), приготовленный в соответствии с инструкциями производителя с добавлением стрептомицина (100 мг / л), 95% беномила (4 мг / л) и 85% молочной кислоты (2 мл / л), которые помогают ограничить рост бактерий и грибков у Ascomycota.Культуры поддерживали на наклонных поверхностях MEA в качестве рабочих запасов, а диски с колонизированным агаром погружали в стерильную воду для длительного хранения (Marx and Daniel, 1976). Коллекции культур (ALM1-ALM17) были заархивированы в Центре исследований лесной микологии (CFMR) Коллекции культур и гербарии Лесной службы Министерства сельского хозяйства США, которые обслуживаются Северной исследовательской станцией и размещены в Лаборатории лесных продуктов Министерства сельского хозяйства США в Мэдисоне, штат Висконсин. .

    Микроскопический анализ

    Мицелий из наборов GYO визуализировали в 5% КОН на предметных стеклах с помощью светового микроскопа Nikon Eclipse 55i (Мелвилл, Нью-Йорк) для определения наличия / отсутствия хламидоспор, которые являются диагностическими признаками для некоторых видов лаккатных Ganoderma . (Дворяне, 1965; Хонг, Юнг, 2004).Для каждого набора GYO были изготовлены два предметных стекла, взяв мицелий из центра колонии зрелой (восьмидневной) культуры, выращенной на MEA. Эти слайды визуализировали при 40-кратном увеличении и сканировали на наличие / отсутствие хламидоспор. Точно так же продукты из добавок рейши были визуализированы на предметных стеклах с 5% КОН, чтобы найти какие-либо отличительные микроскопические особенности. Для каждого произведенного продукта рейши были изготовлены по два предметных держателя путем измельчения продуктов (при необходимости) и помещения небольшого количества (<1 мг) порошка в каплю КОН.Затем образцы визуализировали с 40-кратным увеличением путем сканирования каждого предметного стекла и тщательного выявления любых особенностей, таких как базидиоспоры, генеративные гифы, гифы скелета и хламидоспоры. Эти характеристики использовались для определения того, были ли продукты изготовлены из незрелых базидиом, зрелых базидиом, вегетативных культур или базидиоспор.

    Экстракция ДНК, ПЦР и секвенирование по Сэнгеру


    экстрагировали из каждого продукта добавки рейши и мицелия из набора GYO с помощью мини-набора Qiagen DNeasy Plant (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя.Область внутреннего транскрибируемого спейсера (ITS) рибосомальной ДНК (рДНК) амплифицировали с помощью ПЦР с праймерами ITS1F (5 CTTGGTCATTTAGAGGAAGTAA) и ITS4b (5 CAGGAGACTTGTACACGGTCCAG, 1990; White et al. 1993) для идентификации видов Ganoderma , присутствующих в выборке. ITS — это универсальный штрих-код грибов для грибов, который обычно используется для определения границ видов (Schoch et al., 2012). Кроме того, фактор элонгации трансляции 1-альфа ( tef1α ) был секвенирован для всех наборов GYO с использованием праймеров EF-Gano23F (5 GGTGTCAGGCAGCTCATYGT) и EF-Gano887R (5 CGAACTTGCAR), которые были разработаны специально для амплификации видов лакката Ganoderma .Для каждой реакции ПЦР использовали следующие реагенты: 12,5 мкл Immomix Red Master Mix (Bioline, Лондон, Великобритания), 8,5 мкл H 2 O для ПЦР, 1 мкл BSA (20 мг / мл, Thermo Fisher Scientific, Waltham, MA, США), по 1 мкл каждого 10 мМ праймера и 1 нг / мкл матрицы ДНК. Реакции проводили на термоциклере MJ Mini (Bio-Rad, Hercules, Калифорния, США) в следующих условиях термоциклера: цикл 95 ° C в течение 10 мин и затем 35 ° циклы при 94 ° C в течение 30 с, переменный отжиг. температуры 55 ° C (ITS) или 62 ° C ( tef1α ) в течение 30 с и 72 ° C в течение 1 мин, с последующим заключительным этапом наращивания при 72 ° C в течение 5 мин, а затем 4 ° C.Продукты ПЦР оценивали визуально на 1% агарозном геле, окрашенном Gel Red (Biotium, Фремонт, Калифорния, США) для подтверждения успешной амплификации. Ампликоны очищали с помощью Exo-SAP-IT (Thermo Fisher Scientific, Уолтем, Массачусетс, США) в соответствии с рекомендациями производителя. Секвенирование по Сэнгеру было выполнено с использованием тех же праймеров в лаборатории секвенирования Genewiz. Прямые и обратные последовательности для каждого образца были выровнены и визуально отредактированы с использованием GENEIOUS 10 (Kearse et al., 2012). Все созданные последовательности Сэнгера были депонированы и внесены в базу данных последовательностей GenBank (см. Ниже). Последовательности ITS и tef1α были запрошены по внутренней базе данных по всем известным видам Ganoderma (Zhou et al., 2015). Идентификации были основаны на 99-100% гомологии с надежными эталонными последовательностями.

    Последовательность мета-штрих-кодирования Illumina

    Если бы в отдельном образце присутствовало несколько таксонов, секвенирование по Сэнгеру либо дало бы чистую последовательность ДНК только для доминирующего таксона, либо дало бы смешанную последовательность, которая не была бы читаемой из-за множества перекрывающихся пиков последовательностей.Соответственно, мы выполнили секвенирование метабаркодирования Illumina в дополнение к секвенированию по Сэнгеру для всех производимых продуктов рейши, потому что это продукты, которые, скорее всего, содержат несколько видов на основе рекомендаций Raja et al. (2017). ДНК была экстрагирована из 20 произведенных продуктов рейши, как описано ранее, и все они были подвергнуты секвенированию с использованием метабаркта Illumina. После экстракции концентрацию ДНК измеряли с помощью NanoDrop 2000 (Thermo Fisher Scientific, Уолтем, Массачусетс, США), и образцы уравновешивали перед ПЦР до 5 нг / мкл.Для каждой реакции ПЦР использовали следующие реагенты: 12,5 мкл смеси Phusion High-Fidelity PCR Mix (New England Biolabs, Ипсвич, Массачусетс, США), 1,25 мкл каждого прямого и обратного праймера 5 мкМ и 5–10 нг ДНК. . РДНК ITS1 была амплифицирована грибковоспецифичными праймерами ITS1f (Gardes and Bruns, 1993) и ITS2 (White et al., 1990) с использованием восьми штрих-кодовых адаптеров i5 (прямой) и i7 (обратный) TruSeq (Illumina, San Diego, CA , Соединенные Штаты). Условиями ПЦР были: денатурация при 94 ° C в течение 1 минуты, затем 30 циклов при 94 ° C в течение 30 секунд, 52 ° C в течение 30 секунд, 68 ° C в течение 30 секунд и окончательное удлинение при 68 ° C в течение 7 минут, используя 5– 10 нг ДНК.В качестве положительного контроля было построено фиктивное сообщество из шести видов с использованием эквимолярных концентраций ДНК, экстрагированных из чистых культур MEA из наборов GYO или диких коллекций. Кроме того, использовали отрицательный водный контроль ПЦР. Ампликоны проверяли на 1,5% агарозных гелях, окрашенных SYBR Green (Invitrogen, Карлсбад, Калифорния, США) и нормализованных до эквимолярной концентрации с помощью набора для нормализации SequalPrep (Thermo Fisher Scientific, Waltham, MA, США). Если полосы ПЦР отсутствовали на геле ( n = 5, AL-R4, AL-R9, AL-R10, AL-R12 и AL-R19), образцы готовили так же, как и другие образцы, за исключением того, что продукты ПЦР не были разбавленный.Библиотеку очищали с помощью набора Agencourt AMPure XP (Beckman Coulter, Бреа, Калифорния, США) для удаления димеров праймеров перед секвенированием по протоколу парных концов MiSeq 300 п.н. (Illumina, Сан-Диего, Калифорния, США) в Междисциплинарной лаборатории. Центр биотехнологии Университета Флориды. Исходные данные доступны в SRA BioProject Accession SRP149732 NCBI.

    Анализ мета-штрих-кодирования Illumina

    Данные последовательности Illumina обрабатывались с помощью конвейера AMPtk (версия 1.1.0). Вкратце, перекрывающиеся чтения 2 × 300 Illumina MiSeq были объединены с помощью USEARCH (версия 9.2.64; Edgar and Flyvbjerg, 2015), все праймеры были удалены из объединенных чтений. Все чтения размером менее 150 п.н. были удалены. Чтения, длина которых составляла менее 300 п.н., дополнялись буквами N, а чтения, длина которых превышала 300 п.н., были обрезаны. Этот шаг обрезки / заполнения улучшает кластеризацию и другие последующие шаги (Palmer et al., 2018). Затем считанные данные были отфильтрованы по качеству с ожидаемыми ошибками менее 1,0 (Edgar and Flyvbjerg, 2015), реплицированы и сгруппированы с 97% сходством, широко принятым пороговым значением для приблизительного вида у грибов (Kõljalg et al., 2013), используя UPARSE. Все одноэлементные OTU были удалены. Полученную в результате таблицу OTU затем отфильтровали на предмет потери индекса 0,5%, следуя указаниям Palmer et al. (2018). Таксономия была присвоена с использованием подхода гибридной таксономии в AMPtk. Чтобы проверить идентичность полученных OTU, 60 последовательностей ITS, которые включали надежные эталонные последовательности, а также последовательности, полученные из последовательностей Сэнгера и Illumina (таблица 1), были выровнены с использованием плагина MAFFT (Katoh et al., 2002) в GENEIOUS 10 . Совмещение было отредактировано визуально, чтобы устранить любые двусмысленности и минимизировать различия, которые могли возникнуть в результате ошибки секвенирования.Визуально отредактированные выравнивания каждого локуса использовались для независимого филогенетического анализа с использованием максимального правдоподобия, реализованного в RAxML (Stamatakis, 2014), и байесовского вывода с использованием плагинов MrBayes (Ronquist et al., 2012) в GENEIOUS 10. Анализ RaxML использовал общий эволюционная модель с обращением времени (GTR) с быстрой загрузкой и 1000 повторений начальной загрузки, и байесовский анализ использовал эволюционную модель GTR с вариацией гамма-скорости с использованием четырех гамма-категорий для одного миллиона поколений с 4 нагретыми цепями и длиной прожига 100000 .Эти некорневые деревья были созданы для размещения ITS-последовательностей и ITS1 OTU, сгенерированных в результате секвенирования Sanger и Illumina, в клоны, идентифицированные на основе надежных эталонных последовательностей (рис. 1). Трассы и деревья были депонированы в Treebase под номером 22867.

    ТАБЛИЦА 1. Образцы этикеток, видов, местоположений, типов продуктов и регистрационных номеров ITS GenBank для коммерческих продуктов рейши и эталонных последовательностей, используемых в филогенетическом анализе.

    РИСУНОК 1. Неукорененное филогенетическое дерево максимального правдоподобия, реконструированное с использованием ITS-последовательностей, созданных в этом молекулярном обзоре, вместе с надежными эталонными последовательностями для идентификации на уровне видов. На ветвях указаны значения начальной загрузки, за которыми следует апостериорная вероятность байесовской филогении с идентичной топологией. Контрольные последовательности аннотированы названиями видов и номерами доступа GenBank. В этом исследовании были обнаружены кластеры заштрихованных последовательностей, а ветви последовательностей с одинаковым цветом относятся к одному и тому же виду.Контрольные последовательности для G. weberianum были включены, чтобы показать связь с идентификацией видов G. resinaaceum sensu lato. Последовательности, созданные с помощью секвенирования по Сэнгеру, помечены как AL-M # (наборы GYO reishi) и AL-R # (промышленные продукты), а последовательности, созданные с помощью Illumina MiSeq, обозначены как OTU # (промышленные продукты).


    Микроскопический анализ

    Из наборов GYO 100% чистых культур имели генеративные гифы с зажимными соединениями и соответствовали морфологии колоний in vitro Ganoderma (Nobles, 1965; Adaskaveg and Gilbertson, 1989).Сорок один процент ( n = 7) из семнадцати наборов GYO конститутивно продуцировались гладкими, интеркалярными и конечными, двустенными, гиалиновыми, яйцевидными или обпириформными хламидоспорами, которые соответствуют видам в кладе Ganoderma смола (Hong и Jung , 2004). Никаких других диагностических структур в вегетативном мицелии других продуктов набора GYO не наблюдалось. Тридцать пять процентов ( n = 7) произведенных продуктов рейши предположительно были сделаны со зрелыми плодовыми телами, на основании идентификации генеративных и скелетных гиф и базидиоспор.Двадцать пять процентов ( n = 5) предположительно были получены с незрелыми плодовыми телами (генеративные и скелетные гифы, без базидиоспор), двадцать процентов ( n = 4) предположительно были получены с использованием культур (только генеративные гифы) и десять процентов ( n = 2) предположительно были сделаны только с базидиоспорами. Пять процентов ( n = 1, AL-R15-кофе) произведенных продуктов не имели окончательных салфеток Ganoderma на основе наших слайд-держателей (Таблица 2).

    ТАБЛИЦА 2. Сводка результатов секвенирования по Сэнгеру, сравнивающих таксономические этикетки продукта (наборы GYO Reishi и произведенные продукты Reishi) с идентификацией штрих-кода на основе ДНК.

    Идентификация на основе секвенирования по Сэнгеру

    последовательностей ITS были успешно амплифицированы для 100% ( n = 17) образцов набора GYO и 70% ( n = 14 из 20) произведенных продуктов рейши. Последовательности tef1α были успешно созданы для 100% ( n = 17) образцов набора GYO, и попытки амплификации произведенных продуктов рейши не предпринимались.31 ITS-последовательность (Mh260056-Mh260086) и 17 tef1α последовательностей (Mh268053-Mh268069) депонированы в Genbank. Из наборов GYO два продукта были правильно помечены как G. curtisii (AL-M17) и G. lucidum (AL-M16). Остальные 15 наборов GYO были ошибочно промаркированы как G. lucidum и фактически были идентифицированы как G. lingzhi ( n = 7), G. сидячий ( n = 4), G. sensu lato ( n = 3) или G.curtisii ( n = 1). Все произведенные продукты рейши, для которых мы создали последовательности, были ошибочно помечены как G. lucidum, и впоследствии идентифицированы с помощью секвенирования по Сэнгеру как G. lingzhi, , за исключением одного образца (AL-R6), который был идентифицирован как G. applanatum. Эти результаты представлены в таблице 1.

    Идентификация на основе мета-штрих-кодирования Illumina

    Амплификация и секвенирование геномной библиотеки были успешными для 19 из 20 протестированных производимых продуктов рейши (AL-R12 не удалось).Все успешно секвенированные произведенные продукты рейши ( n = 19) содержали по крайней мере один вид Ganoderma (Таблица 3). Однако G. lucidum sensu stricto не был обнаружен ни в одном из продуктов. Каждый из трех продуктов содержал только один вид Ganoderma , обнаруженный с помощью мета-штрих-кодирования Illumina: G. applanatum в AL-R6 и G. lingzhi в AL-R7 и AL-R14 (рис. 2). Мы также обнаружили несколько видов Ganoderma в 16 из 19 произведенных продуктов.Из-за предвзятости ПЦР, связанной с методами секвенирования следующего поколения, количественная оценка численности видов в сообществе на основе обилия последовательностей в образце обычно не считается надежной (Palmer et al., 2018). Тем не менее, мы смогли обнаружить шесть видов нашего ложного сообщества в нашем положительном контроле с относительно небольшой систематической ошибкой (число считываний варьируется от 6015 до 51 020). Кроме того, наш отрицательный контроль дал только одну OTU, которая не присутствовала ни в одном из наших образцов, а также не наблюдалась полоса продукта ПЦР с гель-электрофорезом, как описано ранее.Поэтому мы использовали относительное количество последовательностей для количественной оценки присутствия Ganoderma spp. в каждом образце (таблица 2). Большинство продуктов (74%, n = 14) содержали большое количество последовательностей G. lingzhi , с незначительным количеством последовательностей (<5% считываний) от других видов Ganoderma или других соответствующих таксоны. Пять из 19 успешно секвенированных продуктов имели последовательность> 5% от других Ganoderma или соответствующих видов грибов, кроме G.lingzhi (Рисунок 2).

    ТАБЛИЦА 3. Последовательности Illumina считываются для произведенных продуктов, показывая только релевантные таксоны, которые были либо обнаружены на этикетке продукта, либо были видами Ganoderma , обнаруженными с помощью технологии секвенирования следующего поколения с использованием ITS1.

    РИСУНОК 2. Относительная последовательность считывания Illumina для каждого произведенного продукта рейши (то есть пищевых добавок). Каждый цвет представляет собой уникальный таксон, который был либо на этикетке продукта, либо вид Ganoderma , обнаруженный с помощью технологии секвенирования нового поколения с использованием платформы Illumina.«FAILED» означает, что реакция Illumina не дала данных хорошего качества. «ND» означает, что в ходе прогона / анализа Illumina ничего не было обнаружено.

    Метод максимального правдоподобия и байесовская филогения, построенная с использованием последовательностей секвенирования Sanger и Illumina, дали идентичные результаты, поэтому представлена ​​только некорневая филогения RAxML (рис. 1). Последовательности ITS, созданные в этом исследовании, сгруппированы со значительной статистической поддержкой с эталонными последовательностями.


    Результаты этого исследования подчеркивают таксономические проблемы, связанные с лекарственным маркетингом видов лакката Ganoderma , которые используются для выращивания икры и / или продаются как промышленные продукты (т.е., БАДы). В большинстве наборов GYO и производимых продуктов рейши указано, что они были изготовлены из « Ganoderma lucidum ». Однако продукты рейши не производились, и только один набор GYO (AL-M16) фактически содержал G. lucidum sensu stricto. Неправильная идентификация видов Ganoderma в этих продуктах считается непреднамеренной и, вероятно, из-за сложных таксономических проблем в лаккате Ganoderma , а также номенклатурных изменений, произошедших в последние годы (Cao et al., 2012; Wang et al., 2012; Чжоу и др., 2015; Хеннике и др., 2016; Дай и др., 2017). В Северной Америке и во всем мире многие виды лаккатных Ganoderma игнорировались или рассматривались как синонимы G. lucidum в прошлом веке. Например, геном G. lucidum , который был секвенирован как модельный лекарственный гриб Chen et al. (2012), на самом деле G. lingzhi на основе rpb1 и rpb2 участков ДНК. Предыдущие филогенетические исследования выдвинули гипотезу о том, что вида Ganoderma имеют викариантный паттерн эволюции, при этом субклады обычно содержат сестринские таксоны в Северной Америке и в Азии-Европе (например,g., G. curtisii и G. lingzhi ) или географически разделенных регионах в пределах Северной Америки (например, Ganoderma tsugae и Ganoderma oregonense ) (Gilbertson and Ryvarden, 1986; Cao et al., 2012; Zhou et al., 2015; Hennicke et al., 2016). Основываясь на этих филогенетических паттернах, мы ожидаем, что G. lucidum и другие виды laccate Ganoderma не будут иметь глобального распространения, если они не были интродуцированы людьми. Однако общепринятой практикой прошлого века было использование эпитета « G.lucidum ”для лакката Ganoderma видов, встречающихся на лиственных породах в Азии, Европе и Северной Америке. Это межконтинентальное таксономическое объединение сделало невозможным сделать четкие выводы о биологии и химии этого культурно и экологически важного рода древесных гниющих грибов, поскольку часто неясно, какой вид изучается в каком-либо конкретном исследовании. Эта таксономическая проблема распространилась на индустрию коммерческих лекарственных грибов, где продукты, содержащие любой лаккат Ganoderma , обычно маркируются как содержащие G.lucidum без дополнительной информации о происхождении продукта или о том, был ли он произведен из нескольких источников или видов. Обнаружение отдельных видов в пределах комплекса видов G. lucidum подняло вопросы о выводах, сделанных в предыдущих экологических исследованиях этого рода (Loyd et al., 2018a, b). Он также выявляет потенциальные источники изменчивости химического состава и эффективности продуктов и представляет проблемы для потенциальных усилий по открытию лекарств.

    Из 36 комплектов GYO и произведенных продуктов рейши, которые были помечены как G.lucidum в нашем исследовании мы обнаружили, что 86% из них включали замену продукта. В большинстве случаев G. lingzhi заменяли G. lucidum. В качестве лекарственного средства эта «замена» рейши, вероятно, более подходит, чем G. lucidum , указанный на этикетке. G. lingzhi, , который произрастает в Восточной Азии, недавно был определен как один из видов, ранее ошибочно обозначенных в Азии как G. lucidum sensu lato (Cao et al., 2012). G. lingzhi , вероятно, является видом, который следует правильно ассоциировать с общими названиями «рейши» и «линчжи», используемыми в китайской медицине (Dai et al., 2017). Мы также нашли доказательства того, что G. lucidum были заменены другими таксонами, в том числе G. applanatum sensu lato, G. australe sensu lato, G. curtisii, G. gibbosum, G. resinaceum sensu lato и г. сидячая. Эти таксоны продавались в виде наборов GYO или давали> 5% считываний последовательности Illumina для отдельного производимого продукта рейши.Все эти виды генетически отличаются от G. lucidum , который является родным для лесов умеренного пояса Европы и некоторых частей Китая (Cao et al., 2012; Wang et al., 2012). Эти другие виды также довольно сильно отличаются друг от друга морфологически. Фактически, G. applanatum, G. australe, и G. gibbosum имеют нелаккатные (тусклые) pilei и относятся к подроду Elfvingia (Moncalvo et al., 1995b). G. curtisii и G.Resinaceum продуцируют лаккатные (блестящие) пилеи, как в G. luccidum , но принадлежат к двум отдельным субкладам в пределах подрода Ganoderma (Zhou et al., 2015). Основываясь на генетическом разнообразии таксонов, продаваемых в виде наборов GYO и производимых продуктов рейши, вполне вероятно, что существуют значительные различия в качестве и количестве важных с медицинской точки зрения химических веществ среди продуктов, продаваемых как «рейши» и обозначенных как « G». . lucidum ».

    Видовые замены в потребительских товарах наблюдались и у других лекарственных и кулинарных грибов.Среди них видов Cordyceps , Boletus и Phellinus (Dentinger and Suz, 2014; Raja et al., 2017). Raja et al. (2017) обнаружили, что многие из продуктов, маркированных Cordyceps sinensis, , высоко ценимым лекарственным грибком, были идентифицированы на основе штрих-кодов ДНК Tolypocladium inflatum , которые принадлежат к тому же отряду Hypocreales, что и C. sinensis. Точно так же Dentinger и Suz (2014) идентифицировали три новых вида Boletus в одной коммерчески продаваемой упаковке китайских белых грибов, предположительно Boletus edulis, в лондонском супермаркете.Кроме того, Newmaster et al. (2013) показали, что индустрия фитотерапии (т. Е. Лекарственных растительных продуктов) страдает от тех же проблем с неправильной маркировкой. Авторы показали, что 68% протестированных продуктов (30 из 44) имели замену видов и около 33% этих продуктов содержали наполнители или загрязнители, которые не были указаны на этикетке продукта. Кроме того, было обнаружено, что некоторые из немаркированных загрязнителей / наполнителей представляют потенциальный риск для здоровья потребителей (Newmaster et al., 2013). Мы обнаружили другой вид Ganoderma , отличный от указанного на этикетке продукта, во всех тестируемых нами продуктах, кроме двух.В более ограниченной выборке Raja et al. (2017) также показали, что продукты рейши, обозначенные как G. lucidum , были либо G. sichuanense , либо G. G. sichuanense был описан до G. lingzhi, , но голотип не соответствовал исходному описанию G. sichuanense. Фактически, голотип G. sichuanense имеет морфологию и ITS-последовательности, которые больше похожи на Ganoderma weberianum .Кроме того, эта путаница усугубляется тем фактом, что два названия G. lingzhi и G. sichuanense продолжают использоваться в литературе (Cao et al., 2012; Wang et al., 2012; Zhou et al. , 2015; Hennicke et al., 2016; Dai et al., 2017; Raja et al., 2017) для одного и того же вида, несмотря на путаницу, возникшую из-за типовых экземпляров / последовательностей G. sichuanense. Как упоминалось в предыдущих исследованиях (Cao et al., 2012; Zhou et al., 2015; Dai et al., 2017), мы предлагаем название G.lingzhi следует использовать до тех пор, пока не будет решена таксономия G. sichuanense .

    Wu et al. (2017) проверили качество продуктов-добавок рейши, оценив профили полисахаридов и тритерпена с помощью хроматографии и картирования сахаридов, и обнаружили, что только 26,3% протестированных продуктов соответствовали профилю тритерпена и полисахарида аутентифицированного G. lucidum sensu строгий образец. Согласно нашим результатам, большинство производимых продуктов рейши (т.е., пищевые добавки), и почти половина продуктов из наборов GYO, продаваемых в США, содержала азиатские виды G. lingzhi , несмотря на то, что они были обозначены как G. lucidum. Hennicke et al. (2016) показали, что G. lucidum и G. lingzhi отличаются не только генетически на основе гена бета-тубулина, но и химически. Экстракты G. lingzhi продуцировали значительно больше тритерпеновых кислот, чем экстракты, полученные с G.lucidum sensu stricto (Hennicke et al., 2016). Хотя продукты были маркированы неправильно, имеющиеся данные свидетельствуют о том, что G. lingzhi является наиболее широко используемым видом в традиционной китайской медицине. Однако необходимы дополнительные данные, чтобы убедиться, что другие таксоны также не использовались традиционно (Cao et al., 2012; Dai et al., 2017). В дополнение к G. lingzhi, в наборы GYO входили G. curtisii, G. lucidum, G. sessile и G. resilaceum sensu lato.Из этих таксонов G. curtisii и G. sessile произрастают в США, тогда как G. Resinaceum и G. lucidum произрастают в Европе. Кроме того, G. curtisii является таксоном-сестрой в Северной Америке широко культивируемого G. lingzhi (Zhou et al., 2015) и потенциально может обладать схожими экологическими, биологическими и химическими свойствами. Однако, за исключением G. lucidum sensu stricto, ни одно исследование не оценивало лечебные свойства этих видов Ganoderma и их связь с широко культивируемыми G.lingzhi в Азии.

    Наш микроскопический анализ показал, что, помимо видового разнообразия, компании производят продукты из рейши из различных типов тканей (например, базидиомы, мицелия, спор и т. Д.). Так же, как мало исследований по изучению биохимических различий между недавно выясненными таксонами Ganoderma , мало исследований изучали различия в производстве важных с медицинской точки зрения химических веществ, продуцируемых в разных типах тканей. Heleno et al.(2012) исследовали различия в антиоксидантном потенциале плодовых тел, мицелия и спор G. lucidum sensu stricto. Авторы показали, что фенольные соединения, продуцируемые G. lucidum , обладают более высоким антиоксидантным потенциалом, чем полисахариды (Heleno et al., 2012). Кроме того, экстракты плодовых тел имеют самый высокий уровень фенольных соединений по сравнению с другими типами тканей (Heleno et al., 2012). Наконец, они обнаружили, что мицелий имеет самый низкий уровень фенольных соединений, но самый высокий уровень полисахаридов (Heleno et al., 2012). Аналогичным образом Sudheer et al. (2018) оценили условия культивирования (например, концентрацию углекислого газа и свет), которые способствуют удлинению ножки («форма рога») по сравнению с образованием гвоздики («почковидная шляпка») (Рисунок 3), а также биохимические свойства, связанные с каждым из это уникальный изолят G. lucidum . «Роговая форма» показала значительно большее производство фенолов, флавоноидов, полисахаридов и ганодермина по сравнению с плодовыми телами, которые образовывали настоящий гной (почковидная форма шляпки) (Sudheer et al., 2018). Поскольку фармацевтические исследования продолжают выявлять конкретные лекарственно ценные соединения, продуцируемые видами Ganoderma , и характеризовать их биологическую активность, необходимы дополнительные исследования по изучению производства соответствующих соединений в каждом типе тканей для повышения эффективности и стабильности продукта и / или для создания основы для биопроизводства конкретных желаемых соединений.

    РИСУНОК 3. Плодовые тела G. lingzhi , полученные из наборов GYO, продаваемых как G.lucidum . (A) Базидиомы «почковидной формы шляпки», получаемые при хорошей вентиляции, (B) базидиомы «роговой формы», которые образуются при плохой вентиляции и высоком уровне CO. 2 и (C) базидиомы «передней формы», которые перешли в «почковидную форму шляпки» после воздействия на них лучшей вентиляции.

    Помимо медицинской значимости разнообразных видов Ganoderma , существует множество экологических последствий в отношении выращивания неместных таксонов Ganoderma за пределами их естественного ареала.Из 17 наборов GYO, приобретенных компаниями в Соединенных Штатах, 11 приобретенных наборов содержали таксона Ganoderma , которые не являются родными для Соединенных Штатов. Эти таксоны включали G. lingzhi (уроженец Азии), G. lucidum (уроженец Европы и Азии) и G. resinaceum sensu lato (уроженец Европы). Ранее было показано, что монокариотические изоляты аборигенов Северной Америки G. sessile (ранее считавшиеся в публикациях G. lucidum ) совместимы с монокариотическими европейскими изолятами G.смолаацеум, , вид, произрастающий в Европе (Adaskaveg, Gilbertson, 1986). Филогенетические исследования показали, что эти виды являются сестринскими таксонами в субкладе смоляных (Zhou et al., 2015). Следовательно, возможно, что обмен генами может происходить между родственными нативными и неместными таксонами Ganoderma . Когда виды выращиваются, вероятность побега увеличивается, потому что большое количество базидиом обычно производится на небольшой территории. Бегство в дикую природу миллиардов пропагул (т.е., базидиоспоры) одного генотипа могут создать генетическое узкое место в диких популяциях. В конечном итоге это приведет к сокращению генетического разнообразия диких популяций. Этот феномен ранее был продемонстрирован на шампиньоне Agaricus bisporus в Калифорнии, где культивируемые генотипы ускользнули от культивирования и вытеснили местные генотипы (Kerrigan and Ross, 1989; Kerrigan, 1995). Аналогичная угроза доминирования одного культивируемого генотипа постулируется для индустрии шиитаке в ее естественном ареале в Азии (Hibbett and Donoghue, 1996).Также возможно, что интродуцированные виды или гибриды между аборигенными и интродуцированными таксонами могут быть более агрессивными грибами гниения древесины, чем аборигенные виды, что может иметь непредвиденные последствия. Например, Coetzee et al. (2001) показали, что европейский генотип Armillaria mellea, , вызывающий корневую гниль дубов и других древесных кустарников, был завезен в Южную Африку более 300 лет назад, предположительно в питомниках. Совсем недавно европейский вид Ganoderma adspersum был завезен в долину Сан-Хоакин в Калифорнии на корневых подвоях миндаля и вызывает значительный распад нижней части ствола / корня, что приводит к гибели деревьев из-за ветровала (Johnson, 2017).Более того, в недавнем обзоре лаккатных видов Ganoderma в Соединенных Штатах, Loyd (2018) обнаружил две небольшие географически изолированные популяции европейского вида G. lucidum sensu stricto, которые предположительно были интродуцированы через питомник или питомник. торговля лекарственными грибами. Исследования по сохранению, направленные на изучение воздействия интродуцированных гниющих грибов, должны быть проведены, чтобы понять последствия выращивания неместных Ganoderma и других коммерчески производимых видов в Соединенных Штатах.

    В соответствии с Законом о здоровье и образовании пищевых добавок (DSHEA) 1994 г. FDA не несет ответственности за анализ содержания пищевых добавок (Dodge et al., 2011). Согласно DSHEA, производитель несет ответственность за безопасность и целостность продаваемого продукта (Dodge et al., 2011). Учитывая трудности в идентификации и точном названии образцов лакката Ganoderma , нельзя винить какое-либо одно учреждение, будь то правительство, академические круги, производителей, производителей или дистрибьюторов.Однако в свете результатов этого и других исследований (Newmaster et al., 2013; Dentinger, Suz, 2014; Raja et al., 2017) США. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов должно пересмотреть способ регулирования индустрии пищевых добавок, особенно лекарственных трав и грибов. Кроме того, существует мало или совсем нет правил выращивания неместных видов Ganoderma за пределами их естественного ареала. Пока не будут проведены дополнительные исследования экологических последствий выращивания таксонов Ganoderma за пределами их естественного ареала, культиваторам Ganoderma следует сосредоточиться на выращивании таксонов, специфичных для региона, чтобы избежать любых потенциальных побегов с чужеродными таксонами.

    Наше исследование показывает, что наборы GYO и промышленные продукты (например, диетические добавки), продаваемые как G. lucidum , содержат несколько видов Ganoderma . Тот факт, что эти продукты имеют неточную маркировку и / или содержат смесь видов, но, тем не менее, продаются для использования в медицинских целях, вызывает вопросы относительно подлинности грибковых продуктов, используемых в этой отрасли. Также возникают важные вопросы, такие как: Все ли виды Ganoderma производят одинаковое качество и количество медицинских веществ? Может ли филогенетическое размещение видов Ganoderma предсказать присутствие или эффективность важных с медицинской точки зрения соединений? Все препарата Ганодерма (т.е.g., ткани базидиом, культурный мицелий, споры) одинаково полезны в лечебных целях? Представляют ли растущие неместные виды Ganoderma риск того, что они могут вытеснить естественные гниющие грибы или вызвать корневую гниль или пагубную гниль на местных деревьях? Эти вопросы должны быть рассмотрены в последующих исследованиях, посвященных выращиванию и производству продуктов из рейши.

    Авторские взносы

    Концепция статьи была совместной идеей с AL, BR, MS и JS.Работа финансировалась грантом, полученным AL, JS и RB. Работа микроскопии и молекулярной лаборатории была проведена совместными усилиями AL, CT и MJ. Рукопись написана А.Л. Рукопись редактировалась и рецензировалась AL, BR, MJ, CT, MS, RB и JS.


    AL, RB и JS получили исследовательский грант от Международного общества лесоводства, Флоридское отделение, которое помогло оплатить некоторые из этих работ. Кроме того, компания F. A. Bartlett Tree Experts Company профинансировала некоторые из этих исследований за счет гранта фонда через Лабораторию патологии лесов Университета Флориды.MS, CT и MJ получили финансирование от Национального института продовольствия и сельского хозяйства Министерства сельского хозяйства США под номером FLA-PLP-005289 (для MS) и Института продовольственных и сельскохозяйственных наук Университета Флориды.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.


    Авторы благодарны Эрику Линдеру и Кэсси Ньюман за помощь в этом проекте.


    1. www.genewiz.com
    2. http://amptk.readthedocs.io

    Список литературы

    Адаскавег Дж. И Гилбертсон Р. (1989). Культурные исследования четырех североамериканских видов в комплексе Ganoderma lucidum в сравнении с G. lucidum и G. tsugae . Mycol. Res. 92, 182–191. DOI: 10.1016 / S0953-7562 (89) 80010-3

    CrossRef Полный текст | Google Scholar

    Адаскавег, Дж.Э. и Гилбертсон Р. Л. (1986). Культурные исследования и генетика сексуальности Ganoderma lucidum и G. tsugae применительно к таксономии комплекса G. lucidum . Mycologia 5, 694–705. DOI: 10.2307 / 3807513

    CrossRef Полный текст | Google Scholar

    Баснет Б. Б., Лю Л., Бао Л. и Лю Х. (2017). Текущая и будущая перспектива антимикробной и антипаразитарной активности Ganoderma sp .: обновленная информация. Микология 8, 111–124. DOI: 10.1080 / 21501203.2017.1324529

    CrossRef Полный текст | Google Scholar

    Биннс, К. В., Ли, М. К., и Ли, А. Х. (2017). Проблемы и перспективы: регулирование пищевых добавок в здравоохранении. Annu. Rev. Public Health 39, 403–420. DOI: 10.1146 / annurev-publhealth-040617-013638

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Бох Б., Берович М., Чжан Дж. И Чжи-Бин Л. (2007). Ganoderma lucidum и его фармацевтически активные соединения. Biotechnol. Анну. Ред. 13, 265–301. DOI: 10.1016 / S1387-2656 (07) 13010-6

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Цао Ю., Ву С.-Х. и Дай Ю.-С. (2012). Уточнение видов призового лекарственного Ganoderma гриб «Линчжи». Fungal Divers. 56, 49–62. DOI: 10.1007 / s13225-012-0178-5

    CrossRef Полный текст | Google Scholar

    Chen, S., Xu, J., Liu, C., Zhu, Y., Nelson, D.R., Zhou, S., et al.(2012). Последовательность генома модельного лекарственного гриба Ganoderma lucidum . Нат. Commun. 3: 913. DOI: 10.1038 / ncomms1923

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кутзи М., Вингфилд Б. Д., Харрингтон Т. К., Стеймель Дж., Коутиньо Т. А. и Вингфилд М. Дж. (2001). Грибок корневой гнили Armillaria mellea , завезенный в Южную Африку первыми голландскими поселенцами. Мол. Ecol. 10, 387–396. DOI: 10.1046 / j.1365-294x.2001.01187.x

    CrossRef Полный текст | Google Scholar

    Dai, Y.-C., Zhou, L.-W., Hattori, T., Cao, Y., Stalpers, J. A., Ryvarden, L., et al. (2017). Ganoderma lingzhi (Polyporales, Basidiomycota): научный бином широко культивируемого лекарственного гриба Lingzhi. Mycol. Прог. 16, 1051–1055. DOI: 10.1007 / s11557-017-1347-4

    CrossRef Полный текст | Google Scholar

    Додж Т., Литт Д. и Кауфман А. (2011). Влияние здоровья и образования пищевых добавок на представления потребителей о безопасности и эффективности пищевых добавок. J. Health Commun. 16, 230–244. DOI: 10.1080 / 10810730.2010.529493

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дреш П., Агуанно М. Н., Розам К., Гриенке У., Роллингер Дж. М. и Пайнтнер У. (2015). Штамм грибов имеет значение: рост колоний и биоактивность европейских лекарственных полипов Fomes fomentarius, Fomitopsis pinicola и Piptoporus betulinus . AMB Express 5: 4. DOI: 10.1186 / s13568-014-0093-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Эдгар Р.К., и Фливбьерг, Х. (2015). Фильтрация ошибок, сборка пар и исправление ошибок для чтения секвенирования следующего поколения. Биоинформатика 31, 3476–3482. DOI: 10.1093 / биоинформатика / btv401

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гардес, М., и Брунс, Т. Д. (1993). Праймеры ITS с повышенной специфичностью для базидиомицетов — применение для идентификации микоризы и ржавчины. Мол. Ecol. 2, 113–118. DOI: 10.1111 / j.1365-294X.1993.tb00005.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гилбертсон Р. и Риварден Л. (1986). Североамериканские полипоры. От Abortiporus до Lindteria. Осло: Fungiflora.

    Хелено, С. А., Баррос, Л., Мартинс, А., Кейруш, М. Дж. Р., Сантос-Буэлга, К., и Феррейра, И. К. (2012). Плодовые тела, споры и in vitro продуцировали мицелий Ganoderma lucidum из Северо-Восточной Португалии: сравнительное исследование антиоксидантного потенциала фенольных и полисахаридных экстрактов. Food Res. Int. 46, 135–140. DOI: 10.1016 / j.foodres.2011.12.009

    CrossRef Полный текст | Google Scholar

    Хеннике, Ф., Шейх-Али, З., Либиш, Т., Мачиа-Висенте, Дж. Г., Боде, Х. Б., и Пипенбринг, М. (2016). Отличие коммерчески выращиваемого Ganoderma lucidum от Ganoderma lingzhi из Европы и Восточной Азии на основе морфологии, молекулярной филогении и профилей тритерпеновой кислоты. Фитохимия 127, 29–37. DOI: 10.1016 / j.phytochem.2016.03.012

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хиббетт, Д. С., и Донохью, М. Дж. (1996). Значение филогенетических исследований для сохранения генетического разнообразия грибов шиитаке. Консерв. Биол. 10, 1321–1327. DOI: 10.1046 / j.1523-1739.1996.10051321.x

    CrossRef Полный текст | Google Scholar

    Хонг, С.Г., и Юнг, Х.С. (2004). Филогенетический анализ Ganoderma на основе почти полных последовательностей митохондриальной малой субъединицы рибосомной ДНК. Mycologia 96, 742–755. DOI: 10.1080 / 15572536.2005.11832922

    CrossRef Полный текст | Google Scholar

    Исака М., Чинтаном П., Саппан М., Данвисетканжана К., Бунпратуанг Т. и Чойклин Р. (2015). Противотуберкулезные тритерпены ланостана из культур базидиомицета Ganoderma sp. BCC 16642. J. Nat. Prod. 79, 161–169. DOI: 10.1021 / acs.jnatprod.5b00826

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Джин, X., Руис Бегери, Дж., Сзе, Д. М., и Чан, Г. К. (2012). Ganoderma lucidum (гриб Рейши) для лечения рака. Кокрановская база данных Syst. Ред. 6: CD007731. DOI: 10.1002 / 14651858.CD007731.pub2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Джонсон, Б. (2017). Гниение корней и ягодиц Ganoderma: новая угроза для калифорнийского миндаля , ред. Б. Джонсон и Д. М. Риццо (Дэвис, Калифорния: Калифорнийский университет).

    Джозеф, С., Сабулал, Б., Джордж, В., Смина, Т. П., и Джанардханан, К. К. (2009). Антиоксидантная и противовоспалительная активность хлороформного экстракта Ganoderma lucidum , обнаруженного в Южной Индии. Sci. Pharm. 77, 111–122. DOI: 10.3797 / scipharm.0808-17

    CrossRef Полный текст | Google Scholar

    Калогеропулос Н., Янни А. Э., Кутроциос Г. и Алоупи М. (2013). Биоактивные микрокомпоненты и антиоксидантные свойства диких съедобных грибов с острова Лесбос, Греция. Food Chem. Toxicol. 55, 378–385. DOI: 10.1016 / j.fct.2013.01.010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Като К., Мисава К., Кума К. и Мията Т. (2002). MAFFT: новый метод быстрого совмещения множественных последовательностей, основанный на быстром преобразовании Фурье. Nucleic Acids Res. 30, 3059–3066. DOI: 10.1093 / nar / gkf436

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кирс, М., Мойр, Р., Уилсон, А., Стоунз-Хавас, С., Cheung, M., Sturrock, S., et al. (2012). Geneious basic: интегрированная и расширяемая настольная программная платформа для организации и анализа данных последовательностей. Биоинформатика 28, 1647–1649. DOI: 10.1093 / биоинформатика / bts199

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Керриган, Р. У. (1995). Глобальные генетические ресурсы для селекции и выращивания Agaricus . банка. J. Bot. 73, 973–979. DOI: 10.1139 / b95-347

    CrossRef Полный текст | Google Scholar

    Керриган, Р.У. и Росс И. К. (1989). Аллозимы дикой популяции Agaricus bisporus : новые аллели, новые генотипы. Mycologia 81, 433–443. DOI: 10.2307 / 3760080

    CrossRef Полный текст | Google Scholar

    Кылъялг, У., Нильссон, Р. Х., Абаренков, К., Тедерсоо, Л., Тейлор, А. Ф., Бахрам, М., и др. (2013). К единой парадигме для идентификации грибов на основе последовательностей. Мол. Ecol. 22, 5271–5277. DOI: 10.1111 / mec.12481

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лай, Т., Гао, Ю., и Чжоу, С. (2004). Глобальный маркетинг лекарственного гриба Линчжи Ganoderma lucidum (W. Curt .: Fr.) Продукция Lloyd (Aphyllophoromycetideae) и проблемы безопасности. Внутр. J. Med. Грибы 6, 189–194. DOI: 10.1615 / IntJMedMushr.v6.i2.100

    CrossRef Полный текст | Google Scholar

    Лойд, А. Л. (2018). Таксономия, биология, потенциал распада и патогенность видов лаккатной (лакированной) ганодермы, присутствующих в США. Гейнсвилл, Флорида: Университет Флориды.

    Лойд, А. Л., Хелд, Б. У., Линдер, Э. Р., Смит, Дж. А., и Бланшетт, Р. А. (2018a). Выявление разложения древесины четырьмя видами Ganoderma из США. Fungal Biol. 122, 254–263. DOI: 10.1016 / j.funbio.2018.01.006

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лойд, А. Л., Линдер, Э. Р., Энгер, Н. А., Рихтер, Б. С., Бланшетт, Р. А., и Смит, Дж. А. (2018b). Патогенность видов Ganoderma на ландшафтных деревьях юго-востока США. Завод Dis. DOI: 10.1094 / PDIS-02-18-0338-RE

    CrossRef Полный текст | Google Scholar

    Маркс, Д. Х., и Даниэль, В. Дж. (1976). Поддержание культур эктомикоризных и патогенных грибов растений в стерильных водных холодильных хранилищах. банка. J. Microbiol. 22, 338–341. DOI: 10.1139 / m76-051

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Moncalvo, J.-M., Wang, H.-F., and Hseu, R.-S. (1995a). Филогения генов комплекса Ganoderma lucidum на основе последовательностей рибосомной ДНК.Сравнение с традиционными таксономическими признаками. Mycol. Res. 99, 1489–1499.

    Google Scholar

    Moncalvo, J.-M., Wang, H.-H., and Hseu, R.-S. (1995b). Филогенетические отношения в Ganoderma выведены из внутренних транскрибированных спейсеров и 25S рибосомных последовательностей ДНК. Mycologia 87, 223–238. DOI: 10.2307 / 3760908

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Мотана, Р., Али, Н.А., Янсен, Р., Вегнер, У., Ментель, Р., Линдеквист, У. (2003). Противовирусные ланостаноидные тритерпены из гриба Ganoderma pfeifferi . Фитотерапия 74, 177–180. DOI: 10.1016 / S0367-326X (02) 00305-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ньюмастер, С. Г., Гргурик, М., Шанмуганандхан, Д., Рамалингам, С., и Рагупати, С. (2013). Штрих-кодирование ДНК обнаруживает загрязнение и замену в североамериканских растительных продуктах. BMC Med. 11: 222.DOI: 10.1186 / 1741-7015-11-222

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дворяне, М. К. (1965). Идентификация культур лесных гименомицетов. банка. J. Bot. 43, 1097–1139. DOI: 10.1139 / b65-126

    CrossRef Полный текст | Google Scholar

    Палмер, Дж. М., Джусино, М. А., Баник, М. Т., и Линднер, Д. Л. (2018). Небиологические синтетические вспомогательные средства контроля и программный конвейер AMPtk улучшают данные о микобиоме. PeerJ 6: e4925.DOI: 10.7717 / peerj.4925

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Пироне, П. П. (1957). Ganoderma lucidum , паразит теневых деревьев. Бык. Торри Бот. Club 84, 424–428. DOI: 10.2307 / 2482973

    CrossRef Полный текст | Google Scholar

    Пауэлл, М. (2006). Использование Ganoderma lucidum (Reishi) для лечения аллергических реакций, опосредованных гистамином. Townsend Lett. 274, 78–82.

    Google Scholar

    Раджа, Х.А., Бейкер Т. Р., Литтл Дж. Г. и Оберлис Н. Х. (2017). Штрих-кодирование ДНК для идентификации грибов, имеющих отношение к потребителю: частичное решение для сертификации продукции? Food Chem. 214, 383–392. DOI: 10.1016 / j.foodchem.2016.07.052

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ронквист, Ф., Тесленко, М., Ван Дер Марк, П., Эйрес, Д. Л., Дарлинг, А., Хона, С. и др. (2012). MrBayes 3.2: эффективный байесовский филогенетический вывод и выбор модели в большом модельном пространстве. Syst. Биол. 61, 539–542. DOI: 10.1093 / sysbio / sys029

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Санодия, Б. С., Такур, Г. С., Багел, Р. К., Прасад, Г., и Бисен, П. (2009). Ganoderma lucidum : мощный фармакологический макрогриб. Curr. Pharm. Biotechnol. 10, 717–742. DOI: 10.2174 / 13897897

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Шох, К. Л., Зайферт, К. А., Хундорф, С., Роберт В., Спуг Дж. Л., Левеск К. А. и др. (2012). Ядерная рибосомная внутренняя транскрибируемая спейсерная область (ITS) как универсальный маркер штрих-кода ДНК для грибов. Proc. Natl. Акад. Sci. США 109, 6241–6246. DOI: 10.1073 / pnas.1117018109

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Синклер, У. А., и Лион, Х. Х. (2005). Болезни деревьев и кустарников. Нью-Йорк, Нью-Йорк: Comstock Publishing Associates.

    Google Scholar

    Стамец, П.(2000). Выращивание изысканных и лечебных грибов. Беркли, Калифорния: Ten Speed ​​Press.

    Google Scholar

    Судхир С., Таха З., Маникам С., Али А. и Ченг П. Г. (2018). Развитие плодовых тел пантового типа Ganoderma lucidum и определение его биохимических свойств. Fungal Biol. 122, 293–301. DOI: 10.1016 / j.funbio.2018.01.007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Аптон, Р., и Петроне, К. (2000). Американская травяная фармакопея — гриб рейши — Ganoderma Lucidum. Нью-Йорк, Нью-Йорк: Американская травяная фармакопея.

    Google Scholar

    Wang, D.-M., Wu, S.-H., Su, C.-H., Peng, J.-T., Shih, Y.-H., and Chen, L.-C. (2009). Ganoderma multipileum , правильное название для « G. lucidum » в тропической Азии. Бот. Stud. 50, 451–458.

    Google Scholar

    Ван Х. и Нг Т. (2006). Ганодермин, противогрибковый белок из плодовых тел лекарственного гриба Ganoderma lucidum . Пептиды 27, 27–30. DOI: 10.1016 / j.peptides.2005.06.009

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ван, X. С., Си, Р. Дж., Ли, Ю., Ван, Д. М., и Яо, Ю. Дж. (2012). Видовая принадлежность широко культивируемых в Китае Ganoderma , « G. lucidum » (Ling-zhi). PLoS One 7: e40857. DOI: 10.1371 / journal.pone.0040857

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Велти, С., и Courtecuisse, R. (2010). Ganodermataceae во Французской Вест-Индии (Гваделупа и Мартиника). Fungal Divers. 43, 103–126. DOI: 10.1007 / s13225-010-0036-2

    CrossRef Полный текст | Google Scholar

    Уайт, Т. Дж., Брунс, Т., Ли, С., и Тейлор, Дж. (1990). «Амплификация и прямое секвенирование генов рибосомной РНК грибов для филогенетики», в PCR Protocols: A Guide to Methods and Applications , eds M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T.Дж. Уайт (Сан-Диего, Калифорния: Academic Press), 315–322.

    PubMed Аннотация | Google Scholar

    Wu, D.-T., Deng, Y., Chen, L.-X., Zhao, J., Bzhelyansky, A., and Li, S.-P. (2017). Оценка согласованности качества диетических добавок Ganoderma lucidum , собранных в США. Sci. Реп. 7: 7792. DOI: 10.1038 / s41598-017-06336-3

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжао, С., Го, Ю., Лю, К., Ван, Х., и Нг, Т. (2009). Лектины, но не противогрибковые белки, проявляют активность против нематод. Environ. Toxicol. Pharmacol. 28, 265–268. DOI: 10.1016 / j.etap.2009.05.003

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжун, Ж.-Дж., и Сяо, Ж.-Х. (2009). Вторичные метаболиты высших грибов: открытие, биоактивность и биопродукция. Биотехнология в Китае I. Берлин: Springer, 79–150. DOI: 10.1007 / 10_2008_26

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжоу, Л.-W., Cao, Y., Wu, S.-H., Vlasák, J., Li, D.-W., Li, M.-J., et al. (2015). Глобальное разнообразие комплекса Ganoderma lucidum (Ganodermataceae, Polyporales), определенное на основании морфологии и многолучевой филогении. Фитохимия 114, 7–15. DOI: 10.1016 / j.phytochem.2014.09.023

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Видовое уточнение призового лекарственного гриба Ganoderma «Линчжи»

  • Али А.Х., Деббаб А., Прокш П. (2011) Пятьдесят лет открытия лекарств из грибов.Fungal Divers 50: 3–19

    Статья Google Scholar

  • Аноним (1969) Флора британских грибов. Таблица идентификации цвета. Канцелярия Ее Величества, Лондон

    Google Scholar

  • Bao XF, Wang XS, Dong Q, Fang JN, Li XY (2002) Структурные особенности иммунологически активных полисахаридов из Ganoderma lucidum . Фитохимия 59: 175–181

    PubMed Статья CAS Google Scholar

  • Bazzalo ME, Wright JE (1982) Обзор аргентинских видов комплекса Ganoderma lucidum .Микотаксон 16: 295–325

    Google Scholar

  • Binder M, Larsson KH, Matheny PB, Hibbett DS (2010) Amylocorticiales ord. ноя и Jaapiales ord. nov .: В ранних расходящихся кладах Agaricomycetidae преобладали кортициоидные формы. Mycologia 102: 865–880

    PubMed Статья CAS Google Scholar

  • Cao Y, Yuan HS (2012) Ganoderma mutabile sp.ноя из юго-западного Китая по морфологическим и молекулярным данным. Mycol Progr. DOI: 10.1007 / s11557-012-0819-9

  • Dai YC (2010) Hymenochaetaceae (Basidiomycota) в Китае. Fungal Divers 45: 131–343

    Статья Google Scholar

  • Dai YC (2012) Разнообразие полипор в Китае с аннотированным контрольным списком китайских полипор. Mycoscience 53: 49–80

    Статья Google Scholar

  • Dai YC, Vainio EJ, Hantula J, Niemelä T, Korhonen K (2003) Исследование Heterobasidion annosum s.лат. в Центральной и Восточной Азии с помощью тестов спаривания и снятия отпечатков ДНК. Для пути 33: 269–286

    Артикул Google Scholar

  • Dai YC, Yang ZL, Cui BK, Yu CJ, Zhou LW (2009) Видовое разнообразие и использование лекарственных грибов и грибов в Китае (Обзор). Int J Med Mushrooms 11: 287–302

    Статья Google Scholar

  • De Silva DD, Rapior S, Fons F, Bahkali AH, Hyde KD (2012) Лекарственные грибы в поддерживающей терапии рака: подход к противораковым эффектам и предполагаемым механизмам действия.Fungal Divers 55: 1–35

    Статья Google Scholar

  • Felsenstein J (1985) Доверительные интервалы по филогенетике: подход, использующий бутстрап. Evolution 39: 783–791

    Статья Google Scholar

  • Gao YH, Zhou SF (2003) Профилактика и лечение рака с помощью Ganoderma , гриба с лечебными свойствами. Food Rev Int 19: 275–325

    Статья Google Scholar

  • Gardes M, Bruns TD (1993) Праймеры ITS с повышенной специфичностью для базидиомицетов — применение для идентификации микоризы и ржавчины.Мол Экол 2: 113–118

    PubMed Статья CAS Google Scholar

  • Ge ZW, Yang ZL, Vellinga EC (2010) Род Macrolepiota (Agaricaceae, Basidiomycota) в Китае. Fungal Divers 45: 81–98

    Статья Google Scholar

  • Гилбертсон Р.Л., Риварден Л. (1986) Североамериканские полипоры 1. Fungiflora, Осло, стр. 1–433

    Google Scholar

  • Gottlieb AM, Wright JE (1999) Таксономия Ganoderma из южной части Южной Америки: подрод Ganoderma .Mycol Res 103: 661–673

    Статья Google Scholar

  • Guindon S, Gascuel O (2003) Простой, быстрый и точный метод оценки крупных филогений с помощью максимального правдоподобия. Syst Biol 52: 696–704

    PubMed Статья Google Scholar

  • Hall TA (1999) Bioedit: удобная для пользователя программа анализа выравнивания биологических последовательностей для окон 95/98 / NT.Symp Ser 41 Nucl Acids: 95–98

    CAS Google Scholar

  • Hall BG (2004) Филогенетические деревья стали проще: практическое руководство, 2-е изд. Sinauer Associates, Сандерленд, стр. 1-221

    Google Scholar

  • Хаттори Т., Риварден Л. (1994) Типовые исследования Polyporaceae 25. Виды, описанные из Японии Р. Имазеки и А. Ясуда. Микотаксон 50: 27–46

    Google Scholar

  • He SH, Dai YC (2012) Таксономия и филогения Hymenochaete и родственных родов Hymenochaetaceae (Basidiomycota) в Китае.Грибные ныряльщики. DOI: 10.1007 / s13225-012-0174-9

  • Hong SG, Jung HS (2004) Филогенетический анализ Ganoderma на основе почти полных митохондриальных последовательностей малой субъединицы рибосомной ДНК. Mycologia 96: 742–755

    PubMed Статья Google Scholar

  • Хонго Т., Идзава М. (1994) Полевые книги Яма-Кей № 10. Yama-Kei Publishers Co., Ltd, Токио, стр. 1–384, в Japanense

    Google Scholar

  • Hseu RS, Wang HH, Wang HF, Moncalvo JM (1996) Дифференциация и группировка изолятов комплекса Ganoderma lucidum методом случайной амплификации полиморфной ДНК-ПЦР по сравнению с группированием на основе внутренних транскрибированных спейсерных последовательностей.Appl Environ Microbiol 62: 1354–1363

    PubMed CAS Google Scholar

  • Hu H, Ahn NS, Yang XL, Lee YS, Kang KS (2002) Экстракт Ganoderma lucidum индуцирует остановку клеточного цикла и апоптоз в клетках рака молочной железы человека MCF-7. Int J Cancer 102: 250–253

    PubMed Статья CAS Google Scholar

  • Hyde KD, Bahkali AH, Moslem MA (2010) Грибы — необычный источник косметики.Fungal Divers 43: 1–9

    Статья Google Scholar

  • Jong SC, Birmingham JM (1992) Лечебные преимущества гриба Ganoderma . Adv Appl Microbiol 37: 101–134

    PubMed Статья CAS Google Scholar

  • Kim HK, Seo GS, Kim HG (2001) Сравнение характеристик Ganoderma lucidum в соответствии с географическим происхождением (II): рассмотрение морфологических характеристик.Микобиология 29: 80–84

    Google Scholar

  • Kino K, Yamashita A, Yamaoka K, Watanabe J, Tanaka S, Ko K, Shimizu K, Tsunoo H (1989) Выделение и характеристика нового иммуномодулирующего белка, ling zhi-8 (LZ-8), из Ganoderma lucidium . J Biol Chem 264: 472–478

    PubMed CAS Google Scholar

  • Lai T, Gao Y, Zhou SF (2004) Глобальный маркетинг лекарственного гриба Лин Чжи Ganoderma lucidum (W.Курт .: Фр.) Lloyd (Aphyllophoromycetideae) и проблемы безопасности. Int J Med Mushr 6: 189–194

    Статья Google Scholar

  • Ларже Б., Саймон Д.Л. (1999) Алгоритмы Монте-Карло цепи Маркова для байесовского анализа филогенетических деревьев. Mol Biol Evol 16: 750–759

    Артикул CAS Google Scholar

  • Ларкин М.А., Блэкшилдс Дж., Браун Н.П., Ченна Р., МакГеттиган П.А., МакВильям Х., Валентин Ф., Уоллес И.М., Уилм А., Лопес Р., Томпсон Дж. Д., Гибсон Т. Дж., Хиггинс Д. Г. (2007) Кластал В. и Кластал Х версия 2.0. Биоинформатика 23: 2947–2948

    PubMed Статья CAS Google Scholar

  • Li YC, Yang ZL, Tolgor B (2009) Филогенетические и биогеографические взаимоотношения видов Chroogomphus на основе молекулярных и морфологических данных. Fungal Divers 38: 85–104

    Google Scholar

  • Лин З.Б. (2007) Современные исследования Ganoderma lucidum .Медицинское издательство Пекинского университета, Пекин, стр. 1–359, на китайском языке

    Google Scholar

  • Линь З.Б. (2009) Линчжи: от тайны к науке. Медицинское издательство Пекинского университета, Пекин, стр. 1–162

    Google Scholar

  • Лю Б. (1974) Китайские лечебные грибы. Shanxi People’s Press, Тайюань, стр. 1–196, на китайском языке

    Google Scholar

  • Лю Ю.Л., Велен С., Холл Б.Д. (1999) Филогенетические отношения среди аскомицетов: данные субъединицы РНК-полимеразы II.Mol Biol Evol 16: 1799–1808

    PubMed Статья CAS Google Scholar

  • Mao XL (1998) Экономические грибы Китая. Science Press, Пекин, стр. 1–762, на китайском языке

    Google Scholar

  • Matheny PB, Liu YJ, Ammirati JF, Hall BD (2002) Использование последовательностей RPB1 для улучшения филогенетических выводов среди грибов ( Inocybe , Agaricales). Am J Bot 89: 688–698

    PubMed Статья CAS Google Scholar

  • Matheny PB, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH, Hughes KW, Petersen RH, Hofstetter V, Ammirati JF, Schoch C, Langer GE, McLaughlin DJ, Wilson AW, Crane PE, Frøslev T, Ge ZW, Kerrigan RW, Slot JC, Vellinga EC, Liang ZL, Aime MC, Baroni TJ, Fischer M, Hosaka K, Matsuura K, Seidl MT, Vaura J, Hibbett DS (2007) Вклад rpb2 и tef1 в филогения грибов и их союзников (Basidiomycota, Fungi).Mol Phylogenet Evol 43: 430–451

    PubMed Статья CAS Google Scholar

  • Min BS, Gao JJ, Nakamura N, Hattori M (2000) Тритерпены из спор Ganoderma lucidum и их цитотоксичность в отношении опухолевых клеток meth-A и LLC. Chem Pharm Bull 48: 1026–1033

    PubMed Статья CAS Google Scholar

  • Moncalvo JM, Ryvarden L (1997) Номенклатурное исследование Ganodermataceae Donk.Син Фунг 11: 1–114

    Google Scholar

  • Moncalvo JM, Wang HF, Wang HH, Hseu RS (1994) Использование данных последовательности рибосомальной ДНК для идентификации видов и филогении у Ganodermataceae. В: Buchanan PK, Hseu RS, Moncalvo JM (eds) Ganoderma : систематика, фитопатология и фармакология. Материалы симпозиума 59A, B, 5-го Международного микологического конгресса, Ванкувер, 14–21 августа 1994 г. Национальный университет Тайваня, Тайбэй, стр. 31–44

  • Moncalvo JM, Wang HF, Hseu RS (1995) Филогения генов комплекс Ganoderma lucidum на основе последовательностей рибосомной ДНК.Сравнение с традиционными таксономическими признаками. Mycol Res 99: 1489–1499

    Статья Google Scholar

  • Niemelä T, Miettinen O (2008) Идентификационные данные Ganoderma applanatum (Basidiomycota). Таксон 57: 963–966

    Google Scholar

  • Núñez M, Ryvarden L (2000) Восточноазиатские полипоры 1. Ganodermataceae и Hymenochaetaceae. Синоп Фанг 13: 1–168

    Google Scholar

  • Nylander JAA (2004) MrModeltest v2.Программа распространяется автором. Центр эволюционной биологии, Уппсальский университет

  • Patouillard N (1907) Champignons du Kouy-tcheou. Monde d be Pl. Сери. 2, 9: 31

  • Pegler DN, Yao YJ (1996) Восточные виды Ganoderma section Ganoderma . В Вассере СП (ред.). Ботаника и микология следующего тысячелетия: сборник научных статей, посвященных 70-летию академика Сытника К.М. Киев: Институт ботаники им. Н.Г. Холодного НАН Украины.pp 336–347

  • Petersen JH (1996) Farvekort. Цветовая карта Датского микологического общества. Foreningen til Svampekundskabens Fremme, Greve

  • Posada D (2008) jModelTest: усреднение филогенетической модели. Mol Biol Evol 25: 1253–1256

    PubMed Статья CAS Google Scholar

  • Quanten E (1997) Полипоры (Polyporaceae s.l.) Папуа-Новой Гвинеи. Opera Bot Belgica 11: 1–352

    Google Scholar

  • Ренер С.А., Бакли Э. (2005) Филогения Боверии, выведенная из ядерных последовательностей ITS и EF1-a: свидетельство загадочной диверсификации и связи с телеоморфами кордицепса.Mycologia 97: 84–98

    PubMed Статья CAS Google Scholar

  • Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: байесовский филогенетический вывод при смешанных моделях. Биоинформатика 19: 1572–1574

    PubMed Статья CAS Google Scholar

  • Ryvarden L (1981) Типовые исследования Polyporaceae. 12. Виды, описанные F.W. Junghuhn. Персония 11: 369–372

    Google Scholar

  • Ryvarden L (1983) Типовые исследования Polyporaceae.14. Виды, описанные Н. Патуйяром самостоятельно или совместно с другими микологами. Occas pap Farlow Herb 18: 1–39

    Google Scholar

  • Ryvarden L (1985) Типовые исследования Polyporaceae. 17. Виды, описанные У. А. Мурриллом. Микотаксон 23: 169–198

    Google Scholar

  • Ryvarden L (1994) Можно ли доверять морфологии Ganoderma ? В: Buchanan PK, Hseu RS, Moncalvo JM (eds) Ganoderma : систематика, фитопатология и фармакология.Материалы симпозиума 59A, B, 5-го Международного микологического конгресса, Ванкувер, 14–21 августа 1994 г. Национальный университет Тайваня, Тайбэй, стр. 19–24

  • Ryvarden L (2004) Неотропические полипы Часть 1. Syn Fung 19: 1–229

    Google Scholar

  • Ryvarden L, Gilbertson RL (1993) Европейские полипоры 1. Syn Fung 6: 1–387

    Google Scholar

  • Ryvarden L, Johansen I (1980) Предварительная флора полипов Восточной Африки.Fungiflora, Осло, стр. 1–636

    Google Scholar

  • Sliva D, Labarrere C, Slivova V, Sedlak M, Lloyd FP Jr, Ho NWY (2002) Ganoderma lucidum подавляет подвижность высокоинвазивных клеток рака груди и простаты. Biochem Biophys Res Commun 298: 603–612

    PubMed Статья CAS Google Scholar

  • Smith BJ, Sivasithamparam K (2000) Внутренняя транскрибированная последовательность рибосомной спейсерной ДНК пяти видов Ganoderma из Австралии.Mycol Res 104: 943–951

    Статья CAS Google Scholar

  • Smith BJ, Sivasithamparam K (2003) Морфологические исследования Ganoderma (Ganodermataceae) из Австралазийского и Тихоокеанского регионов. Aust Syst Bot 16: 487–503

    Статья Google Scholar

  • Steyaert RL (1972) Виды Ganoderma и родственных родов, в основном из Богорских и Лейденских гербариев.Персония 7: 55–118

    Google Scholar

  • Steyaert RL (1980) Изучение видов Ganoderma . Bull Jard Bot Nat Belg 50: 135–186

    Статья Google Scholar

  • Swofford DL (2002) PAUP *. Филогенетический анализ с использованием экономичности (* и других методов) Версия 4.0b10. Sinauer Associates, Сандерленд

    Google Scholar

  • Szedlay G (2002) Широко используемый лекарственный гриб Ganoderma lucidum (фр.) карст. sensu stricto? Acta Microbiol Immunol Hung 49: 235–243

    PubMed Статья Google Scholar

  • Tai FL (1979) Sylloge фунгорум sinicorum. Science Press, Пекин, стр. 1–1527, на китайском языке

    Google Scholar

  • Teng SC (1934) Заметки о Polyporaceae из Китая. Sinensia 5: 198–200

    Google Scholar

  • Wachtel-Galor WS, Tomlinson B, Benzie IFF (2004) Ganoderma lucidum («Линчжи»), китайский лекарственный гриб: ответы биомаркеров в контролируемом исследовании добавок на людях.Brit J Nutr 91: 263–269

    PubMed Статья CAS Google Scholar

  • Wang DM, Wu SH (2008) Таксономическая ревизия Ganodermataceae, представленная на Тайване. Микотаксон 104: 297–308

    Google Scholar

  • Wang XC, Yao YJ (2009) Таксономические исследования « Ganoderma lucidum » в Китае. Тезисы 5 -й Международной конференции по лекарственным грибам , Наньтун, 5–8 сентября 2009 г.pp 104–106

  • Wang DM, Wu SH, Li TH (2009a) Две записи Ganoderma , новые для материкового Китая. Микотаксон 108: 35–40

    Артикул Google Scholar

  • Wang DM, Wu SH, Su CH, Peng JT, Shih YH, Chen LC (2009b) Ganoderma multipileum , правильное название для « G. lucidum » в тропической Азии. Bot Stud 50: 451–458

    Google Scholar

  • Wasser SP (2005) Рейши или Лин Чжи ( Ganoderma lucidum ).В: Coates PM, Blackman MR, Cragg GM, Levine M, Moss J, White JD (eds) Энциклопедия пищевых добавок. Марсель Деккер, Нью-Йорк, стр. 603–622

    Google Scholar

  • Wasser SP (2011) Текущие результаты, будущие тенденции и нерешенные проблемы в исследованиях лекарственных грибов. Appl Microbiol Biotechnol 89: 1323–1332

    PubMed Статья CAS Google Scholar

  • Вассер С.П., Змитрович И.В., Дидух М.Ю., Спирин В.А., Малышева В.Ф. (2006) Морфологические признаки комплекса Ganoderma lucidum с выделением G . цугае вар. jannieae : текущее обобщение. Gantner, Ruggell, pp 1–187

    Google Scholar

  • Welti S, Courtecuisse R (2010) The Ganodermataceae во Французской Вест-Индии (Гваделупа и Мартиника). Fungal Divers 43: 103–126

    Статья Google Scholar

  • White TJ, Bruns TD, Lee S, Taylor J (1990) Амплификация и прямое секвенирование генов грибковой рибосомной РНК для филогенетики.In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) Протоколы ПЦР, руководство по методам и применению. Academic, San Diego, pp 315–322

    Google Scholar

  • Wu XL, Dai YC (2005) Цветные иллюстрации Ganodermataceae из Китая. Science Press, Пекин, стр. 1–229, на китайском языке

    Google Scholar

  • Ян З.Л. (2011) Молекулярные методы революционизируют знания об эволюции базидиомицетов.Fungal Divers 50: 47–58

    Статья Google Scholar

  • Ying JZ, Mao ZL, Ma QM, Zong LC, Wen HA (1987) Иконки лекарственных грибов из Китая. Science Press, Пекин, стр. 1–579, на китайском языке

    Google Scholar

  • Yu YN, Shen MZ (2003) История выращивания линчжи ( Ganoderma spp.). Mycosystema 22: 3–9, на китайском языке

    Google Scholar

  • Zhang JS, Tang QJ, Zimmerman-Kordmann M, Reutter W, Fan H (2002) Активация B-лимфоцитов с помощью GLIS, биоактивного протеогликана из Ganoderma lucidum .Life Sci 71: 623–638

    PubMed Статья CAS Google Scholar

  • Чжао Д.Д., Чжан XQ (2000) Flora Fungorum Sinicorum 18, Ganodermataceae. Science Press, Пекин, стр. 1–204, на китайском языке

    Google Scholar

  • Zhao RI, Desjardin DE, Soytong K, Perry BA, Hyde KD (2010) Монография Micropsalliota в Северном Таиланде, основанная на морфологических и молекулярных данных.Fungal Divers 45: 33–79

    Статья Google Scholar

  • Zhao CL, Cui BK, Dai YC (2012) Новые виды и филогения Perenniporia на основе морфологических и молекулярных признаков. Грибные ныряльщики. DOI: 10.1007 / s13225-012-0177-6

  • Преимущества грибов рейши: 10 подтвержденных наукой людей, которые нужно знать

    Когда суперпродукт называют «королем грибов», вы понимаете, что в нем происходит что-то особенное.И хотя грибы рейши не превратят вас в новую Меган Маркл, они — это , известные своим регенерирующим клетки и иммуностимулирующим потенциалом, что может иметь большое значение для улучшения качества вашей жизни.

    Веерообразные, от оранжевого до красновато-коричневого цвета грибы рейши ( Ganoderma lucidum для нас, гиков-ученых) — редкая находка в природе, и, как правило, использовались королевской семьей, когда впервые были использованы в азиатских культурах тысячи лет назад. (Подскажите прозвище.) Сегодня они коммерчески выращиваются и продаются в различных форматах, включая чай, настойки, капсулы и даже горячее какао, косметические продукты и энергетические батончики.И нет, вы не найдете их торчащими в продуктовом ряду Whole Foods — хотя грибы рейши можно есть свежими, их древесная текстура и горький вкус не очень приятны на вкус.

    Так почему они вдруг везде ? «Грибы рейши отлично подходят для стимуляции иммунной системы и функции печени, оказывают противовоспалительное действие в организме и даже снижают рост опухолей», — говорит Рэйчел Гарджуло, сертифицированный консультант по питанию в оздоровительном центре Nourishing Journey. органическое кафе в Колумбии, штат Мэриленд.

    Действительно, грибы рейши обладают полным набором качеств, которые делают лекарственные грибы такими модными — они адаптогенные успокаивающие от стресса и богаты антиоксидантами, поэтому они долгое время были одним из основных продуктов восточной медицины. Неудивительно, что сейчас все в мире велнеса приветствуют этого короля.

    Истории по теме

    Продолжайте читать, чтобы узнать, что наука говорит о пользе грибов рейши для здоровья.

    Фото: Getty Images / Ryan McVay

    Польза для здоровья грибов рейши

    Хотя грибы рейши, как правило, безопасны для экспериментов с большинством людей, они могут вызывать некоторые побочные эффекты — пищеварительные и другие — поэтому вам следует проконсультироваться с врачом перед их приемом.(Это вдвойне, если вы беременны, кормите грудью, собираетесь перенести операцию, страдаете каким-либо заболеванием крови или высоким / низким артериальным давлением.) способов, которыми грибы рейши могут потенциально улучшить ваше здоровье. Ниже приведены 10 преимуществ, которые были обнаружены учеными — хотя важно отметить, что многие из этих исследований не проводились на людях (а если и проводились, размер выборки был очень мал), и прежде чем эти теории появятся, необходимо провести дополнительные исследования. окончательно доказаны.

    1. Они могут укрепить иммунную систему

    Исторически грибы рейши использовались в качестве усилителя иммунной системы — они даже используются в азиатских культурах в качестве иммуностимулятора для пациентов с ВИЧ и раком. Считается, что бета-глюканы (сложные сахара) в грибах стимулируют иммунную систему для предотвращения инфекции.

    2. Грибы рейши снимают усталость

    Грибы рейши являются адаптогенами, растениями, которые помогают организму бороться со стрессом. В одном исследовании 132 пациентов, страдающих неврастенией (состоянием, характеризующимся физическим и умственным истощением), было показано, что потребление соединения, содержащегося в грибах рейши, уменьшает боли и чувство раздражительности.

    3. Они могут быть союзником в борьбе с раком

    Было проведено множество исследований воздействия грибов рейши на раковые клетки. Результаты были интригующими — одно небольшое исследование, опубликованное в журнале Journal of Oncology , показало, что опухоли уменьшились у трех онкологических больных, принимавших грибы рейши. Исследователи считают, что содержащиеся в грибах бета-глюканы могут предотвратить рост новых кровеносных сосудов, что является ключевым моментом, поскольку для роста раковых клеток требуется постоянное кровоснабжение. Тритерпены (эфирные масла AKA) в грибах также могут подавлять развитие и метастазирование опухолей.Дополнительные исследования показывают, что грибы могут облегчить тошноту, вызванную химиотерапией, и повысить эффективность лучевой терапии.

    Тем не менее, если вы в настоящее время проходите курс лечения рака, обязательно посоветуйтесь с врачом, прежде чем добавлять грибы рейши в свой распорядок дня, поскольку они могут взаимодействовать с вашим протоколом.

    4. Грибы рейши могут снизить кровяное давление

    Согласно исследованию, проведенному на крысах в 2014 году, соединения, содержащиеся в грибах рейши, могут помочь сдерживать высокое кровяное давление.Но опять же, если вы в настоящее время принимаете лекарства от кровяного давления, проконсультируйтесь с врачом, прежде чем принимать грибы рейши — это сочетание может снизить ваше АД до опасного уровня.

    5. Они могут быть полезны для мозга

    Исследования, проведенные на животных, показывают, что грибы рейши могут быть терапевтическими при нейродегенеративных расстройствах, таких как болезнь Альцгеймера, а также могут защищать мозг от судорог. Однако для подтверждения этого еще предстоит провести дальнейшие исследования.

    6. Они обладают потенциалом борьбы с аллергией

    Некоторые исследования показали, что грибы рейши могут оказывать антигистаминное действие и улучшать снабжение организма кислородом, что является ключевым фактором для людей, страдающих хронической и аллергической астмой.

    7. Грибы рейши содержат соединения, снижающие уровень холестерина.

    И тритерпены, и бета-глюканы могут снижать общий холестерин и ЛПНП, обычно называемые «плохим холестерином».

    8. Они могут быть полезны для диабетиков

    Грибы рейши снижают уровень сахара в крови в одном небольшом двойном слепом плацебо-контролируемом исследовании — возможно, за счет ингибирования фермента, вырабатывающего глюкозу.Кроме того, увидев заметное снижение нагрузки на почки и снижение уровня сахара в крови у испытуемых, другая группа исследователей пришла к выводу, что грибы рейши могут предотвратить или остановить почечные осложнения у пациентов с диабетом.

    9. Они могут улучшить функцию печени

    Было обнаружено, что споры грибов рейши способствуют регенерации клеток печени у мышей, улучшая способность органа выводить токсины из организма. Здоровая печень также может иметь решающее значение для поддержания других преимуществ для здоровья, упомянутых выше, включая контроль уровня сахара в крови и аллергии.

    10. Они богаты антиоксидантами

    Несмотря на то, что их другое прозвище — «гриб бессмертия», грибы рейши на самом деле не заставят вас жить вечно. Но они обладают антиоксидантными свойствами, которые могут снизить риск заболеваний и преждевременного старения — а в нашем рационе никогда не может быть слишком много таких продуктов, верно?

    Есть ли какие-либо риски или побочные эффекты при употреблении грибов рейши?

    Возможные побочные эффекты или аллергические реакции на рейши включают сухость во рту, зуд во рту или горле, расстройство пищеварения или кровавый стул.Если вы испытываете какой-либо из этих эффектов, лучше в будущем воздерживаться от грибов рейши. Если вы принимаете какие-либо лекарства, поговорите со своим врачом, прежде чем принимать рейши — на всякий случай.

    Первоначально опубликовано 5 сентября 2018 г. Обновлено 25 сентября 2020 г.

    О, привет! Вы похожи на человека, который любит бесплатные тренировки, скидки на культовые велнес-бренды и эксклюзивный контент Well + Good.

    Добавить комментарий

    Ваш адрес email не будет опубликован.